Italian Journal of Gynaecology and Obstetrics
Transcript
Italian Journal of Gynaecology and Obstetrics
Italian Journal of Gynaecology & Obstetrics June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868 The Official Journal of the Società Italiana di Ginecologia e Ostetricia (SIGO) Quarterly Partner-Graf 1 Italian Journal of Gynaecology & Obstetrics The Official Journal of the Società Italiana di Ginecologia e Ostetricia (SIGO) Quarterly Partner-Graf Editor in Chief Paolo Scollo, Catania Editors Herbert Valensise, Roma Enrico Vizza, Roma Editorial Board Cervigni Mauro, Roma Chiantera Vito, Napoli Costa Mauro, Genova De Stefano Cristofaro, Avellino De Vita Davide, Salerno La Sala Giovanni Battista, Reggio Emilia Locci Maria Vittoria, Napoli Marci Roberto, Roma Monni Giovanni, Cagliari Ragusa Antonio Franco, Milano Sirimarco Fabio, Napoli Trojano Vito, Bari Viora Elsa, Torino Editorial Staff Roberto Zerbinati Serena Zerbinati Management, Administrative office Partner-Graf Srl - Via F. Ferrucci, 73 - 59100 Prato Tel 0574 527949 - Fax 0574 636250 E-mail: [email protected] The Italian Journal of Gynaecology & Obstetrics is a digital magazine. You can download it freely from www.italianjournalofgynaecologyandobstetrics.com or www.italianjog.com It. J. Gynaecol. Obstet. 2016, 28: N.2 Table of contents 5 Editorial. Oncofertility: a new medical discipline 7 Magnetic Resonance guided Focused ultrasound in uterine fibroids treatment: a cost analysis 9 Lymphoplasmacytic lymphoma or Plasmacytoma of the Ovary? A case report and a literature Review 17 Paolo Scollo Federica Romano, Sabrina Livolsi, Sarah Tardino, Francesca Ganguzza, Silvia Coretti, Matteo Ruggeri, Americo Cicchetti, Massimo Midiri, Adelmo Grimaldi, Paolo Scollo Tiziana Tomaselli, Drusilla Rollo, Francesco Tarsitano, Rosangela Trezzi, Claudio Crescini Correlation between Amniotic Fluid Index at Admission and Intrapartum Foetal Wellbeing in Women with Pre-labour Rupture of membranes at Term 21 Leiomyosarcoma of the vulva: a case report and review of the literature 29 Terrorism and the male to female ratio at birth: “Anni di Piombo” in Italy 32 Management of adnexal masses during the third trimester of pregnancy: a case report in twin-pregnancy and review of the literature 36 Laparoscopic treatment of Interstitial Ectopic Pregnancy: a Case Report 41 Transient osteoporosis and pathological fractures in pregnancy and puerperium: a case report and review of literature 45 The timing of elective caesarean delivery at term in Lombardy: a comparison of 2010 and 2014 48 Centiles of weight at term birth according to maternal nationality in a Northern Italian region 52 Altered lamin A expression as a possible prognostic biomarker in endometrioid endometrial cancers 57 Ashwini Mallesara, Pralhad Kushtagi Giuseppe Comerci, Venelia Picarelli, Emilia Crisanti, Giandomenico Raulli Victor Grech, Julian Mamo Luciana Cacciottola, Eugenio Solima,Giuseppe Trojano, Marzia Montesano, Mauro Busacca, Michele Vignali Marta Mancini, Francesco Cassanelli, Nicola Santomarco, Matteo Collamarini, Arianna Olivieri, Emilio Piccione, Michelangelo Boninfante Guido Formelli, Giorgio Scagliarini,Mauro Girolami, Giuseppe Mignani Giuseppe Trojano, Michele Vignali, Mauro Busacca, Sonia Cipriani, Giovanna Esposito, Camilla Bulfoni, Fabio Parazzini Fabio Parazzini, Sonia Cipriani, Giuseppe Bulfoni, Paola Agnese Mauri, Giorgia Carraro, Salvatore Andrea Mastrolia, Mauro Busacca, Giuseppe Trojano Lucia Cicchillitti, Giacomo Corrado, Mariantonia Carosi, Rossella Loria, Malgorzata Ewa Dabrowska, Giuseppe Trojano, Emanuela Mancini, Giuseppe Cutillo, Rita Falcioni, Giulia Piaggio, Enrico Vizza 5 Editorial Oncofertility: a new medical discipline Paolo Scollo In recent years vast progress has been made in the treatment of oncological diseases. Today the 5 year survival rate is estimated to be approximately 65% and for some cancers (lymphomas and breast cancer) more than 85%. This data clearly reveals that oncologists can no longer limit medical care within the realm of patient survival but forces them to take responsibility of patients’ quality of life carefully considering future prospects and the possibility of having children. The topic of fertility and procreation is increasingly gaining a voice in the field of oncology, not only due to the abovementioned improvement of the prospects towards healing but also as a result of the decrease in age of the onset of certain cancers and the average age at first pregnancy which have led to a rise in the number of women of childbearing age developing a disease before completing the reproductive path. With easy and regular access to information as well as a greater awareness of being able to play an active role in the care, more and more women are seeking informed and explicitly demanding to address issues related to fertility and procreation. As a result, the emergence of a new medical discipline arose combining oncology and reproductive medicine: Oncofertility. Specialists in oncologic gynecology with specific expertise in the field of infertility treatment and medically assisted procreation, deals with all issues related to fertility and procreation in oncology: fertility preservation, seeking pregnancy after cancer and cancer during pregnancy. ASCO (American Society of Clinical Oncology) provides recommendations on fertility preservation for cancer patients, highlighting the importance of discussing the risks of infertility with patients of childbearing age referring them to a specialist in order to evaluate the possibility of fertility preservation. Bringing the issue of fertility at diagnosis allows the patient to have the time to reflect, gather information and decide whether to undergo fertility preservation treatment. This choice should be offered to all women of childbearing age, regardless of the treatment they will undergo, and their procreative history. Fertility is in fact part of every young woman’s life, no matter what her maternity projects are. It is a resource that the patients may not be able to use during cancer. It is comforting and reassuring for many women knowing that they will be able to take up this issue once treatment ends (of course, with the use of their cryopreserved gametes or otherwise). At diagnosis the doctor should offer patients the opportunity and time to reflect on their reproductive health and fertility treatment options by providing them with the tools to make informed decisions which patients deem appropriate. The first wave of information on the issue of fertility should be generic, inviting patients to consider issues on fertility and procreation as well as providing patients with the option on whether to obtain specific information via a referral to a fertility specialist. Such information should be accompanied by a structured support pathway, providing a decision-making aid and a clear understanding of the potential benefits and risks of fertility preservation methods available today. Prof. Paolo Scollo S.I.G.O. President 7 V E M ICA UT E IA C G A O FARM INECOL IN G LA NATURA CHE AIUTA ClimaMEV IncontinenzaMEV VenaMEV FARMACEUTICA MEV - Strada Cassia Sud, 175 - 53100 Siena (SI) Tel. 0577 378091/ Fax 0577 379970 - www.farmaceutica-mev.it Italian Journal of Gynaecology & Obstetrics June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868 Magnetic Resonance guided Focused ultrasound in uterine fibroids treatment: a cost analysis Federica Romano 1, Sabrina Livolsi 1, Sarah Tardino 2, Francesca Ganguzza 2, Silvia Coretti 4, Matteo Ruggeri 4, Americo Cicchetti 4, Massimo Midiri 2,3, Adelmo Grimaldi 1,3, Paolo Scollo 5 LATO HSR Giglio, Cefalù, Palermo, Italy. Fondazione Istituto “San Raffaele - G. Giglio”, Cefalù, Palermo, Italy. 3 University of Palermo, Palermo, Italy. 4 Catholic University of the Sacred Heart, Rome, Italy. 5 Cannizzaro Hospital Catania, Italy. 1 2 ABSTRACT Introduction: uterine fibroids are the most common benign tumors of reproductive-age women. Different treatment options exist such as myomectomy, isterectomy, drugs and uterine artery embolization (UAE). Recently, technological progress provides noninvasive and conservative treatments such as MRgFUS (Magnetic Resonance-guided Focused Ultrasound Surgery). Objective: the aim of this study was to estimate the mean cost per treatment with MRgFUS. Methods: cost analysis was performed from the hospital perspective. Total costs were considered. They were defined as the sum of fixed costs (equipment and maintenance costs) and variable costs (personnel, materials and drugs costs). A deterministic approach was followed assuming that all patients require an equal resources utilization. The average materials and drugs consumption was quantified by reviewing medical records of patients treated and through experts’ opinion. Cost data were provided by the hospital accounting office. Results: the mean cost of a single treatment with MRgFUS was equal to € 2.101,85, lower than the DRG tariffs paid for alternative treatments. Conclusions: the MRgFUS could be an evaluable alternative to standard techniques, as it would allow an immediate improvement in patients’ quality of life and cost savings for the hospital as well as for healthcare system. SOMMARIO Introduzione: i fibromi uterini costituiscono la forma più diffusa di tumore benigno nelle donne in età fertile. Esistono diverse opzioni di trattamento quali miomectomia, isterectomia, trattamenti farmacologici ed embolizzazione dell’arteria uterina. Negli ultimi anni il progresso scientifico punta sempre di più all’uso di tecniche sempre meno invasive e più conservative tra le quali l’MRgFUS (Magnetic Resonance-guided Focused Ultrasound Surgery). Obiettivo: stimare il costo medio di un singolo trattamento tramite MRgFUS. Metodi: la valorizzazione delle risorse utilizzate è stata effettuata secondo la prospettiva dell’ospedale. Sono stati considerati i costi totali definiti come somma dei costi fissi (costo delle apparecchiature e delle manutenzioni) e dei costi variabili (costo del personale, dei materiali e dei farmaci). È stato seguito un approccio deterministico ipotizzando che tutti i soggetti trattati comportino un uguale uso di risorse. Il consumo medio di materiali e farmaci è stato quantificato mediante l’opinione di personale medico. I dati di costo sono stati forniti dall’ufficio contabilità e bilancio dell’ospedale. Risultati: il costo medio di un trattamento con MRgFUS pari € 2.101,85 risulta inferiore alle tariffe previste dai DRG per i trattamenti alternativi. Conclusioni: l’MRgFUS potrebbe essere una valida alternativa alle tecniche standard, in quanto permetterebbe un miglioramento immediato della qualità di vita delle pazienti e un possibile risparmio di costi per il sistema sanitario. Keywords: MRgFUS, uterine fibroids, costs, cost analysis. Correspondence to: [email protected] Copyright 2015, Partner-Graf srl, Prato DOI: 10.14660/2385-0868-35 9 It. J. Gynaecol. Obstet. 2016, 28: N.2 INTRODUCTION 10 Magnetic Resonance guided Focused ultrasound in uterine fibroids treatment: a cost analysis Uterine fibroids are the most common benign tumors in women in reproductive-age. In Italy, the diagnosed fibroids prevalence equals 23.6% (1). Common symptoms are abnormal vaginal bleeding, abdominal pressure, urinary or bowel discomfort, back pain and reproductive dysfunction. Diagnosis is based on clinical signs and gynecological examination which allows evaluating the increase in uterine volume, the degree of mobility and the possible site of myomatous nodule. Diagnostic imaging allows a precise determination of fibroids’ location and number. In addition, ultrasound examination usually provides all the necessary information to therapeutic planning, but magnetic resonance imaging (MRI) is necessary in particular cases. MRI, although more expensive than ultrasound examination, is more sensitive, less operatordependent and very precise in both location of fibroids and identification of stalked fibroids. MRI allows the diagnosis and the study of other pelvic pathologies, such as adenomyosis, which could modify treatment strategies and increase surgical risk(2). Imaging, therefore, is essential to confirm or rule out the diagnosis and to select the most appropriate and effective therapeutic strategy. Treatment options for symptomatic uterine fibroids include conservative (myomectomy) or radical (hysterectomy) surgery, drugs and uterine artery embolization (UAE). In recent years, the MRgFUS (Magnetic ResonanceGuided Ultrasound Surgery), a new non-invasive technique in the treatment of uterine fibroids, is emerging at a local and international level. This technique is based on the application of a focused ultrasound surgery (FUS) under real-time MRI guidance and control(3). Treatment is performed transcutaneously in a state of conscious sedation in order to have a constant feedback from the patient during the procedure. The FUS produces coagulative necrosis in a precise focal point (sonication) through a rapid increase of local temperature (60-80 °C) with a fibroid volume reduction relieving from the pathology associated symptoms(3). The innovation consists in the ability to monitor in real time the temperature variations of trading volumes and tissues crossed by the ultra sound. MR images are acquired before, during and after the session. Information from images are essential to plan treatment, to identify target volumes, to monitor in real time the evolution of the temperature and to find the exact point of ablation and distribution of the thermal dose. In 2004, the United States Food and Drug Administration (FDA) approved the MRgFUS(4), which obtained CE mark in 2007 and was recommended in United Kingdom (UK) by NICE (National Institute for Clinical Excellence) for uterine fibroids treatment in 2011. In Italy, the technique is being tested in five specialized centers such as Niguarda Ca’ Granda Hospital in Milan, Umberto I University Hospital in Rome, San Salvatore Hospital in L’Aquila, San Raffaele G. Giglio Hospital in Cefalù and P. Giaccone University Hospital in Palermo. The adoption of a new technology in healthcare is the result of a complex process that involves researchers, citizens, public institutions and industry. In recent decades, the widespread of highly costly innovative technologies and the increasing costs of research and development have been raising questions about the financial sustainability of healthcare systems. The major challenge for decision makers is to face potentially unlimited healthcare needs relying on limited resources availability. Therefore, it is essential to balance the need for a fair acknowledgement of the value of new technologies, on the one hand, and the request for costs containment on the other hand. Currently, a few studies have investigated the cost-effectiveness of MRgFUS versus the standard practice, showing that MRgFUS therapy results as a dominant strategy being characterized by lower costs and higher benefits. Results from a study conducted in the UK(5) show that MRgFUS is costsaving compared to the alternative treatments, yielding an average saving of about £295 per patient. Taking into account indirect costs, savings rise to more than £500 for each woman treated. A significant increase in benefits for patients in terms of QALYs (Quality Adjusted Life Years) is associated with this cost saving. In the U.S. study conducted by O’Sullivan et al. in 2009(6), the annual cost of uterine fibroids has been estimated at $2.2 billion and the MRgFUS proves to be a costeffective technology. Scientific evidence currently available suggests that MRgFUS exibits equal or superior efficacy than alternative treatments, in addition to relevant advantages of allowing rapid symptoms remission and being mini invasive technique. However, being an innovative technology not yet codified in any Regional Health Care Range of Fees, MRgFUS needs a careful evaluation of costs and benefits, in order to encourage rational and well-informed decisions. At the moment, there are no studies and cost analyses of MRgFUS in Italy. Magnetic Resonance guided Focused ultrasound in uterine fibroids treatment: a cost analysis Given this background, the aim of this study was to conduct a cost analysis in order to provide information on costs and potential savings associated with fibroids MRgFUS treatment in the Italian context. MATERIALS AND METHODS The cost analysis was performed from a hospital perspective and resource consumption was quantified taking into account costs actually incurred by the health facility. Data on treatment time and drugs consumption were derived from medical records of patients treated. Disposables consumption has been identified and quantified through experts’ opinion. Cost data were provided by the accounting office of San Raffaele Giglio hospital in Cefalù, Sicily. Total costs defined as the sum of fixed costs (equipment and maintenance) and variable costs (staff, supplies and drugs) were considered in the analysis. A deterministic approach was followed, assuming that costs are not patient-specific but equal for all patients, that is, all patients give rise to the same resource use. The equipment cost was the most relevant item among fixed costs. San Raffaele-Giglio Hospital utilizes the ExAblate 2100 system, by InSightec company. The ExAblate system consists of a patient mobile table and an emission and conduction system of ultrasound beam placed inside a last generation magnetic resonance (MR) GE Sigma HDtx. A workstation is used for planning and remote execution of treatment from the control room. Moreover, an emergency button inside can be used by the patient to report any problems during the treatment session. In order to compute the equipment cost per procedure, the number of treatments potentially feasible in one year was calculated by keeping in account work shifts, department logistic and needs and the annual depreciation rate was first calculated for the dedicated equipment, assuming that these devices have an average life cycle of 8 years. Since the MRgFUS system includes an ultrasound ExAblate 2100 and a MR GE Sigma HDTX, the depreciation for the two technologies was calculated separately. The depreciation rate per procedure for the device totally dedicated to MRgFUS treatment (ExAblate 20100) was obtained by dividing the annual depreciation rate by the number of procedures potentially feasible each year. With regard to the non-dedicated equipment (MR), the annual depreciation rate was divided by the total number of hours of equipment use so that the rate allocated to MRgFUS session F. Romano et al. was calculated on the basis of the number of hours devoted to MRgFUS treatments. The cost of maintenance per procedure was estimated through the same method. Staff costs refer to the cost of professional figures involved in the treatment of uterine fibroids with MRgFUS: radiologist, anesthesiologist, health physicist, nurse and radiology technician. For every unit of staff, costs were calculated based on their hourly wage (including direct and indirect charges), obtaining €49/h for the radiologist, €45/h for the anesthesiologist, €37,66/h for health physicist, €23,39/h for the nurse, €27,84/h for the radiology technician. The resulting hourly cost was then multiplied by the mean treatment time for each staff unit, as estimated on the basis of experience and evidences. As a result, the cost of each professional profile and overall staff cost was obtained. The duration of treatment of uterine fibroids with MRgFUS varies between 3 and 6 hours and depends mainly on the size of the fibroids and subjective parameters such as the threshold of tolerance of pain or the anxiety of the patient. For the purpose of this study an average duration of 4 hours per treatment was assumed, including the phase of preparation of the patient before surgery and discharge procedures. Supply costs included all the materials used for each procedure (from patient positioning to discharge) and therefore included anesthetic drugs, medical contrast mediums, dressing materials and other disposable items (gloves, coats, syringes, catheters and disposable kits). Dosage of drugs administered during the treatment was quantified by consulting medical records of the patients treated and through experts’ opinion. Data on anesthetic drugs consumption were derived from medical records of patients previously treated, and the average consumption was quantified according to experts’ opinion. Drugs and supplies cost for each treatment was obtained by multiplying their unit cost by estimated average consumption. Overhead expenses were assumed equal to 20% of total costs of MRgFUS treatment. Training cost of technical staff and follow up costs were not considered in the analysis. RESULTS To evaluate the mean cost per procedure, we considered equipment costs, staff, drugs and supplies costs. The overall equipment costs of € 1.854.846,20 for MRgFUS and € 2.034.000 for MR, include the cost of acquisition, as well as maintenance and upgrades. 11 It. J. Gynaecol. Obstet. 2016, 28: N.2 Magnetic Resonance guided Focused ultrasound in uterine fibroids treatment: a cost analysis Table 1. Equipment costs. Table 3. Supplies and drugs cost. Table 2. Staff cost per hour. 12 These cost items are reported in Table 1. Staff costs refer to hospital cost per hour including social charges (Table 2). Staff cost is a fixed cost for the hospital, but it could be considered variable in the current analysis since the share of cost per procedure depends on the duration of treatment. The cost of drugs and materials was obtained based on the estimated average consumption for each treatment. Supplies and drugs used are listed in Table 3 including their average consumption and unit costs. MRgFUS treatment requires a low consumption of materials and drugs: only the disposable KIT FUS is the most considerable cost driver in this category. Magnetic Resonance guided Focused ultrasound in uterine fibroids treatment: a cost analysis Table 4. Mean cost per treatment. Finally, the current cost-analysis resulted in an overall cost of € 2.101,85 for MRgFUS treatment. The mean costs per procedure are summarized in Table 4. DISCUSSION Uterine fibroids have a negative impact on the National Health Service budget in terms of F. Romano et al. costs of visits, hospitalizations and treatments. Considering the societal perspective the disease also imposes high costs to the general population in terms of absenteeism and productivity losses. In a cross-sectional study conducted on 1756 women from five European countries including Italy(1), 19.6% of Italian women reported to have been hospitalized. Of these more than 30% received pharmacological or surgical treatments. Uterine fibroids are traditionally treated surgically. Surgical approaches are usually associated with intra operative complications such as bleeding, deformation of the uterine cavity, risk of emergency hysterectomy and subsequent uterine rupture in future pregnancies(7). MRgFUS is an innovative technology in radiology for the local treatment of tumor lesions with the advantage of preserving the surrounding healthy tissues. In Italy, this procedure has not been codified yet in any Regional Health Care Range of Fees and, therefore, patients enrollment in clinical trials is still limited. The MRgFUS procedure was initially approved by FDA for premenopausal women with symptomatic fibroids who had no desire for future fertility. However, a few years later, based on the experience accrued in the field of MRgFUS and a deeper understanding of outcomes in pregnant women, the FDA amended the labeling of the device recommending to take into account desire for future pregnancy but not to consider this as an absolute contraindication. Women who desire further fertility can undergo MRgFUS since 2007(8). There is some scientific evidence on safety and efficacy of this technique in terms of lesion reduction, remission of symptoms and improved patients’ quality of life(3,9-13). In particular, two studies show a 33% volume reduction and significant symptoms improvement six months after MRgFUS(11, 12). Recent studies(14) on effectiveness of MRgFUS report a percentage of non-perfused volume (NPV) of 98%(3), 80%(15), 90%(16), 90 %(17) and 88%(18, 19). Moreover, an average rate of NPV greater than 70% was observed during 15 treatments carried out at San Raffaele Giglio hospital. In addition, several analyses(20-26) describe the effect of treatment on fertility (when this problem is associated with fibroids); in particular, Rabinovici et. al(27) reports findings of an high successful pregnancies rate after MRgFUS. Concerning re-intervention rates, one non-randomized study reported a rate of 4% at 6 months follow-up(13), whereas re-intervention rates range between 5% and 10% in studies with 12 months follow-up(28, 29) and between 14% and 13 It. J. Gynaecol. Obstet. 2016, 28: N.2 Magnetic Resonance guided Focused ultrasound in uterine fibroids treatment: a cost analysis 21.6% at month 24(30). A re-intervention rate of 15% was recorded during a study with 34 months follow-up period(28). Kim et al.(31) reported that 69% of patients did not need a second surgery three years after MRgFUS, while a study conducted in Germany(32) from 2002 to 2009 shows a reintervention rate of 66% after 60 month follow-up. Finally, the innovative technology is associated with fewer adverse events and complications than the myomectomy, as well as with a reduction of hospital stay and a rapid return to usual activities(7, 8, 28). As all innovative technologies, MRgFUS has relevant costs of investment and management against benefits previously described. In the present work, overall costs associated with MRgFUS treatment were quantified as the sum of fixed costs (equipment and maintenance) and variable costs (staff and supplies costs). The staff is multidisciplinary and highly specialized: medical personnel, nurses and technicians involved during pre-treatment, treatment and follow-up phases. Our cost analysis estimates a cost per procedure of 2,100 Euro. An average duration of four hours per procedure was hypothesized, although some sources indicate a shorter duration, from two to three hours per session(8), so that the cost per procedure could be lower. The estimated cost per MRgFUS procedure is lower than the Diagnosis Related Group (DRG) tariffs used for alternative therapies. More in detail, we can consider DRG tariffs 354 and 355 related to intervention on uterus and adnexa not for malignant neoplasm with or without complications, respectively, and DRG number 356 about female reproductive system reconstructive procedures(33). DRG tariff 356, equal € 2.901, being the lowest value among three DRG tariffs considered, but it is still higher than the cost of MRgFUS in uterine fibroids treatment herein estimated. Also the average value of these tariffs (€3.415) is more than 1,000 higher than our result. MRgFUS is a minimally invasive technique that allows patients to avoid intraoperative and postsurgical risks, to get total symptoms remission and to become pregnant if they are in reproductive-age. 14 This technique allows a maximization of available resources because it can be performed in a single session in outpatient setting. Evidence from the literature and our cost analysis suggest that focused ultrasound treatment results in an improvement in symptoms and patients’ quality of life and eventually in a cost saving for National Health Service. The use of an innovative technology like MRgFUS is usually associated with a lack of long-term data on efficacy and safety. In addition, although several preclinical studies on FUS treatments have been carried out, this option has not yet been studied in women with uterine fibroids within an experimental setting. Moreover, several analyses compare findings from women treated with uterine artery embolization (UAE) with conventional surgical procedures, but there are no studies that compare MRgFUS treatment with other conventional techniques. Even though international literature demonstrates the cost-effectiveness of MRgFUS, economic evaluations should be performed also in Italy, since resource consumption data are scarcely transferable from foreign contexts. This would allow to develop context-specific to comparisons of benefits and costs associated with MRgFUS with those of standard techniques, such as myomectomy, in order to inform decisions at a local or hospital level. Further developments of this research could concern long-term benefits and costs, including in the analysis follow-up costs (hospitalizations, visits) and indirect costs of absenteeism and productivity losses. Finally, our analysis is based on a small sample of patient in a single medical center, so it would be preferable to extend the analysis to the rest of the Italian medical centers in order to obtain more generalizable and representative results. DISCLOSURE This work was carried out as part of the project “Proteogenomica e Bioimaging in Medicina” (DM No. 45602) funded by MIUR (Italian Ministry of University and Research). Magnetic Resonance guided Focused ultrasound in uterine fibroids treatment: a cost analysis REFERENCES 1) Downes E, Sikirica V, Gilabert-Estelles J, Bolge SC, Dodd SL, Maroulis C, Subramanian D. (2010) The burden of uterine fibroids in five European countries Eur J Obstet Gynecol Reprod Biol. Sep;152(1):96-102. doi: 10.1016/j.ejogrb.2010.05.012. 2) Spies J, Roth A, Gonsalves S, Murphy-Skrzyniarz K. (2001) Ovarian function after uterine artery embolization: assessment using serum folliclestimulating hormone assay. J Vasc Interv Radiol 12:437-442. 3) Gizzo et. Al. (2013) Magnetic resonanceguided focused ultrasound Myomectomy: Safety, Efficacy, Subsequent Fertility and Quality of life Improvements, A systematic Review. Reproductive Science. 4) Manyonda IT, Gorti M. (2008) Costing magnetic resonance-guided focused ultrasound surgery, a new treatment for symptomatic fibroids. BJOG. Apr;115(5):551-3. doi: 10.1111/j.1471-0528.2007.01656.x. 5) Zowall H, Cairns JA, Brewer C, Lamping DL, Gedroyc WM, Regan L. (2008) Cost-effectiveness of magnetic resonance guided focused ultrasound surgery for treatment of uterine fibroids. BJOG 2008;115(5):653– 662. doi: 10.1111/j.1471-0528.2007.01657.x. 6) O’Sullivan AK, Thompson D, Chu P, Lee DW, Stewart EA, Weinstein MC. (2009) Cost-effectiveness of magnetic resonance guided focused ultrasound for the treatment of uterine fibroids. Int J Technol Assess Health Care 25(1):14–25. doi: 10.1017/ S0266462309090035. 7) Griffiths A, D’Angelo A, Amso N. (2006) Surgical treatment of fibroids for s ubfertility. Cochrane Database Syst Rev. Jul 19;(3):CD003857. 8) Al Hilli MM, Stewart EA. (2010) Magnetic resonanceguided focused ultrasound surgery. Semin Reprod Med. May;28(3):242-9. doi: 10.1055/s-0030-1251481. 9) Stewart E, Rabinovici J, Tempany C, Inbar Y, Regan L, Gastout B, et al. (2006) Clinical outcomes of focused ultrasound surgery for the treatment of uterine fibroids. Fertil Steril 85:22–9. 10) Harding G, Coyne KS, Thompson CL, Spies JB. (2008) The responsiveness of the uterine fibroid symptom and health-related quality of life questionnaire (UFS-QOL). Health Qual Life Outcomes 12;6:99. doi: 10.1186/1477-7525-6-99. 11) Morita Y, Ito N, Hikida H, Takeuchi S, Nakamura K, Ohashi H. ( 2007) Non-invasive magnetic resonance imaging-guided focused ultrasound treatment for uterine fibroids – early experience. Eur J Obstet Gynecol Reprod Biol. 139(2):199-203. 12) Fukunishi H., Funaki K, Sawada K, Yamaguchi K, Maeda T, Kaji Y. (2008) Early Results of Magnetic Resonance–guided Focused Ultrasound Surgery of Adenomyosis: Analysis of 20 Cases. J Minim Invasive Gynecol. 2008 Sep-Oct;15(5):571-9. doi: 10.1016/j. jmig.2008.06.010. 13) Taran F.A. C.M.C.Tempany, L.Regan, Y.Inbar, A.Revel, E.A.Stewart (2009) Magnetic resonanceguided focused ultrasound (MRgFUS) compared with abdominal hysterectomy for treatment of F. Romano et al. uterine leiomyomas. Ultrasound Obstet Gynecol. Nov;34(5):572-8. doi: 10.1002/uog.7435. 14) Stewart EA, Gostout B, Rabinovici J, Kim HS, Regan L, Tempany CM. (2007) Sustained Relief of Leiomyoma Symptoms by Using Focused Ultrasound Surgery, Obstetrics & Gynecology 110(2):279-287. 15) de Melo FC, Diacoyannis L, Moll A, TovarMoll F. (2009) Reduction by 98% in uterine myoma volume associated with signficant symptom relief after peropheral treatment with magnetic resonance imaging-guided focused ultrasound surgery. J Minim Invasive Gynecol. 16(4): 501-503. doi: 10.1016/j. jmig.2009.04.007. 16) Kim KA, Yoon SW, Yoon BS, Park CT, Kim SH, Lee JT. (2011) Spontaneous vaginal expulsion of uterine myoma after magnetic resonance-guided focused ultrasound surgery. J Minim Invasive Gynecol. 18(1):131-4. doi: 10.1016/j.jmig.2010.09.015. 17) Zaher S, Lyons D, Regan L. (2010) Uncomplicated term vaginal delivery following magnetic resonanceguided focused ultrasound surgery for uterine fibroids. Biomed Imaging Interv J. 6(2). doi: 10.2349/ biij.6.2.e28. 18) Zaher S, Lyons D, Regan L. J (2011) Successful in vitro fertilization pregnancy following magnetic resonance-guided focused ultrasound surgery for uterine fibroids. Obstet Gynaecol Res. Apr;37(4):370-3. doi: 10.1111/j.1447-0756.2010.01344.x. 19) Trumm CG, Stahl R, Clevert DA, Herzog P, Mindjuk I, Kornprobst S, Schwarz C, Hoffmann RT, Reiser MF, Matzko M (2013) Magnetic resonance imagingguided focused ultrasound treatment of symptomatic uterine fibroids: impact of technology advancement on ablation volumes in 115 patients. Invest Radiol. Jun;48(6):359-65. doi: 10.1097/RLI.0b013e3182806904. 20) Desai SB, Patil AA, Nikam R, Desai AS, Bachhav V. (2012) Magnetic Resonance-guided Focused Ultrasound Treatment for Uterine Fibroids: First Study in Indian Women. J Clin Imaging Sci. 2:74. doi: 10.4103/2156-7514.104307. 21) Millan Cantero H, Suárez J, Garcia E, Gomez E. (2011) First three cases in Spain of term pregnancy after treatment of uterine fibroid with non-invasive MRgFUS surgery, Caso clinico, Prog Obstet Ginecol. 54(11): 601-4. 22) Bouwsma EVA, Gorny K, Hesley G, Jensen JR, Peterson LG, Stewart EA. (2011) Magnetic Resonanceguided Focused Ultrasound Surgery for Leiomyomaassociated Infertility, Fertil Steril.96(1):e9-e12. doi: 10.1016/j.fertnstert.2011.04.056. 23) Yoon SW, Kim KA, Kim SH, Ha DH, Lee C, Lee SY, Jung SG, Kim SJ. (2010) Pregnancy and Natural Delivery Following Magnetic Resonance ImagingGuided Focused Ultrasound Surgery of Uterine Myomas Yonsei Med J. 51(3):451-3. doi: 10.3349/ ymj.2010.51.3.451 24) Hanstede MF, Tempany MC, Stewart EA. (2007) Focused Ultrasound Surgery of Intramural Leiomyomas May Facilitate Fertility: A Case Report, Fertil Steril. 88(2):497. 15 It. J. Gynaecol. Obstet. 2016, 28: N.2 Magnetic Resonance guided Focused ultrasound in uterine fibroids treatment: a cost analysis 25) Okada A, Morita Y, Fukunishi H, Takeichi K, Murakami T. (2009) Non-invasive Magnetic Resonanceguided Focused Ultrasound Treatment of Uterine Fibroids in a Large Japanese Population: Impact of the Learning Curve on Patient Outcome, Ultrasound Obstet Gynecol, 34:579-583. doi: 0.1002/uog.7454 26) Gavrilova-Jordan LP, Rose CH, Traynor KD, Brost BC, Gostout BS. (2007) Successful Term Pregnancy Following MR-guided Focused Ultrasound Treatment of Uterine Leiomyoma, Journal of Perinatology, 27:59-61. 27) Rabinovici J, Inbar Y, Eylon-Cohen S, Schiff E, Hananel A, Freundlich D. (2006) Pregnancy and live Birth after Focused Ultrasound Surgery for Symptomatic Focal Adenomyosis: A Case Report, Hum Reprod. 21(5):1255-9. 28) Gorny KR, Woodrum DA, Brown DL et al. (2011) Magnetic resonance-guided focused ultrasound of uterine leiomyomas: review of a 12-month outcome of 130 clinical patients. Journal of Vascular and Interventional Radiology 22: 857–64. doi: 10.1016/j. jvir.2011.01.458. 29) LeBlang SD, Hoctor K, Steinberg FL. (2010) Leiomyoma shrinkage after MRI-guided focused ultrasound treatment: report of 80 patients. American 16 Journal of Roentgenology 194: 274–80. doi: 10.2214/ AJR.09.2842. 30) Funaki K, Fukunishi H, Sawada K. (2009) Clinical outcomes of magnetic resonance-guided focused ultrasound surgery for uterine myomas: 24-month follow-up. Ultrasound Obstet Gynecol 34(5):584–9. doi: 10.1002/uog.7455. 31) Kim HS, Baik JH, Pham LD, Jacobs MA. (2011) MRguided high-intensity focused ultra-sound treatment for symptomatic uterine leiomyomata: long-term outcomes. Acad Radiol 18(8):970–6. doi: 10.1016/j. acra.2011.03.008. 32) Froeling V, Meckelburg K, Schreiter NF, ScheurigMuenkler C, Kamp J, Maurer MH, Beck A, Hamm B, Kroencke TJ. (2013) Outcome of uterine artery embolization versus MR-guided high-intensity focused ultrasound treatment for uterine fibroids: Long-term results. Eur J Radiol. 82(12):2265-9. doi: 10.1016/j.ejrad.2013.08.045. 33) Ministero della Salute Decreto 18 ottobre 2012. Allegato 1. Remunerazione prestazioni di assistenza ospedaliera per acuti, assistenza ospedaliera di riabilitazione e di lungodegenza post acuzie e di assistenza specialistica ambulatoriale. Italian Journal of Gynaecology & Obstetrics June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868 Lymphoplasmacytic lymphoma or Plasmacytoma of the Ovary? A case report and a literature Review Tiziana Tomaselli 1, Drusilla Rollo 1, Francesco Tarsitano 1, Rosangela Trezzi 2, Claudio Crescini 1 1 2 Department of Gynecology and Obstetrics, ASST Bergamo Ovest, Treviglio, Italy. Department of Pathology, ASST Papa Giovanni XXIII, Bergamo, Italy. ABSTRACT Extramedullary plasmacytoma (EMP) are rare neoplasms, most commonly occurring in the upper respiratory tract and rarely arise in the ovary. A 46-yearold woman presented with a history of abdominal mass associated with acute episodes of pain. A mobile abdomino-pelvic mass measuring 13.6 x 8.8 cm arising from the right adnexa. The patient subsequently underwent an exploratory laparotomy. We report the nine such case ever identified in the literature. These tumors are usually large at the time of presentation, more likely involving the left ovary and usually without evidence of disseminated disease. Adjuvant treatment for ovarian plasmacytomas is not clearly established; however, if complete surgical resection is achieved and no evidence of multiple myeloma is found, observation should be strongly considered. Keywords: extramedullary plasmacytoma, neoplasms, lymphoplasmacytic. INTRODUCTION Extramedullary plasmacytoma (EMP) are rare neoplasms, most commonly occurring in the upper respiratory tract and rarely arise in the ovary. Review of the literature reveals nine previously reported cases of ovarian plasmacytomas. Lymphoplasmacytic lymphoma is an indolent B cell lymphoma commonly with bone marrow and lymphonode involvement. Extranodal involvement si rare, and in the ovary extreamly rare(1). Unfortunately, there has been no consistent immunologic evaluation of such specimens nor has systematic workup or follow-up been discussed. Correspondence to: [email protected] Copyright 2015, Partner-Graf srl, Prato DOI: 10.14660/2385-0868-36 SOMMARIO Il plasmocitoma extramidollare (EMP) è una rara neoplasia, insorge più comunemente a livello delle vie respiratorie alte e più raramente a livello ovarico. Una donna di 46 anni si è presentata alla nostra attenzione con una storia di massa addominale associata a episodi acuti di dolore. Una massa addomino-pelvica delle misura 13,6 x 8,8 cm a carico dell’annesso di destra. La paziente successivamente è stata sottoposta a laparotomia esplorativa. Riportiamo di seguito il nono caso di questo tipo di tumore mai descritto in letteratura. Questi tumori sono solitamente di grandi dimensioni al momento della diagnosi, più spesso a carico dell’ovaio di sinistra e di solito senza evidenza di malattia disseminata. Non è chiaro il ruolo di un trattamento adiuvante per i plasmocitomi ovarici. Tuttavia, se si raggiunge la resezione chirurgica completa e non vi è nessuna evidenza di mieloma multiplo, dovrebbe essere fortemente considerata un condotta di osservazione. CASE REPORT A 46-year-old woman presented with a history of abdominal mass associated with acute episodes of pain. On vaginal and rectal examination, the uterus and cervix felt normal. A mobile abdominopelvic mass measuring 13.6 x 8.8 cm arising from the right adnexa. There was tenderness during examination. Bilateral parametria were supple and rectal mucosa was free. Except for a haemoglobin level of 10.3 g/dl, the remainder of the haemogram, serum biochemistry, chest X-ray, serum anti-HbsAg and HCV levels were normal. Serum cancer antigen Ca125: 25.2 U/ml; Ca15.3: 35.8 U/ml; Ca19.9: 6.1 U/ml, CEA: 0.4 ng/ml. An ultrasound revealed the presence of heterogeneous mass measuring 13,6x8,8 cm with 17 It. J. Gynaecol. Obstet. 2016, 28: N.2 Lymphoplasmacytic lymphoma or Plasmacytoma of the Ovary? A case report and a literature Review multiple septa. A CT scan of the abdomen showed a large pelvic mass measuring 12x12x14 cm arising from the right adnexa with a solid area measuring 8 cm. No ascites and others localitations. The patient subsequently underwent an exploratory laparotomy. During surgery a complete adhesiolysis of pelvic adhesion was made. A very vascular right ovarian mass measuring 15x14x10 cm, with solid cystic areas adherent to the uterus and the sigma rectum, was seen. The cervix, appendix, omentum, and upper abdominal viscerae were normal. Left tube and ovary and right tube were removed previously. Bulky nodes were not palpable along the paraaortic and iliac regions. An intraoperative frozen section revealed the presence of poorly differentiated neoplasm carcinoma. An extrafascial hysterectomy with oophorectomy was performed. No residual tumor. Blood loss was 900 ml. She was submitted to blood transfusion and was discharged on the eighth post-operative day. Post-operative PET was negative, conversely CT scan showed millimetric peritoneal nodules. The patient was referred to the haematological oncology service and was evaluated by the multiple myeloma program to stage her plasma cell dyscrasia (complete blood count, serum protein electrophoresis, serum immunofixation, urine immunofixation and urine protein electrophoresis). She also underwent a bone marrow aspirate and biopsy with 10% plasma cells. In view of the limited anatomical disease in our case, the patient is receiving follow-up care and there wasn’t any evidence of recurrence clinically in the last 16 months. Medical scans in the follow up included a CT chest, abdomen and pelvis and abdominal ultrasound. The Adjuvant treatment is not clearly established; however, if complete surgical resection is achieved and no evidence of multiple myeloma is found, observation should be strongly considered(2). PATHOLOGY The isthological examination reveald a diffuse ovarian infiltrate composed by clonal well differentiated plasmacells . The neoplastic population was CD138 positive and CD20 negative, with clonal expression of Lambda ligth chain (Figure 1). It requested a second opinion on slides reading. 18 Figure 1. Sheets of plasmablasts. DISCUSSION EMP is a rare primary soft tissue plasma cell tumor. These tumors are known to originate in a variety of anatomical sites, although more than 90% have been reported as developing in the head or neck area, and most of these arise in the upper respiratory passages. EMP constitute fewer than 5% of all plasma cell tumors, generally remain localized, and are more responsive to therapy(2-10). Voegt initially reported a case of ovarian plasmacytoma in 1938; he described the tumor as the size of a fist(11). Since that time, eight other cases, have been reported(12-16) (Table 1). Review of the reported cases reveals inconsistent evaluations; review of the literature reveals that in the early years the principal form of treatment of EMP was surgery for accessible lesions. However, the current treatment of choice is radiotherapy for localized disease(2,5,8,10,17,18). The median survival of patients with EMP is reported to vary from 4-10 years(2,17,18). Only one experience exists regarding adjuvant postsurgical therapy for patient with extramedullary plasmacytoma of the ovary. Shakuntala et al. reported a patient start three cycles of single agent carboplatin for rapidly refilling ascites and pleural effusion(19). In summary, extramedullary plasmacytomas is an exceedingly uncommon tumor, especially with solitary involvement of the ovary. We report the nine such case ever identified in the literature. These tumors are usually large at the time of presentation, more likely involving the left ovary and usually without evidence of disseminated disease. Adjuvant treatment for ovarian plasmacytomas is not clearly established; however, if complete surgical resection is achieved and no evidence of multiple myeloma is found, observation should be strongly considered(2). A clonal plasma cell proliferation can be the expression of a plasmacitoma or a lymphoplasmocytic lymphoma with an extreme plasma cells differentiation. Lymphoplasmacytic lymphoma or Plasmacytoma of the Ovary? A case report and a literature Review This case propose the differential diagnoses between this two entities. Although the CD20 negativity the patient has also a nodal envolvement so the clinical data suggested the final diagnosis of B lymphoma. Primary lymphoma of ovary is rare and can be of Burkitt’s, T or B cell types. Lymphomas secondarily involving ovary are seen in up to 25% of advanced cases. Majority of cases will have concomitant lymphadenopathy. Grossly, the ovarian surface is smooth and parenchymal involvement can be partial or complete. Bi-laterality is encountered in 60% of cases. Burkitt, diffuse large B cell, follicular T. Tomaselli et al. lymphoma, plasmacytoma, Hodgkin lymphoma and many others were reported(20) (Table 1). Written informed consent was obtained from the patient for publication of this Case Report and any accompanying images. The author(s) declare that they have no competing interests. All authors deny any financial and personal relationships with other people or organizations that could inappropriately influence their work and affirm that the manuscript has not been published previously and is not being considered concurrently by another publication. Table 1. Clinical characteristics, pathologic variables, Ca125 and outcome for the nine reported cases of ovarian plasmacytoma. 19 It. J. Gynaecol. Obstet. 2016, 28: N.2 REFERENCES Lymphoplasmacytic lymphoma or Plasmacytoma of the Ovary? A case report and a literature Review 1) A. Albawardi, A. Casella, S.S. Almarzooq: Lymphoplasmacytic lymphoma-Waldenström macroglobulinemia: an unusual presentation in ovaries, fallopian tubes and uterine cervix. Int J Clin Exp Med. 2013; 6(5): 346–350. 2) Emery JD, Kennedy AW, et al: Plasmacytoma of the ovary: a case report and literature review. Gynecol Oncol 73: 151-154, 1999 3) Dolin S, Dewar JP: Extramedullary plasmacytoma. Am J Pathol 32:83-103, 1956 4) Batsakis JG, Fried GT, Goldman RT, Karlsberg RC: Upper respiratory tract plasmacytoma. Arch Otolaryngol 79:613-618,1964 5) Poole AG, Marchetta FC: Extramedullary plasmacytoma of the head and neck. Cancer 22:14-21,1968 6) Castro EB, Lewis JS, Strong EW: Plasmacytoma of paranasal sinuses and nasal cavity. Arch Otolaryngol 97:326-329,1973 7) Webb HE, Harrison EG, Masson JK, Remine WH: Solitary extramedullary myeloma (plasmacytoma) of the upper part of the respiratory tract and airway. Cancer 15:1142-1155, 1962 8) Wiltshaw E: The natural history of extramedullary plasmacytoma and its relation to solitary myeloma of bone and myelomatosis. Medicine 55:217-237,1976 9) Woodruff RK, Whittle JM, Malpas JS: Solitary plasmacytoma. I. Extramedullary soft tissue plasmacytoma of bone. Cancer 43: 2344-22347, 1979 10) Knowling MA, Harwood AR, Bergsagel DE: Comparison of etramedullary plasmacytomas with 20 solitary and multiple plasma cell tumors of bone. J Clin Oncol 1:255-262,1983 11) Voeget H. Extramedullari plasmacytoma: Virchows Arch (Pathol Anat) 302:497-508,1938 12) Bambirra EA, Miranda D, Magalhaes GMC: Plasma cell myeloma simulating Krukenberg’s tumor. South Med J 75:511-512,1982 13) Hautzer NW: Primary plasmacytoma of ovary. Gynecol Oncol 18:115-118, 1984 14) Talerman A: Nonspecific tumors of the ovary, including mesenchymal tumors and malignant lymphoma. In Kurman RJ (ed): Blaustein’s pathology of the female genital tract, 3rd ed, New York, SpringerVerlag, 1987, p738 15) CooK HT, Boylston AW: Plasmacitoma of the ovary. Gynecol Oncol 29: 378-381, 1988 16) Andze G, Pagbe JJ, Tchokoteu PF, et al: Le plasmacytome solitaire extraosseux ovarien. J Chir 130:137-140, 1993 17) Mayr NA, Wen BC, Hussey DH, et al: The role of radiation therapy in the treatment of solitary plasmacytomas. Radiother Oncol 17: 293-303, 1990 18) Wasserman TH: Diagnosis and management of plasmacytomas. Oncology 1(2): 37-41,1987 19) Shakuntala PN, Praveen SR, Shankaranand B, et al: A rare case of plasmacytoma of the ovary: a case report and literature review. Ecancer 2013, 7:288 20) Shacham-AbulafiaA. Nagar R et al. Lymphoma of hte ovary: case report and review of the literature. Acta Heam 2012;129:169-174 Italian Journal of Gynaecology & Obstetrics June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868 Correlation between Amniotic Fluid Index at Admission and Intrapartum Foetal Wellbeing in Women with Pre-labour Rupture of membranes at Term Ashwini Mallesara 1, Pralhad Kushtagi 1 Department of Obstetrics and Gynecology, Kasturba Medical College (A Constituent of Manipal University), Mangaluru 575001, India. 1 ABSTRACT Objective: To evaluate measurement of Amniotic Fluid Index (AFI) at admission as a predictor of intrapartum foetal compromise in women with pre-labour rupture of membrane (PROM). Material and Methods: Sonographic record of AFI was made on singleton pregnancies at early and full term admitted in early labour with PROM. The clinical team treating the cases was not aware of the admission AFI values. The labour outcome was studied with respect to the AFI values to find out influence of duration of rupture of membranes (DROM) on intrapartum foetal status, neonatal outcome and infective morbidity. Results: Higher proportion of cases with non-reassuring foetal status (NRFS) was found when admission AFI was less than 5 cm. No baby with low Apgar was born to women recording admission AFI of at least 8 cm. NRFS was not influenced by DROM or period of gestation. High specificity (82%) and negative predictive value (81.9%) was found with low AFI for NRFS. Conclusion: AFI at admission in women with PROM is not a sensitive determinant to predict occurrence of intrapartum foetal compromise. But, AFI less than 5 cm is associated with higher incidence of NRFS in primipara, women aged between 20 to 25 years, or those receiving oxytocin. Keywords: Amniotic fluid index; labour admission test; pre-labour rupture of membranes; intrapartum foetal compromise. INTRODUCTION It is not uncommon to find women reporting to labour ward with ruptured membranes much before start of labour uterine contractions. The Correspondence to: [email protected] Copyright 2015, Partner-Graf srl, Prato DOI: 10.14660/2385-0868-37 SOMMARIO Obiettivo: Valutare la misura dell’indice di fluido amniotico (AFI) al ricovero come fattore predittivo di compromissione fetale perinatale nelle donne con rottura della membrana prima del travaglio (PROM). Materiale e metodi: Il dato ecografico di AFI è stato fatto su singoli parti prematuri e a scadenza del termine, in donne ricoverate prima del travaglio con PROM. Il team clinico che ha trattato i casi non era a conoscenza dei valori AFI al momento del ricovero. Il risultato del lavoro è stato studiato nel rispetto dei dati AFI per trovare l’influenza e la durata della rottura delle membrane (DROM) sullo stato fetale perinatale, l’outcome neonatale e la morbidità infettiva. Risultati: La più alta percentuale dei casi con stato fetale non rassicurante (NRFS) è stato riscontrato quando, all’ammissione AFI, era inferiore ai 5 cm. Nessun bambino con Apgar basso è nato da donne con valore di ammissione AFI di almeno 8 cm. NRFS non è stato influenzato dal DROM o dal periodo di gestazione. Un’alta specificità (82%) e un valore predittivo negativo (81,9%), è stato trovato in pazienti con AFI basso per NRFS. Conclusione: Il valore AFI al ricovero in donne con PROM non è un fattore sensibilmente determinante nel predire episodi di compromissione fetale perinatale. Ma un valore AFI inferiore a 5 cm è associato a una maggiore incidenza di NRFS in donne primipare, donne di età compresa fra i 20 e i 25 anni o quelle che ricevono ossitocina. pre-labour rupture of membranes (PROM) is seen in 10% of all pregnancies. The resulting reduction in amniotic fluid volume in cases with PROM will lead to umbilical cord and placental compression, and ascending infection. This is reflected in increased incidence of non-reassuring foetal/ neonatal outcomes during labour(1), foetal 21 It. J. Gynaecol. Obstet. 2016, 28: N.2 and maternal infection(2, 3), and perinatal death(4). These patients also have a high caesarean rate due to severe variable decelerations(1). The concept of admission test in early labour– labour admission test (LAT) using either an initial period of foetal heart rate monitoring(5,6) or the foetal response to acoustic stimulation(7) was an attractive suggestion because it provided an assessment of current foetal condition and risk. The studies have shown that the LATs cannot be recommended as a screening test for foetal compromise in low risk women since the sensitivity is too low and false positive rates are high(8). Measurement of amniotic fluid index (AFI) or volume forms an important and influential component of antepartum foetal surveillance through biophysical profiling. Since significant number of women present with ruptured membranes prior to onset of labour, the present study was designed to evaluate the effectiveness of AFI at admission in labour as a predictor of foetal status by correlating incidence of non-reassuring foetal status with amniotic fluid index, and finding out relationship of rupture of membranes with maternal and neonatal outcome. MATERIALS AND METHODS 22 A prospective observational study was carried out in the Labour ward Facility of District Government Hospital, attached to a Medical College, from July 2012 to July 2013. The Study was approved by Institutes Scientific and Ethics Committee. All the cases recruited were informed of the study and their written consent was obtained. Sample size required was calculated on the basis of incidence for non- reassuring foetal status (15%) in the hospital to obtain the results with 95% confidence interval. Consecutive consenting 100 women with singleton live term pregnancies with pre-labour rupture of membranes were recruited to the study. Women were with cephalic presentation of foetus and vertex as presenting part and had known gestational age. Women excluded were high risk pregnancies, uterus with fibroid/ scar/ anomalies, medical disorders complicating pregnancy (anaemia, gestational diabetes, hypertension), foetal growth restriction, non-reassuring foetal status at admission, choriamnionitis at admission and women in active phase of labour (cervix dilation ≥ 3 cm). AFI as admission test in PROM For the purpose of the study following definitions and descriptions were considered: (a) Term pregnancy: Period of pregnancy from 37 completed weeks to 40 weeks was considered as term. This period was further subdivided in to early term (37 to 38.6 weeks) and full term (39 to 40 weeks). (b) Pre-labour rupture of membranes: Women with complaint of leak of amniotic fluid without uterine contractions or in early labour (cervix up to 3 cm dilatation). The amniotic fluid leak should be visible on speculum examination and the fluid should have alkaline pH. (c) Known gestational age: The calculated period of gestation in weeks of parturient with regular 28-30 day menstrual cycle and the known last menstrual period (LMP) in agreement with either uterine size at the pelvic examination in 1st trimester and/ or ultrasound determined period of gestation. (d) Non-reassuring foetal-neonatal status (NRFS): Presence of any of the following meconium stained liquor during labour, foetal heart rate (FHR) variations during labour, Apgar of ≤ 7 at 1 and/ or 5 minutes, or neonatal intensive care unit (NICU) stays, i.e., newborns requiring transfer to NICU soon after birth and monitoring for more than 24 hours. (e) Chorioamnionitis: was considered to be present if maternal fever of >37.8°C was present with any two of the following – maternal tachycardia of > 120 beats/ min, foetal tachycardia 160 beats/ min, purulent or smelling amniotic fluid vaginal discharge, uterine tenderness, or maternal leucocytosis > 15,000 cells/ mcL. The particulars regarding pregnancy and the findings at admission and follow-up were recorded on the format designed for the study. At the outset, (a) Speculum examination with sterile Sim speculum was performed to confirm the rupture of membranes. Rupture of membranes was confirmed if the pooling of amniotic fluid on speculum was seen and determination of alkaline pH of the fluid using red litmus paper. Change of colour to blue on contact with fluid was taken as alkaline. (b) A vaginal swab was taken for culture studies, and Inj. Ampicillin 2g followed by 500mg 6th hourly was administered, intravenously. (c) A single digit vaginal examination was performed with aseptic observations to note cervical dilatation, effacement, station of the presenting part, and to assess pelvic capacity for ruling out disproportion. A. Mallesara et al. AFI as admission test in PROM to: Following recruitment, women were subjected (a) Admission cardiotocography: to obtain foetal heart traces for a minimum of 20 minutes using tocodynamometer (EDAN Foetal Monitor, China; Model F3). The machine had the paper speed of 3cm/minute. Foetal heart rate traces obtained at admission were interpreted as ‘reassuring’ and ‘non-reassuring’(9). (b) Admission record of AFI: Amniotic fluid index was recorded using ultrasound unit (Philips HD7 XE BOTHELL, WA USA) equipped with 3.5MHz curvilinear transducer. The four-quadrant AFI(10) was measured and to study its effect the cases were grouped, for the purpose of the study, as with low (< 5 cm), average (5.1-8 cm), or high (> 8 cm) AFI. Blinding policy in the study: The measured AFI was not informed to the obstetrician managing the cases in the labour ward. The investigator knowing the value of measured AFI was not involved in the labour management of any of the cases. Foetal and maternal monitoring: The maternal wellbeing in labour was monitored by recording pulse rate and blood pressure at 30 minutes interval. Foetal well-being was monitored by foetal heart trace recording and inspecting the colour of liquor on vulvar diaper. Labour-delivery management: Labour was managed as per the hospital policy. Labour was either induced with oxytocics or expectant management was carried out. Progress of labour was monitored and documented on modified WHO partogram. Episiotomy was made to all primigravidas and in multigravidas when needed. Delivery of the head was assisted by Ritgen manoeuvre and oro-nasopharyngeal suctioning done following the delivery of the baby. After the placental delivery piece of chorioamnion near the placental edge was collected for culture studies. Neonatal Care: Asphyxia status of the new-born was assessed by Apgar at 1 and 5 minute. Neonatal assessment included estimation of the gestational age by new Ballard scores, birth weight and recognition of congenital abnormalities and soft tissue injuries if any. In cases where meconium stained liquor was present, laryngoscopic visualization of the foetal larynx and glottis for meconium was done and if detected, endotracheal suctioning through a suction catheter was carried out. Baby was kept in neonatal intensive care unit for observation and management. Any neonate requiring stay in neonatal intensive care unit, the duration and the indication for the same was noted. Work-up for sepsis: Maternal septic work-up included high vaginal swab for culture sensitivity (collected at first examination), determination of total leucocyte count and placental membrane culture examination. Neonatal septic work-up consisted estimation of C-reactive protein, total leucocyte count and study of peripheral smear for band neutrophils. The route of delivery, Apgar scores, birth weight, and information about septic workup, neonatal problems, and perinatal deaths were recorded in the designed proforma. Statistical analysis: Outcome of labour, delivery and neonate were studied in relation to AFI. The statistical methods applied to analyse the data were chi square test and Fisher’s t test. To validate the significance of admission AFI, the cases were grouped as those with under or more than 5 cm of AFI. A statistical package SPSS version 17.0 was used and p value <0.05 was considered significant. RESULTS The mean age of parturient was 25 ± 4.03 years with majority (47%) in the age group of 2025 years. Nullipara formed 2/3rd of the study population. Nearly half (56%) of the pregnancies were at early term gestation. Normal AFI of >8 cm was found in 47% of parturients and low AFI of <5 cm was recorded in 17% of women with PROM. The mean AFI was 7.9 ± 2.7 cm. Almost all cases had reported early on occurrence of leaking, except 4 women who spent more than 12 hours at home awaiting onset of labour or in transit. The mean duration of PROM at admission was 4.1 ± 3.2 hours. The evidence of compromise was identified in 18 foetus/ neonates of 100 parturients. Nonreassuring foetal heart trace was recorded in 38.9 percent and 22.2 percent were associated with low Apgar scores of these 18 cases with non-reassuring foetal-neonatal status. The incidence of caesarean delivery was 12 percent in the study group. Although cases with foetal growth restriction were excluded there were 19 percent neonates with birth weight lesser than 2.5 kg. However, the mean birth weight was 2.8 ± 0.4 kg. An effort was made to explore and find out the association of AFI estimates, if any, with some of the patient characteristics and pregnancy outcome. 23 It. J. Gynaecol. Obstet. 2016, 28: N.2 Proportion of cases with admission AFI of less than 5 cm was found to be higher in the peripheral age groups being highest (40%) among the age cohorts of ≤ 20 years (p= 0.655). Incidence of less AFI (<5 cm) did not appear to be different in the two parity groups, despite number of nullipara being two-times that of multipara in the study. The proportions of cases with lesser AFI were similar across the term gestational period phases - early and full term pregnancies. There was only one woman with less AFI in the group who had PROM beyond 12 hours when reporting to hospital. Point of interest to note was despite varying amount of time since leak, proportion of cases with average to high AFI was similar (Table 1). Association between AFI groups and the admission-delivery interval (ADI) showed that women with higher AFI took longer time to deliver (4.2 ± 1.1 and 11.4 ± 5.1 hours in women with mean AFI 7.2 ± 2.6 and 8.2 ±2.7 cm, respectively). No definite trend was seen with caesarean delivery and AFI stratification. However, in women with AFI of lesser than 5 cm, the decision for caesarean was much commoner (4 of 12 vs. 13 of 88 cases with caesarean and vaginal delivery, respectively; p =0819) (Table 2). No association was seen for occurrence of Table 1. AFI and maternal characteristics (N=100). 24 AFI as admission test in PROM abnormal foetal heart trace and AFI at admission. Abnormal FHR trace was recorded in 11.8% of women with AFI of lesser than 5 cm (2 of 17 cases) and it was 6% in women with admission AFI beyond 8 cm (5 of 83 cases; p=0.2). There were 4 cases with meconium stained amniotic fluid, but none in the group with AFI of < 5cm at admission. There were 4 babies with low Apgar among 53 mothers who had admission AFI of up to 8 cm (7.5%) and no baby was born with low Apgar when mother’s admission AFI was higher than 8 cm. If the child required transfer to intensive neonatal care nursery within 24 hour of birth and stay for more than 12 hours was considered to indicate indirectly the intrapartum insult. Even though there were 17 women with AFI less than 5 cm none of them had their babies requiring NICU transfer (Table 3). The interdependency of maternal characteristics with AFI at admission on the effect of foetus/ neonate was explored. There were a total of 18% occurrences with compromised foetal outcome as indicated by abnormal FHR traces, appearance of meconium with liquor, low Apgar of lesser than 7 at 1 or 5 minutes of birth or the early requirement for neonatal intensive care. Incidence of nonreassuring foetal status was higher if the mother had low admission AFI of less than 5 cm, more so AFI as admission test in PROM A. Mallesara et al. Table 2. AFI and Labour-Delivery (N=100). Table 3. AFI and Non-Reassuring Foetal-Neonatal Status (N=100). if she was aged between 20-25 years (p=0.243) and was a nullipara (p=0.208). Period of gestation and duration after rupture of membranes did not show any meaningful relationship with occurrence of NRFS. In women who required oxytocin for induction of labour had higher incidence of NRFS if AFI at admission was less than 5 cm (p=0.654). The duration in labour did not show any correlation with occurrence of NRFS. Influence of NRFS did not appear to dictate mode of delivery since distribution of cases according to admission AFI 25 It. J. Gynaecol. Obstet. 2016, 28: N.2 and compromised foetal status in them was similar between vaginal and caesarean delivery (Table 4). There were only two neonates that showed perinatal infection. Both of their mothers had average AFI and the total duration after rupture of membranes till delivery was 17 hours 20 minutes and 9 hours 10 minutes, respectively. (p=0.483) Only case of chorioamnionitis was in one who had total duration after rupture of membranes of 23 hours and ADI of 20 hours. Her labour was induced with oral PGE1. She had above average AFI of 11.6 cm at admission. (p=0.558). These AFI as admission test in PROM cases of infective morbidity were associated with women having admission AFI of > 5 cm and they had rupture of membranes to delivery interval of > 12hours. To validate the significance of admission AFI, the cases were grouped as those with under or more than 5 cm of AFI. Number of cases with nonreassuring foetal status was 3 of 17 with less than 5 cm AFI group and that in the other group were 15 cases of 83 women. Based on these findings, the AFI of <5 cm at admission, although found to have poor sensitivity and positive predictive value, it Table 4. Proportion of NRFS cases in relation to some maternal characteristics and delivery factors in relation to AFI at admission (n,%). 26 AFI as admission test in PROM Table 5. Validation of low AFI at admission as predictor of intrapartum nonreassuring foetal-neonatal status. demonstrated to have acceptable high specificity higher negative predictive value (Table 5). There were no cases of stillbirths, early neonatal deaths and maternal deaths in the study group. DISCUSSION Every foetus is prone to develop intrapartum hypoxia as labour is a process of repeated foetal hypoxic events. It is difficult to predict with accuracy which foetus would develop hypoxia in labour and the degree of hypoxia the baby would undergo. Mostly because of presence of differing risk factors and different indicators the reported incidence of intrapartum foetal compromise has a wide variation. Women with AFI < 5 cm have been shown to be at significantly higher relative risk of 6.83 for caesarean delivery if the foetal heart trace showed variable decelerations(11). Other studies have reported a high 25% occurrence of foetal distress(6). The figure for non-reassuring foetal status in the present study was 17% in women with AFI < 5 cm. The protective importance of intact membranes is known and rupture of it prior to the onset of labour or in early labour does impart high risk nature affecting foetal wellbeing. The participant characteristics like age and parity did not appear to be the influencing factors for occurrence of PROM in the studied group. The reason for preponderance of nulliparous women in the recruited could be because of increased alertness and apprehension in them coupled with multipara reporting late in advanced labour for being indifferent to the appearance of leak having gone through labours earlier. It is only A. Mallesara et al. an assumption. Because of the early reporting when leak occurred, in a nullipara lesser AFI at admission may be considered as a significant finding. It was found that nullipara with AFI of < 5 cm had higher proportion of cases with nonreassuring foetal status (Table 4). Majority of the cases had AFI >8 (47%) and mean duration of PROM at admission was 4.13 hours in the present study. This can be accounted by increased health awareness resulting in timely reporting to the labour ward. The finding of women with AFI < 8 cm having shorter admission-delivery interval than the counterparts with higher AFI make one to search for the answer for variation in compromise to foetal wellbeing in the mean AFI values among AFI cohorts. The cases with AFI < 5 cm in whom labour was induced and maintained with oxytocin infusion the occurrence of intrapartum foetal compromise was commoner. In the absence of intrauterine pressure monitoring data it will be difficult to comment on the finding. It may be incidental that most patients in other group receiving prostaglandin preparations had AFI of > 5 cm. Moreover administration of different oxytocics was not randomized and oxytocin was the most frequently used preparation (67 of 93 cases, 72%). The incidence of operative intervention to deliver for foetal compromise was reported to be 3times commoner in low AFI groups(12). The present study noted frequency of caesarean delivery twice than vaginal delivery in the group with AFI < 5 cm. It was seen that even with the not-so stringent criterion used for defining non-reassuring foetal status, heir occurrence was similar in both the delivery modes. Despite patients with PROM having admissiondelivery interval of more than 12 hours forming nearly 3rd of the study group, the infective morbidity and foetal compromise was similar in the two cohorts of labour duration on either side of 12 hours. It is in contrast to reported 68.4% overall incidence of significant maternal and foetal infection rates in the study group with low AFI. That study(13) also included preterm pregnancies with expectant management. Use of liberal antimicrobials could be the reason behind the only 1 and 2% of maternal and perinatal infection, respectively in the present report. The present study accorded a high specificity (82%) and negative predictive value (81.9%) to the predictability of admission AFI of < 5 cm in women with PROM to pre-suggest possibility of intrapartum foetal compromise. But, the 27 It. J. Gynaecol. Obstet. 2016, 28: N.2 sensitivity of the indicator was a poor 17%. The good results for prediction by Baron and associates (1995)(11) based on study with intact membranes could not be reproduced and probably they cannot be extrapolated to the situations with ruptured membranes (Table 5). The higher specificity and negative predictive values attached to the low AFI in identifying pregnancies likely to develop intrapartum foetal non-reassuring nature based on the observations made in the present study appear substantial in the light of incorporated blinded component that kept the treating obstetricians unprejudiced. To look in to influence of confounding variables such as maternal characteristics including socioeconomic and educational status of the patient REFERENCES 28 1) Moberg LJ, Garite TJ, Freeman RK. Foetal heart rate patterns and foetal distress in patients with preterm premature rupture of membranes. Obstet Gynecol 1984; 64:60–64 2) Lanier LR, Scarbrough RW, Ficklingim DW, Baker RE Jr. Incidence of maternal and foetal complications associated with rupture of membranes before the onset of labour. Am J Obstet Gynecol 1965; 93:398-404 3) Gonik B, Bottoms SF, Cotton DB. Amniotic fluid volume as a risk factor in preterm PROM. Obstet Gynecol 1985; 65:456-459 4) Naeye RL. Causes of perinatal mortality in the US Collaborative Perinatal Project. JAMA 1977; 238:228-229 5) Ingemarsson I, Arulkumaran S, Ingemarsson E, Tambyraja RL, Ratnam SS. Admission test: a screening test for foetal distress in labour. Obstet Gynecol 1986; 68:800-806 6) Sarno AP Jr, Ahn MO, Phelan JP. Intrapartum amniotic fluid volume at term; association of ruptured membranes, oligohydramnios and increased foetal risk. J Reprod Med 1990; 35:719-723 7) Ingemarsson I, Arulkumaran S, Paul RH, Ingemarsson E, Tambyraja RL, Ratnam SS. Foetal acoustic AFI as admission test in PROM and labour-delivery events, type of oxytocic used more number of cases need to be studied under those cohort subgroups. ACKNOWLEDGEMENT Authors thankfully acknowledge Clinical unit heads of Obstetrics and Gynaecology and Medical Superintendent of the Lady Goschen Hospital, Mangaluru for permission given to carry out the project. DECLARATION Authors declare no conflict of interest. stimulation in early labour in patients screened with the admission test. Am J Obstet Gynecol 1988; 158:70-74 8) Blix E, Oian P. Labour admission test: an assessment of the test’s value as screening for foetal distress in labour. Acta Obstet Gynecol Scand 2001; 80:738-743 9) Vintzileos AM, Antsaklis A, Varvarigos I, Papas C, Sofatzis I, Montgomery JT. A Randomized Trial of Intrapartum Electronic Foetal Heart Rate Monitoring versus Intermittent Auscultation. Obstet Gynecol 1993; 81:899-907 10) Phelan JP, Smith CV, Broussard P, Small M. Amniotic fluid volume assessment with the fourquadrant technique at 36-42 weeks’ gestation. J Reprod Med 1987; 32:540-542 11) Baron C, Morgan MA, Garite TJ. The impact of amniotic fluid volume assessed intrapartum on perinatal outcome. Am J Obstet Gynecol 1995; 173:167-174 12) Grubb DK, Paul RH. Amniotic fluid index and prolonged antepartum foetal heart rate decelerations. Obstet Gynecol 1992;79:558-560. 13) Vintzileos M, Campbell WA, Nochimson DJ, Weinbaum PJ. Degree of oligohydramnios and pregnancy outcome in patients with PROM. Obstet Gynecol 1985; 66:162-167 Italian Journal of Gynaecology & Obstetrics June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868 Leiomyosarcoma of the vulva: a case report and review of the literature Giuseppe Comerci1, Venelia Picarelli1, Emilia Crisanti2, Giandomenico Raulli2 1 2 Gynecology Oncology Service, Department of Obstetrics, Gynecology & Pediatrician Department of Pathology, “Santa Maria delle Croci” Hospital, Ravenna, Italy ABSTRACT Leiomyosarcoma of the vulva is very uncommon and it represents 1% of the vulval neoplasms. A case of 44-years old lady affected by leiomyosarcoma of the vulva is presented. She was admitted to our unit because of complaining painful nodule localized on the left labia majora. It was supposed to be a vulval abscess and under local anesthesia it was excised. Histology report was consistent with leiomyosarcoma of the vulva. Imaging did not reveal any other lesion. A second surgery has been done in order to guarantee optimal free margins. She did not require adjuvant treatment. After five years of follow-up there is no evidence of local recurrence and distant metastases. Most vulval lesion are benign but the possibility of leiomyosarcoma should always be considered if a rapidly growing hard vulvar mass is found. The surgical excision with widely free margins is recommended. Long term careful follow-up is necessary. Keywords: Gynecologic oncology; surgery in GYN cancers; cancer of the vulva; gynecologic imaging; epidemiology of GYN cancers. INTRODUCTION Malignant tumors of the vulvar soft tissue are very rare. Leiomyosarcoma is the most frequent histological type, representing 1% of the malignant neoplasms of the vulva(1-3). However, it is an aggressive disease which usually present as slowly growing nodule and it can often mistaken Correspondence to: [email protected] Copyright 2015, Partner-Graf srl, Prato DOI: 10.14660/2385-0868-38 SOMMARIO Il leiomiosarcoma della vulva è una neoplasia maligna molto rara e rappresenta l’1% dei tumori vulvari. In quasto articolo si illustra il caso clinico di una paziente di 44 anni ricoverata presso la nostra unità di ginecologia per la comparsa di un nodulo dolente a carico del grande labbro vulvare di sinistra. La diagnosi di ammissione è stata di ascesso vulvare che, in anestesia locale, è stato escisso. La diagnosi istologica è stata di leiomiosarcoma della vulva. In seguito a tale diagnosi è stata fatta una stadiazione per immagini sottoponendo la paziente ad una TC totalbody che non ha rivelato secondarismi. Una chirurgia di seconda istanza è stata successivamente eseguita in funzione di garantire sufficienti margini di tessuto indenne. Non è stato necessaria alcuna terapia adiuvante. Dopo cinque anni di controlli clinici e strumentali la paziente non ha sviluppato lesioni locali o a distanza. Gran parte delle lesioni vulvari sono benigne ma la possibilità che possa trattarsi di una neoplasia invasiva dovrebbe essere sempre considerata qualora si noti una lesione di consistenza dura e a rapida crescita. E’ raccomandata fortemente una chirurgia radicale con ampi margini di tessuto sano. E’, inoltre, opportuno eseguire un attento e duraturo follow-up. for a benign lesion causing a delay in diagnosis. The major incidence is seen in women between 40 and 55 years old. These tumors are thought to originate from smooth muscle within erectile tissue or blood vessel walls, the round ligament, the dartos muscle, or the erectorpili muscle(4). Primary therapy is surgical and prognosis is difficult to estimate based on the rareness of these tumors(1). The case of a patient who had a leiomyosarcoma growth in the left labia majora is reported. 29 It. J. Gynaecol. Obstet. 2016, 28: N.2 Leiomyosarcoma of the vulva CASE Forty-four years old, para 1 was admitted to our unit because of complaining painful 2 cm nodule localized on the left labia majora. The patient reported that the lesion was present since years but during the last four months increased rapidally in size. It was thought to be a possible vulvar abscess but white cell count with neutrophil count was normal and reactive protein C was negative. Anyway, the following day, under local anesthesia it was found to be a 2 x 2 cm hard mass on the left labia majora. It was incompletely excised. Histology confirmed leiomyosarcoma. The tumor greatest dimension was 1,5 cm. Grossly it has white cut surface and ill-defined margins. It is composed primarily of spindle cell arranged in fascicles with area showing pleomorphism and mitotic figures (average 18 per 10 HPF), with infiltrative margins and area of necrosis (Figure 1). It Figure 2. The cells stain for smooth-muscle actin and desmin; no staining is observed for keratin or S-100 (40x). DISCUSSION Figure 1. The tumor is composed primarily of spindle cells arranged in fascicles with necrosis, infiltrative margins and mitotic figures (18 x 10 Hpf). 30 stains for smooth-muscle actin and desmin, there is no staining for keratin or S-100 (Figure 2). A CT scan of the thorax, abdomen and pelvis was performed, revealing no additional lesions. A second surgery was scheduled and a wide local excision of the left vulva, deeper up to the fascia, was done. Microscopic examination showed a 5 mm residual tumor with free margin greater than 1 cm. Five years after the diagnosis, patient remains well with no clinical evidence of recurrence. This is the first case of vulvar leiomyosarcoma reported in our unit as, already mentioned, the disease is rare. As in this case, an enlarging painless mass, located in labia majora or minora is usually the only symptom of vulvar leiomyosarcoma. Its biological behavior in the vulva is similar to that in other subcutaneous tissue locations, characterized by high rate of local recurrence and frequency of metastasis by hematogenous route. So these tumors have an insidious evolution and usually reach huge dimensions before accurate diagnosis is done. Because of the rarity of these neoplasms our knowledge is limited. Differentiation between benign and malignant lesion in the vulva is difficult and it causes diagnostic problems. To overcome this problem, Nielsen et al. in 1996 proposed an useful scoring system in order to differentiate leiomyomas and leiomyosarcomas of the vulva. The most important pathologic findings are: tumor diameter greater than 5 cm, infiltrative margins, more than five mitotic figures per 10 HPF and moderate to severe nuclear atypia. Tumors with three or more of these characteristics are considered sarcomas; those that have only one of these characteristics should be diagnosed as leiomyomas and those with only two characteristics should be considered benign but atypical leiomyomas. A review of the literature shows a wide variety of treatment options due to a small number of cases but most of the authors feel that a radical vulvectomy is only mandatory if a wide local excision should not guarantee a pathological free margin greater than 1 cm(5). In our case, because G. Comerci et al. Leiomyosarcoma of the vulva the lesion was 2 cm in greater dimension and localized in the labia majora we have had the possibility to preserve the clitoris in order to decrease the consequences for psychosexual function. In our case there were no clinically and radiologically enlarged lymph nodes at the moment of diagnosis; we decided not to perform inguinal lymphadenectomy. As reported in the literature, this disease behave aggressive in general, with a high rate of local recurrence and distant metastases by haematogenous route (liver and lung mainly). In the review analysed by Aartsen et al, the authors found that the disease may present with possible late recurrence(6). For REFERENCES 1) Curtin JP, Saigo P, Slucher B, Venkatraman ES, Mychalczak B, Hoskins WJ. Soft-tissue sarcoma of the vagina and vulva: a clinicopathologic study. Obstet Gynecol 1995;86:269-272. 2) Nielsen GP, Rosenberg AE, Koerner FC, Young RH, Scully RE. Smooth-muscle tumors of the vulva: a clinicopathological study of 25 cases and review of the literature. Am J Surg Pathol 1996;20(7):779-793. 3) Behranwala KA, Latifaj B, Blake P, Barton DP, Shepherd JH, Thomas JM. Vulvar soft tissue tumors. Int J Gynecol Cancer 2004;14:94-99. 4) Kaufman RH, Gardner HL. Benign mesodermal tumors. Clin Obstet Gynecol 1965;8:953-981. 5) Gonzales-Bugatto F, Anon-Requena MJ, Lopez-Guerrero MA, Baez-Perea JM, Bartha JL this reason we have planned to follow-up our patient for at least ten years. In conclusion, any vulval lesion with unusual characteristics or insidious evolution should be investigated rapidally, in order to make an accurate diagnosis, and due to the rarity of the disease referral to a gynecological cancer centre is mandatory(7-9). DISCLOSURE The authors declare that they have no conflict of interest. Hervias-Vivancos B. Vulvar leiomyosarcoma in Bartholin’s gland area: a case report and literature review. Arch Gynecol Obstet 2009;279:171-174. 6) Aartsen EJ, Albus-Lutter CE. Vulvar sarcoma: clinical implications. Eur J Obstet Gynecol Reprod Biol 1994;56:181-189. 7) Salehin D, Haugk C, William M, Hemmerlein B, Thill M, Diedrich K, Friedrich M. Leiomyosarcoma of the vulva. Eur J Gynaec Oncol 2012;33(3):306-308. 8) DiSaia PJ, Rutledge Felix, Smith JP. Sarcoma of the vulva: report of 12 patients. Obstet Gynecol 1971;38(2):180-184. 9) Davos I, Abell MR. Soft tissue sarcomas of vulva. Gynecol Oncol 1976;4(1):70-86. 31 Italian Journal of Gynaecology & Obstetrics June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868 Terrorism and the male to female ratio at birth: “Anni di Piombo” in Italy Victor Grech1, Julian Mamo1 1 Academic Department of Paediatrics, Mater Dei Hospital, Malta ABSTRACT Introduction: Males are usually born slightly in excess of females and the ratio is often expressed as M/F (male divided by total births). Many factors have been shown to influence M/F, including periods of terrorism which lower M/F through a process of excessive male foetal loss. The Years of Lead constituted a terrorist political phenomenon that commenced in Italy, known as “Anni di Piombo” (1969–1982). This study was carried out in order to ascertain whether the era caused any fluctuations in annual M/F in Italy. Methods: Annual birth data by gender for Italy was obtained from a World Health Organisation Database. Monthly data was unavailable. Results: Annual M/F showed no significant annual dips. However, M/F rose between 1965-69 and 1970-4, and again between 1985-89 and 1990-94 (p<0.01). Discussion: These findings may be due to one of two reasons: a population that is unaffected or less affected by terrorism, or additional factors that may have obscured and even swung M/F upward, in the opposite direction to that expected. A potential explanation is an increase in ambient radiation following a peak of atmospheric bomb testing prior to the Partial Nuclear Test Ban Treaty in 1963, and after Chernobyl in 1986. The rise in M/F in Italy in the early 1970s may have been caused by the former and the rise in the late 1980s may have been caused by the latter. Radiation may be as strong or an even stronger influence on M/F than stress. Keywords: Sex ratio; infant, newborn; birth rate/*trends; terrorism; Italy INTRODUCTION Males are born slightly in excess of females(1). The ratio of male-to-female live births is conventionally expressed as M/F (male births divided by total births – technically M/T not 32 Correspondence to: [email protected] Copyright 2015, Partner-Graf srl, Prato DOI: 10.14660/2385-0868-39 SOMMARIO Introduzione: I maschi, solitamente, nascono in numero leggermente superiore rispetto alle femmine e il rapporto è spesso espresso come M/F (maschi su totale delle nascite). E’ stata dimostrata l’influenza di molti fattori sul rapporto M/F, incluso periodi di terrorismo in cui si ha un abbassamento del rapporto M/F attraverso un processo di eccessiva morte fetale maschile. Gli Anni di Piombo costituiscono un fenomeno politico terroristico iniziato in Italia (1969-1982). Questo studio è stato condotto allo scopo di accertare se il periodo ha causato fluttuazioni nel rapporto annuale M/F in Italia. Metodi: Dati annuali delle nascite divisi per genere per l’Italia, sono stati ottenuti dal Database del World Health Organisation. I dati mensili non erano disponibili. Risultati: Il rapporto annuale M/F non ha mostrato variazioni annuali significative. Tuttavia, si è riscontrato un aumento del rapporto M/F tra il 1965-69 e il 1970-4, and di nuovo tra il 1985-89 e il 1990-94 (p<0.01). Discussioni: Questi risultati possono essere ricondotti a uno dei due seguenti motivi: o una popolazione non è influenzata o poco influenzata dal terrorismo, o altri fattori possono aver modificato il risultato facendo aumentare il rapporto M/F in direzione opposta rispetto a quanto atteso. Una potenziale spiegazione è un aumento delle radiazioni ambientali a seguito dei test nucleari nell’atmosfera prima del Trattato sulla messa al bando parziale dei test nel 1963, e dopo Chernobyl nel 1986. La crescita del rapporto M/F in Italia all’inizio degli anni ’70 può essere stata causata dal primo e l’aumento negli ultimi anni ’80 può essere stata causata dal secondo. Le radiazioni possono influenzare in modo sostanziale il rapporto M/F, o ancora più sostanziale di quanto ipotizzato. M/F). Many factors have been shown to influence M/F, and indeed, all forms of stress have been shown to cause dips in M/F. Violence in particular has also been shown to reduce population M/F. This has included not only frank warfare(2), but also simple civil unrest(3). Terrorist attacks have also been shown to reduce M/F. This was notably shown after the September 11 attacks, following V. Grech et al. Anni di Piombo and M/F birth ratio which transiently less males were born (four months later) not only in New York(4), but in the entire United States(5). The mechanism for these dips has been shown to be due to an excess of male foetal loss in women who were already pregnant(5). A similar effect was also found following the Los Angeles Rodney King riots (1992) and the Breivik (Norway - 2011) and Sandy Hook (Connecticut - 2012) shootings(6). Longer periods of sectarian violence have also been shown to lower M/F, as was evidenced after “The Troubles” in Northern Ireland(6,7). The Years of Lead constituted a political phenomenon that arose from the Cold War. This was characterized by anarchists and by both leftand right-wing terrorism that commenced in Italy and spread to the rest of Europe. In Italy, these were referred to as the “Anni di Piombo”, a period of socio-political turmoil that mostly affected Northern Italy and lasted from the late 1960s into the early 1980s (1969–1982). This era was notable for violent waves of terrorist acts and summary executions of both civilian and military victims. Violence erupted in 1969 with public protests, the occupation of the Fiat automobile factory in Milan, the death off the policeman Antonio Annarumma and the bombings of Piazza Fontana in Milan and that of the monument to Victor Emmanuel II in Rome, among others(8). This study was carried out in order to ascertain whether the Anni di Piombo caused any fluctuations in annual M/F in Italy. M/F rose between 1965-69 and 1970-4, and again between 1985-89 and 1990-94. These rises are highly statistically significant (Table 1). Figure 1. M/F for Italy, 1950-99. Table 1. Totals and M/F for the three eras: 1950-69, 1970-84 and 1985-99, along with significance testing. METHODS Annual birth data by gender for Italy was obtained from a World Health Organisation Database (HFA (Health for All) Database) for 195099. Monthly data was unfortunately unavailable and not forthcoming. Excel was used for data entry, overall analysis and charting. The quadratic equations of Fleiss were used for the calculation of 95% confidence intervals for ratios(9). Chi tests and chi tests for trends for annual male and female births were used throughout using the Bio-Med-Stat Excel add-in for contingency tables(10). A p value ≤0.05 was taken to represent a statistically significant result. RESULTS Annual M/F showed no significant individual variation/s for the period 1950-1999. Five year M/F values for this period are shown in Figure 1. 33 It. J. Gynaecol. Obstet. 2016, 28: N.2 DISCUSSION Research regarding the field of M/F has repeatedly shown that M/F dips follow catastrophic or tragic events if these are felt to be momentous enough and/or to cause sufficient population stress or privation, whether or not these are associated with violence. For example, an M/F dip was noted in the United Kingdom after the accidental death of the Lady Diana, Princess of Wales in 1997, a loved public figure(11). A dip in M/F was also noted in Quebec a few months after a closely-run referendum proposing secession from Canada(12). This is in accordance with the Trivers-Willard hypothesis which states that evolution should have favoured parents who can influence M/F according to conditions around conception and during pregnancy. In polygynous species, a robust son who is conceived under favourable environmental conditions has greater reproductive opportunities than an equivalent daughter who is constrained by pregnancy and lactation. Conversely, under unfavourable conditions, a male foetus (which is weaker than a female foetus) will be less likely to be carried to term and survive to reproductive age, and if so, would compete poorly with more robust males. However a frail female is likelier to survive and reproduce. Hence, under unfavourable conditions, the parental passage of genes if favoured if less males are produced through the culling of weaker males(13). This may have been the mechanism for the decline noted in M/F in Northern Ireland during “The Troubles” (1969-1998). The ethnonationalist conflict was political with ethnic and sectarian influences, with a majority Unionist/ Loyalist population who did not want the country to secede from the United Kingdom, and a minority Nationalist/Republican RomanCatholic population who wished to leave the United Kingdom. Over 3500 individuals died in the Troubles and this was associated a decline in M/F(6,7). This study shows the converse effect, a rise in M/F. These findings may be due to one of two reasons: a population that is unaffected or less affected by terrorism, or additional factors that 34 Anni di Piombo and M/F birth ratio may have obscured and even swung M/F upward, in the opposite direction to that expected. One such potential influence is ionising radiation, the only toxin that has repeatedly been shown not only to cause foetal losses, but also cull more female than male foetuses, thereby raising M/F in ensuing cohorts. Irradiated men sire an excess of males(14), and irradiated females give birth to an excess of females(15). This is attributed to the hypothesis that if an X-linked recessive lethal gene is induced in a mother’s germ cell line by ionising radiation, it would have no effect on a heterozygous daughter but would be lethal to a hemizygous male zygote. X-linked dominant lethal mutations in mothers would be equally lethal to both genders (16). X-linked dominant mutations induced in fathers would suppress only female offspring. Recessive X-linked lethal mutations in fathers would not influence M/F as sons do not receive the paternal X-chromosome and daughters carry (and are protected by) a second X-chromosome from their mother(16). M/F is thus influenced through increased but gender-biased foetal mortality. It has been hypothesised that the skew toward higher female mortality may be due to the fact that the X chromosome contains more genetic material and is physically larger, and hence, may be more easily struck by ionising radiation. Another possibility is that ova and sperm afford their genetic material different levels of protection(16,17). The effect of radiation was shown, for example, in areas in close proximity to nuclear facilities(17), worldwide following a peak of atmospheric bomb testing prior to the Partial Nuclear Test Ban Treaty in 1963(18), and after Chernobyl in 1986(17,19). The rise in M/F in Italy in the early 1970s may have been caused by the former and the rise in the late 1980s may have been caused by the latter(20). If this is the case, then radiation may be as strong or an even stronger influence on M/F than stress. COMPETING INTERESTS STATEMENT There are no real/potential conflicts, financial or otherwise. Anni di Piombo and M/F birth ratio REFERENCES 1) James WH. Proximate Causes of the Variation of the Human Sex Ratio at Birth. Early Hum Dev. 2015;91:795-9. 2) Grech V. Conflicts in the last fifty years and subsequent effects on the male:female ratio at birth. Br J Med Med Res 2015;5:1247-1254. 3) Grech V. Population Stress, Civil Unrest and the Male to Female Ratio at Birth in Chile, Argentina, Australia and Finland. Int J Tropical Dis Health 2015;6: 27-34. 4) Catalano R, Bruckner T, Marks AR, Eskenazi B. Exogenous shocks to the human sex ratio: the case of September 11, 2001 in New York City. Hum Reprod. 2006;21:3127-31. 5) Bruckner TA, Catalano R, Ahern J. Male fetal loss in the U.S. following the terrorist attacks of September 11, 2001. BMC Public Health. 2010;10:273. 6) Grech V. Terrorist attacks and the male-to-female ratio at birth: The Troubles in Northern Ireland, the Rodney King riots, and the Breivik and Sandy Hook shootings. Early Hum Dev. 2015;91:837-40. 7) Grech V. The male to female ratio at birth in the Republic of Ireland and Northern Ireland: influence of societal stress. Ulster Med J. 2015;84:157-60. 8) Weinberg L. The end of terrorism? New York: Routledge; 2013. 9) Fleiss JL. Statistical methods for rates and proportions. New York: John Wiley and Sons; 1981:1415 (2nd edition). 10) Slezák P. Microsoft Excel add-in for the statistical analysis of contingency tables. Int J Innovation Educ Res 2014;2:90-100. V. Grech et al. 11) Grech V. Historic Royal events and the male to female ratio at birth in the United Kingdom. Eur J Obstet Gynecol Reprod Biol. 2015 May 30;191:57-61. 12) Grech V. The male:female ratio at birth was depressed in Québec by the sovereignty referendums. Obstet Gynaecol Can 2015;37:405–411. 13) Trivers RL, Willard DE. Natural selection of parental ability to vary the sex ratio of offspring. Science. 1973;179:90-2. 14) James WH. The sex ratios of offspring of people exposed to non-ionising radiation. Occup Environ Med. 1997;54:622-3. 15) Schull WJ, Neel JV. Radiation and the sex ratio in man. Science. 1958;128:343-8. 16) Vogel F, Motulsky AG. Human genetics. 2nd ed. Berlin: Springer; 1986. 17) Scherb H, Voigt K. The human sex odds at birth after the atmospheric atomic bomb tests, after Chernobyl, and in the vicinity of nuclear facilities. Environ Sci Pollut Res Int. 2011;18:697-707. 18) Grech V. The Chernobyl accident, the male to female ratio at birth and birth rates. Acta Medica (Hradec Kralove). 2014;57:62-7. 19) Grech V. Atomic bomb testing and its effects on global male to female ratios at birth. Int J Risk Saf Med. 2015;27:35-44. 20) Scherb H, Voigt K. Response to F. Bochud and T. Jung: Comment on the human sex odds at birth after the atmospheric atomic bomb tests, after Chernobyl, and in the vicinity of nuclear facilities, Hagen Scherb; Kristina Voigt, Environ Sci Pollut Res (2011) 18:697-707. Environ Sci Pollut Res Int. 2012;19:4234-41. 35 Italian Journal of Gynaecology & Obstetrics June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868 Management of adnexal masses during the third trimester of pregnancy: a case report in twin-pregnancy and review of the literature Luciana Cacciottola1, Eugenio Solima1,Giuseppe Trojano1, Marzia Montesano1, Mauro Busacca1, Michele Vignali1 Department of Biomedical Science for the Health, University of Milan, Macedonio Melloni Hospital, Milan, Italy 1 ABSTRACT The occurrence of ovarian masses during pregnancy is uncommon, nevertheless the correct diagnosis and management, either surgical or obstetric, may represent an issue. The clinical management has to take into consideration aspects both related to the mass (symptoms of torsion, rupture or occlusion and malignant potential) and to the foetal risks. A 36-year-old woman with a twin pregnancy at 29 weeks of gestation was diagnosed with an ovarian cyst with suspicious ultrasonographic features (diameter of 15 cm and enhanced blood flow). An expectant management until a safer gestational age for the twins was established. At 32 weeks of gestation symptoms of bowel obstruction and abdominal pain required a caesarean section and the removal of the affected adnexum. The histological analysis revealed a mucinous borderline tumour with intraepithelial carcinoma. When an adnexal mass is diagnosed during third trimester of pregnancy the ultrasonographic evaluation has to be done to assess the potential of malignancy. The clinical management needs a multidisciplinary approach has to be balanced between the risk of malignancy or other issues related to the mass and the foetal health. Keywords: Adnexal mass; borderline tumour; mucinous tumour; twin-pregnancy; ovarian markers; CA 19.9 INTRODUCTION According to literature the incidence of adnexal masses in pregnancy ranges from 1 in 25 to 1 in 8000(1). The widespread use of ultrasonography since the first trimester makes the detection of 36 Correspondence to: [email protected] Copyright 2015, Partner-Graf srl, Prato DOI: 10.14660/2385-0868-40 SOMMARIO Il riscontro di una neoformazione ovarica in gravidanza è un evento raro. La diagnosi e la gestione clinica possono presentare diverse criticità. E’ neccessario considerare il potenziale di malignità e la presenza di complicanze (torsione ovarica, rottura della massa e dolore addominale), oltre che i rischi fetali. Una paziente di 36 anni, con gravidanza gemellare, ha avuto diagnosi di massa ovarica sospetta a 29 settimane gestazionali. L’ecografia mostrava una neoformazione di circa 15 cm, multicistica, con porzioni solide e aumentata vascolarizzazione. Abbiamo scelto una condotta di attesa per le problematiche fetali di prematurità, ma a 32 settimane gestazionali l’insorgenza di una sintomatologia suggestiva per occlusione intestinale ha portato al taglio cesareo e contestualmente ad annessiectomia monolaterale con stadiazione della patologia ovarica. L’esame istologico definitivo era tumore mucinoso borderline con carcinoma intraepiteliale. In caso di riscontro di una massa ovarica nel terzo trimestre la valutazione, attraverso l’ecografia, del potenziale di malignità guida la condotta clinica rispetto alla scelta di una terapia chirurgica e al timing del parto. La gestione del caso deve essere multidisciplinare e tenere in conisiderazione sia i rischi associati ad un ritardo di diagnosi istologica e terapia chirurgica, sia i rischi fetali. asymptomatic lesions possible and more frequent every day(2,3). During pregnancy most ovarian tumours reduce or disappear spontaneously and they don’t need surgical management(4). Although malignant adnexal cysts are extremely rare (ranging from 1 in 10’000 to 1 in 50’000) the possibility of a borderline tumour has to be considered(5). Malignancy is not the only L. Cacciottola et al. Adnexal mass in pregnancy risk of adnexal masses in pregnancy: the risk of rupture, torsion or bowel occlusion are increased during the whole gestation and so is the risk of dystocia during labour(5,6,7). Nevertheless the management of adnexal masses can be difficult as both the surgical removal of the mass and an expectant management present risks for the mother and the foetus(5,6). CASE PRESENTATION A 36 year-old twin pregnant woman on the 29th week of gestation presented to the Emergency Room in January 2015 complaining diffuse abdominal pain. She had a previous caesarean section because of a foetal malpresentation. This pregnancy was a spontaneous bichorial-biamniotic twin pregnancy with regular evolution for both twins and no signs of obstetrics pathologies. No uterine contractions or tenderness were noted and the cervix was regular at vaginal examination and at ultrasound screen. An obstetric ultrasonography showed that both foetuses heart rates were regular and checked the foetal position: cephalic for the first twin and breech for the second one. While hospitalized the patient started to have irregular uterine contractions; then a tocolytic therapy and antenatal corticosteroids for foetal lung maturation were performed. An ultrasonography detected the presence of left ovarian cyst, with multilocular lesions of 14 x 15 x 13 cm with liquid and solid portions, with regular boundaries and a vascular flow perfusing the solid areas (color score 3/4). Ovarian markers were dosed finding CA 19,9 increased (462,5 IU/ml). Normal values were observed for CA125. Considering the gestational age, the common issues related to a twin pregnancy and the mass size (which made it not possible to be removed preserving the pregnancy), an observation period, until the 34th week of gestation was established by a multidisciplinary team foreseeing a magnetic risonance imaging (MRI) and an elective caesarean section and surgical management of the mass. After few weeks an exacerbation of abdominal pain together with other gastro-enteric symptoms such as nausea, anorexia and difficult digestion led to the decision to anticipate the caesarean section which was performed at 32 weeks of gestation, before MRI execution. The caesarean section was carried out through a midline incision. A sample of peritoneal fluid was collected for cytology before the twins extraction. First twin was in cephalic presentation, the second twin was in breech presentation. The newborns were both males weighting 1850 grams and 1990 grams and with an Apgar score of 9 and 10 respectively. After closing the uterine incision and the visceral peritoneum the ovarian mass was then considered. The mass showed solid and cystic portions. It was located between the diaphragm on the top, the small bowel medially and the uterus and pelvic cavity inferiorly. After the removal of few adhesions between the small bowel and the mass, the vascular ovarian pedicle was then isolated, clamped and ligated with double safety vessel ligation because of its size. The mass was then removed without compromising its integrity and sent to the pathology for a frozen section analysis which came back to be a mucinous borderline tumour, weighing 2095 grams. Omentectomy, appendicectomy and several peritoneal biopsies were then performed. The right ovary appeared regular. The operation course and puerperium were regular. The definitive histological exam reported mucinous borderline tumour intestinal type with intraepithelial carcinoma (1A1 F.I.G.O. 2013). Free peritoneal fluid, appendix, peritoneum and omentum were free from neoplastic cells. A 4 months follow-up was established considering patient’s young age and the clinical benign course of this kind of lesion. Twins were discharged in few weeks heatlhy. DISCUSSION In this case the adnexal mass was diagnosed in the third trimester of a twin pregnancy, with suspicious features and symptoms (abdominal pain and increasing preterm uterine contractions). Even if a surgical management to confirm the tumour histology was the best patient’s option, the a conservative surgical treatment without stopping the pregnancy was not possible, because of the patient’s history of previous caesarian section and the size of the mass itself. Even though the adnexal mass had several features of malignancy such as an increased size, solid component and abnormal blood flow, the high risks of neonatal complications deemed an expectant management until a safer gestational age to be the best option for the patient. CA 125 was negative while CA 19.9 was found highly increased (>400 IU/ml). Even though 37 It. J. Gynaecol. Obstet. 2016, 28: N.2 there are limited reports regarding the use of CA 19.9 as a diagnostic marker in ovarian mucinous tumours (and even less about its value in screening borderline and malignant tumours from the benign ones)(8) its positivity, together with the ultrasonographic features, were suggestive of a mucinous mass. Regarding the definitive histological type the discovery of malignant cells in the tumour’s parenchyma is based on cytological evidences and immunohistochemical techniques. This accounts for the underdiagnosis of this type of tumours as they require a more extensive sampling then possible during a frozen section analysis. Mucinous borderline tumours with intraepithelial carcinoma have a benign clinical behaviour and are bilateral only 5% of the times. We applied a fertility preserving strategy choosing not to remove the other ovary or perform biopsies which could cause adhesions and reduce fertility(9). Even if the rate or recurrence is higher in this kind of management (10% to 20% versus 5% of radical surgery) the mortality rate is no increased(10,11). Considering the low risk of lymph nodes metastasis in this kind of histotype the retroperitoneal staging was omitted(12). REVIEW OF THE LITERATURE 38 Adnexal masses in pregnancy are rare, from 0,15%-0,57% (incidence rate ranging from 1 in 25 to 1 in 8000)(1). The risk of malignancy is even less common, (1 in 10000 to 1 in 50000) especially considering the patients’ age (3). The risk of borderline ovarian tumour (BOT) is though worth of being considered. BOT represent between 10% and 20% of all ovarian malignancies(13). The mean age of incidence is 20 years earlier than ovarian invasive carcinomas, with up to 30% of diagnosis in childbearing age (< 40 years) (14). The exact incidence of BOT during pregnancy is unknown; literature reports an incidence up to 8% of adnexal masses(14). Even if their early diagnosis is increasingly frequent because of the widespread use of ultrasonography from the first trimester, the 19.4% of all ovarian masses are detected in the third trimester or at term of pregnancy and this percentage reaches 36,9% considering the ovarian masses requiring surgery(5). When dealing with an adnexal mass in third trimester of pregnancy the malignant potential, the likelihood of sponaneous resolution (depending on the size and the ultrasonographic and radiologic Adnexal mass in pregnancy appearance), the presence of symptoms and the risk of obstructed labour should be considered(12). The ultrasonographic diagnosis of malignant ovarian masses during pregnancy has a sensitivity ranging between 68 and 93%(6), with a certain rate of false positives. It’s not known if the specific pregnancy’s hormonal environment could contribute to this particular issue. The Doppler examination has a false positive rate of 49% in predicting malignancies, due to the increased pelvic blood flo (3). MRI with gadolinium injection can be performed during from the third trimester of pregnancy. Gadolinium is a pregnancy category C drug. Animal studies have shown an increased risk of skeletal malformations; for this reason it should be avoided during organogenesis. MRI is a second line examination and it should be considered in case of indeterminate adnexal lesion, up to 20% of times. It is useful in evaluating adnexal masses that are too large to be evaluated by ultrasonography(7,15). Ca 125 is not useful in the diagnosis of ovarian masses during pregnancy, because the effect of embryonic growth during pregnancy and the peculiar hormonal assessment can cause significant variations in the first and third trimester. CA 19.9 is even less specific during pregnancy, but it is associated with several types of mucinous tumours in the gastrointestinal tract and with primitive ovarian tumours as well (dermoid cyst and mucinous ovarian tumour), playing a potential role in different diagnosis(16,17). The 70% of the masses resolve spontaneously(4). This percentage does not decrease in patients with complex or large cysts (more than 5 cm) and is higher in presence of simple cysts with major diameter less than 5 cm (18). Adnexal masses are asymptomatic in 65% of cases. Symptoms detected are abdominal pain, occurrence of rapture or bleeding and ovarian torsion(4,7). The rate of torsion is between 1 and 22% of cases, it is higher in adnexal masses with size between 6 and 8 cm, compared to other size (22% vs 14%), but only 5,9% of ovarian torsions appears in third trimester(19). The cyst rapture or bleeding seems to be less frequent, ranging form 1 to 9%, without difference during the whole pregnancy(20). There is not a definitive management strategy dealing with the adnexal masses in pregnancy(1). The optimal management foresees a multidisciplinary approach, involving specialist in oncology, in obstetrics and sometime in pediatrics(5). In case of an asymptomatic masses with no L. Cacciottola et al. Adnexal mass in pregnancy features of malignancy in third trimester an expectant management should be offered and surgery should be considered at least 6 weeks after delivery. Ultrasonographic features of malignancy guide to a surgical management. In case of a complex mass or a large one with major diameter > 8 cm(20) or > 10 cm(19,21) according to different authors, there is an increased risk of malignancy. If a low malignant potential can be confirmed the tumour can be treated with conservatively adnexectomy, peritoneal citology and biopsies, without leading to the end of pregnancy when possible. In case of single ovary or bilateral tumour a conservative treatment with cistectomy should be considered(4,5) to preserve fertility in young patients(9). Frozen section analysis should be always performed to achieve the diagnosis. In case of invasive tumour unilateral or bilateral adnexectomy with abdominopelvic exploration should be done in stage IA and IB. If the tumour stage is advanced (stage II-IV) the best options in third trimester is to consider a premature birth to avoid delay in mother’s treatment. In earlier gestational age the neoadjuvant chemotherapy during pregnancy should be taken in consideration by a multidisciplinary group and according to the patient’s will(8). The surgical approach (laparoscopic or laparotomic) should be established considering the gestational age, the patient’s history of previous surgery, the likelihood of pelvic adhesions and the mass’(22,23). Laparoscopy is as safe as laparotomy up to 32 weeks of gestation(24) and should be preferred when possible because it seems to cause less preterm uterin contractions , even if there is not an evidence of difference in preterm delivery rate and intrauterine foetal demise(25). The increased risk of emergency surgery versus elective surgery is not confirmed(6,25). List of abbreviations BOT: borderline ovarian tumour. MRI magnetic risonance imaging COMPETING INTERESTS All authors declare no conflict of interests. 39 It. J. Gynaecol. Obstet. 2016, 28: N.2 REFERENCES 1) Mukhopaddhyay A, Shunde A, Naik R. Ovarian cyst and cancer in pregnancy. Best Pract Res Clin Obstet Gynaecol 2016. pp 58-72 2) Hoover K, Jenkins TR. Evaluation and management of adnexal mass in pregnancy. Am J Obstet Gynecol. 2011. pp 97-102 3) Xie M, Zhang X, Wang W, Hua K. Benign pelvic masses masquerading as adnexal cancer during pregnancy on ultrasound: A retrospective study of 5 years. Mol Clin Oncol 2015. pp 1395-1397 4) Aggarwal P, Kehoe S. Ovarian tumours in pregnancy: a literature review. Eur J Obstet Gynecol Reprod Biol. 2011. pp 119-24 5) Marret H, Lhomme¥ C, Lecuru F, Canis M, Leveque J, Golfier F et al. Guidelines for the management of ovarian cancer during pregnancy. Eur J Obstet Gynecol Reprod Biol. 2010 pp 18-21 6) Whitecar MP, Turner S, Higby MK. Adnexal masses in pregnancy: A review of 130 cases undergoing surgical management. Am J Obstet Gynecol. 1999. pp 19-24 7) Navqui M, Kaima A. Adnexal masses in pregnancy. Clin Obstet Gynaecol 2015. pp 93-101 8) Kyung MS, Choi JS, Hong SH et al. Elevated CA 19-9 levels in mature cystic teratoma of the ovary. Int J Biol Markers. 2009. pp 52-6 9) Tomao F, Peccatori F, del Pup L, Franchi D, Zanagnolo V, Panici PG, Colombo N. Special issues in fertility preservation for gynaecologic malignancies. Crit Rev Oncol Hematol. 2016. pp 206-219 10) du Bois A, Trillish F, Mahner S, Heitz F, Harter P. Management of borderline ovarian tumors. Ann Oncol. 2016 11) du Bois A, Ewald-Riegler N, de Gregorio N. et al. Borderline tumours of the ovary: a cohort study of the Arbeitsgmeinschaft Gjnäkologische Onkologie (AGO) Study Group. Eur J Cancer 2013. pp 1905-1914 12) Powless CA, Aletti GD, Bakkum-Gamez JN, Cliby WA. Risk factors for limph node metastasis in apparent early-stage epithelial ovarian cancer: implications for surgical staging. Gynaecol Oncol. 2011. pp 536-540 13) TropÈ CG, Kaern J, Davidson B. Borderline ovarian 40 Adnexal mass in pregnancy tumours. Best Pract Res Clin Obstet Gynaecol. 2012. pp 325-36 14) Fauvet R, Brzakowski M, Morice P, Resch B, Marret H,Graesslin O et al. Borderline ovarian tumors diagnosed during pregnancy exhibit a high incidence of aggressive features: results of a French multicenter study. Ann Oncol.2012. Pp 1481-7 15) Yacobozzi M, Nguyen D, Rakita D. Adnexal masses in pregnancy. Semin Ultrasound CT MR. 2012. pp 55-64 16) Cho H, Kyung M.S. Serum CA19-9 as a Predictor of Malignancy in Primary Ovarian Mucinous Tumors: A Matched Case-Control Study. Med Sci Monit. 2014. pp 1334-9 17) Ercan S, Kaymaz O, Yucel N. Serum concentrations of CA 125, CA 15-3, CA 19-9 and CEA in normal pregnancy: a longitudinal study. Arch Gynecol Obstet. 2012. pp 579-84 18) Bernhard LM, Klebba PK, Gray DL. Predictors of persistence of adnexal masses in pregnancy. Obstet Gynecol. 1999. pp 585-9 19) Yen CF, Lin SL, Murk W. . Risk analysis of torsion and malignancy for the adnexal masses during pregnancy. Fertil Steril. 2009. pp 1895-902 20) Bignardi T, Condous G. The management of ovarian pathology in pregnancy. Best Pract Res Clin Obstet Gynaecol. 2009. pp 539-48 21) Horowitz NS. Management of adnexal masses in pregnancy. Clin Obstet and Gynaecol. 2011. pp 519-527 22) Mathevet P, Nessah K, Mellier G. Laparoscopic management of adnexal masses in pregnancy: a case series. Eur J Obstet Gynecol Reprod Biol. 2003. pp 217-22 23) ACOG Committee on Obstetric Practice. ACOG committee opinion No 474: non obstetrics surgery during pregnancy. Obstet Gynaecol 2011. 420-421 24) Weiner E, Mizrachi Y, Keidan R.. Laparoscopic surgery performed in advanced pregancy compared to early pregnancy. Arch Gynaecol Obstet. 2015. pp 1063-68 25) Webb KE, Sakhel K, Chauhan SP, Abuhamad AZ. 2015. Adnexal mass during pregnancy: a review. Am J Perinatol. pp 1010-16 Italian Journal of Gynaecology & Obstetrics June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868 Laparoscopic treatment of Interstitial Ectopic Pregnancy: a Case Report Marta Mancini1,2, Francesco Cassanelli1,2, Nicola Santomarco1, Matteo Collamarini1,2, Arianna Olivieri1,2, Emilio Piccione2, Michelangelo Boninfante1 1 2 Department of Obstetrics and Gynecology: Ospedale Generale Madre Giuseppina Vannini, Rome-Italy Specialization School of Obstetrics and Gynecology, University of Rome Tor Vergata, Italy ABSTRACT Interstitial pregnancy is a rare form of ectopic pregnancy with a significant risk for morbidity(1). A 27-year-old woman was brought to the emergency department with vaginal spotting bleeding and serum ß hCG levels up to 7900 mUI/mL. The trans-vaginal ultrasound scan showed a normal uterus with an endometrial thickness of 13 mm; near the left uterine horn, there was a mass characterized by an oval shape of 24x25x18 mm with a mixed echogenic pattern and a moderate vascularization at Color-Doppler investigation which was suggestive for a cornual/interstitial pregnancy. During the next controls the ß hCG levels increased until 9156 mlU/mL, for this reason it was proceed with a laparoscopy. During laparoscopy an ectopic pregnancy was diagnosed in the left uterine horn. Complete salpingectomy was performed. Interstitial (IP) and corneal (CP) pregnancies should be considered as two different clinical situations. It is important to enhance the clinician’s suspicion about interstitial/ cornual pregnancy(2). Laparoscopic approach represents the treatment of choice for reducing maternal risks and obtaining the patient’s best outcome(3). SOMMARIO La gravidanza interstiziale rappresenta una rara localizzazione di gravidanza ectopica associata ad un elevato tasso di morbidità. Una donna di 27 anni è giunta in Pronto Scoccorso per perdite ematiche vaginali e con livelli di ß hCG di 7900 mUI/mL. L’ecografia pelvica trans-vaginale ha mostrato un corpo uterino nella norma con spessore endometriale di 13 mm; in prossimità dell’angolo cornuale sinistro dell’utero si è evidenziato una formazione a contenuto misto, di forma ovalare, di mm 24x25x18, dotata di discreta vascolarizzazione al Color-Doppler, riferibile a gravidanza ectopica cornuale/interstiziale. Nei controlli successivi le ß hCG sono aumentate di 9156 mlU/mL, per cui si è deciso di procedere con la laparoscopia. Nel corso di tale procedura, è stata diagnosticata una gravidanza ectopica interstiziale sinistra per cui è stata effettuata una salpingectomia totale sinistra. È importante fare diagnosi differenziale tra gravidanza ectopica di tipo interstiziale o cornuale per rendere più appropriata la scelta terapeutica chirurgica e favorire un miglior outcome della paziente. Keywords: Ectopic pregnancy; interstitial pregnancy; laparoscopic treatment; salpingectomy INTRODUCTION IP represents approximately 1–3% of ectopic pregnancies (EP) (2). In an IP, the embryo is implanted at the proximal site of the fallopian tube, which is embedded within the muscular wall of the uterus(4). This site is a highly vascular area near the anastomosis of the ascending uterine and tubo-ovarian vessels(5). A diagnosis is usually delayed because of such a rare position and the maternal mortality rate related to it is 2.0–2.5%(1). Correspondence to: [email protected] Copyright 2015, Partner-Graf srl, Prato DOI: 10.14660/2385-0868-41 CASE PRESENTATION A 27-year-old nulliparous woman was referred to the emergency room of our hospital on March 2016 with spotting bleeding. The woman referred irregular menstrual periods. Her medical history included smoking (20 cigarettes per day) and no past or current medical problems. On arrival, her vital parameters were normal. Vaginal examination revealed bleeding, no uterine dilatation, no uterine contractions or abdominal pain and tenderness. Speculum inspection was unremarkable. In addition, laboratory evaluation revealed that hematocrit was 37.5%, hemoglobin 41 It. J. Gynaecol. Obstet. 2016, 28: N.2 12.3 gr/dl, white cell blood count 11.4 x 103 / mL, normal liver and kidney function tests. Her βhCG value was 7900 mlU/mL. The ultrasound examination showed no evidence of a gestational sac in the uterine cavity, nor in the adnexal region. In the suspicion of an EP, the woman was admitted to our obstetric department for observation of the evolution of the pregnancy. The day after, clinical examination was identical. A second transvaginal ultrasound scan was performed and it showed “a normal uterus with an endometrial thickness of 13 mm (Figure 1); near the left horn of the uterus presence of a mass characterized by an oval shape of 24x25x18 mm with a mixed echogenic pattern and a moderate vascularization at Color-Doppler investigation, suggestive for a cornual/interstitial pregnancy (Figure 2). Presence of free abdominal fluid in Douglas cavity”. Figure 1. Fig. 1 Normal uterus with an endometrial thickness of 13 mm. 42 Figure 2. Near the left horn of the uterus presence of a mass characterized by an oval shape of 24x25x18 mm with a mixed echogenic pattern and a moderate vascularization at Color-Doppler investigation, suggestive for a cornual/interstitial pregnancy. Laparoscopic treatment of Interstitial Ectopic Pregnancy: a Case Report βhCG levels increased up to 8043 mlU/mL and, finally, up to 9156 mlU/Ml in 24 hours. The surgical approach was necessary into account of clinical condition and of βhCG levels, that contraindicate a medical treatment (Methotrexate)(6). The woman decided to proceed with surgery. A traditional laparoscopic approach was preferred. During the procedure, a left interstitial EP (maximum diameter 3-4 cm) was found (Figure 3) with an extended adherence syndrome that included both the adnexa and hepatodiaphragmatic and hepato-renal regions. This pathological pattern suggested a previous Pelvic Inflammatory Disease (PID). Figure 3. Laparoscopic diagnosis of left interstitial ectopic pregnancy. Figure 4. A complete left salpingectomy performed with a Bipolar Biclamp applied in the proximal interstitial-isthmic portion and Surgiflo Hemostatic Matrix in the left cornual region. M. Mancini et al. Laparoscopic treatment of Interstitial Ectopic Pregnancy: a Case Report The tube with EP could not be salvaged. For this reason, a complete left salpingectomy was performed with a Bipolar Biclamp applied in the proximal interstitial-isthmic portion and Surgiflo Hemostatic Matrix in the left cornual region (Figure 4). Finally, the adherences were removed by adhesiolysis. The patient was discharged from the hospital without complications on the second postoperative day. At the demission, a serial dosage of serum βhCG levels was suggested to the patient every week for the follow-up until the βhCG titer became negative. Furthermore, it was prescribed transvaginal ultrasound control and clinical examination after 15 days. An important advice for the patient was not to get pregnant for 1 year after the surgery. After two weeks, histopathological report confirmed the laparoscopic diagnosis: interstitial ectopic pregnancy. DISCUSSION Cornual and interstitial pregnancies are two rare subtypes of EP characterized by the implantation of the gestational sac in the uterine horns or into the proximal portion of the fallopian tube. These conditions present a significantly greater propensity to expand before rupture if compared with the distal portion(7). For these reasons, IP may remain asymptomatic until 7–16 weeks’ gestation, timing at which tubal rupture may result in catastrophic, life-threatening maternal hemorrhage(8,9). CP, on the other hand, refers to a pregnancy that develops in a horn of a bicornuate uterus, with highly variable clinical outcomes that are particularly related to the size of the uterine horn involved(4). However, the two terms are often used interchangeably in the medical literature and in clinical practice. Today, the use of sensitive β-human chorionic gonadotropin (β-hCG) assay and transvaginal ultrasound permits earlier diagnosis(10) of IP. But the final diagnosis is usually made at the time of surgery(11). Once a diagnosis of IP is suspected, multiple factors should be considered to determine whether surgical or medical treatment is indicated. These factors include clinical presentation and features of EP, gestational age at diagnosis, contraindications to medical therapy and patient preference. Early diagnosis may potentially allow conservative treatment thus minimizing morbidity and mortality rates. Formerly, treatment options for IP mainly relied upon laparotomy (3) . Conservative laparoscopic treatment is now the preferred surgical approach in cases of EP that are not eligible for medical treatment. The Royal Collage of Obstetricians and Gynecologist recommends that the women with EP who are most suitable for medical (Methotrexate) therapy are those with minimal symptoms and low serum β-hCG levels (<3000 IU/l). Even in women with significant hemoperitoneum, laparoscopic surgery can be safely conducted by experienced laparoscopic surgeons if hemodynamic stability is achieved through perioperative management. Laparoscopic treatment per se offers several advantages over laparotomy. These include lower surgical morbidity, shorter hospital stay, faster return to normal activities, and decreased healthcare cost (12). Conservative laparoscopic treatment may potentially remove the EP while preserving uterine architecture(13). It does not appear necessary to routinely monitor serum β-hCG levels postoperatively in women diagnosed with tubal miscarriages undergoing complete salpingectomy. On the contrary, it is advisable for a ruptured EP or in cases of salpingectomy where there is thought to be spillage of trophoblast(14). Expectant management of EPs that are located in the distal tube has been shown to be an acceptable approach in the presence of a spontaneously declining serum β-hCG level in an asymptomatic woman(15). Nonetheless expectant management may also potentially be associated with uterine rupture leading to severe maternal morbidity, unpredictable course to resolution (even with declining β-hCG levels) and the need for prolonged hospitalization. Risk of recurrence of IP(13) and risk of uterine rupture during subsequent pregnancy may be also considered. CONCLUSIONS An early diagnosis and a correct treatment of IP avoids invasive operations, such as a laparotomy obtaining a favorable maternal outcome. A successful and safe management of this condition is possible when the treatment strategy is based on the patient’s clinical conditions, on the evaluation of the risk factors and on the integration of the different available diagnostic techniques. 43 It. J. Gynaecol. Obstet. 2016, 28: N.2 REFERENCES 1) S. Lau, T. Tulandi. Conservative medical and surgical management of interstitial ectopic pregnancy. Fertil Steril, 72 (1999), pp. 207–215. 2) E. Kagan Arleo, E. M. DeFilippis Cornual, interstitial, and angular pregnancies: clarifying the terms and a review of the literature. NY Presbiterian/Weill Cornell, New York, NY, USA, 2014 763-770. 3) Grobman WA, Milad MP: Conservative laparoscopic management of a large corneal ectopic pregnancy. Hum Reprod 1998;13:2002–2004.70 Hill A. 4) S. Dilbaz, B. Katas, B. Demir, B. Dilbaz Treating cornual pregnancy with a single methotrexate injection: a report of 3 cases. J Reprod Med, 50 (2005), pp. 141–144. 5) M.M. Chou, J.J. Tseng, Y.C. Yi, W.C. Chen, E.S. Ho. Diagnosis of an interstitial pregnancy using fourdimensional volume contrast imaging. Am J Obstet Gynecol, 193 (2005), pp. 1551–1553. 6) Lau S, Tulandi T: Conservative medical and surgical management of interstitial ectopic pregnancy. Fertil Steril 1999. 7) Moawad NS, Mahajan ST, Moniz MH, Taylor SE, Hurd WW: Current diagnosis and treatment of interstitial pregnancy. Am J Obstet Gynecol 2010; 202: 15–29. 8) Tulandi T, Al-Jaroudi D: Interstitial pregnancy: results generated from the Society of Reproductive 44 Laparoscopic treatment of Interstitial Ectopic Pregnancy: a Case Report Surgeons Registry. Obstet Gynecol 2004; 103: 47–50. 9) Fylstra DL: Ectopic pregnancy not within the (distal) fallopian tube: etiology, diagnosis, and treatment. Am J Obstet Gynecol 2012; 206: 289–299. 10) Larrain D, Marengo F, Bourdel N, Jaffeux P, AubletCuvelier B, Pouly JL, Mage G, Rabischong B: Proximal ectopic pregnancy: a descriptive general populationbased study and results of different management options in 86 cases. Fertil Steril 2011;95:867–871. 11) G. Cucinella, A. Perino: Interstitial pregnancy: a road map of surgical treatment based on a systematic review of the literature. Gynecol Obstet Invest 2014; 141-149. 12) Baumann R, Magos AL, Turnbull A: Prospective comparison of video pelviscopy with laparotomy for ectopic pregnancy. BJOG 1991; 98:765–771. 13) Royal College of Obstetricians and Gynaecologists: The management of tubal pregnancy. Guideline No. 21, May 2004. Reviewed 2010. 14) Bora SA, Kirk E, Daemen A, Timmerman D, Bourne T: Is serum human chorionic gonadotrophin follow-up necessary after suspected spillage of trophoblast at the time of laparoscopic surgery for ectopic pregnancy? Gynecol Obstet Invest 2011;71:225–228. 15) Maymon R, Shulman A: Controversies and problems in the current management of tubal pregnancy. Hum Reprod Update 1996;2:541–551. Italian Journal of Gynaecology & Obstetrics June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868 Transient osteoporosis and pathological fractures in pregnancy and puerperium: a case report and review of literature Guido Formelli1, Giorgio Scagliarini1,Mauro Girolami2, Giuseppe Mignani2 1 2 UO Ostetricia e Ginecologia Bentivoglio, AUSL Bologna, Italia UO Ortopedia Bentivoglio, Istituto Ortopedico Rizzoli Bologna, Italia ABSTRACT Spontaneous pathological fractures of the pelvic bones and the femoral neck occuring during the last three months of pregnancy or immediately after delivery are often underestimated and misinterpreted. Early diagnosis and a prompt evaluation of symptoms and signs can prevent more serious orthopedical complications and physical limitations of the women in their family and work activities. We describe a recent clinical case under our observation 20 years after the pubblication of a previous report on the same subject. Keywords: Pregnancy; pelvic bones; spontaneous fractures. INTRODUCTION Orthopaedic problems during pregnancy and puerperium are very frequent but fortunately most are of a benign nature resulting in a complete recovery. We need to consider in particular painful osseous-articular syndromes, which are usually located in the pelvic girdle and spinal column and are related to fetal intra- uterine development, diastasis of the pubic symphysis and sacrum-iliac joints, coccyx lesions, an increase in weight and last but not least, bad body posture. Traumatic musculoskeletal-lesions occurring during labour and delivery have also been described(1). Of a rarer nature but more insidious, due to possible sequelae, are the spontaneous Correspondence to: [email protected] Copyright 2015, Partner-Graf srl, Prato DOI: 10.14660/2385-0868-42 SOMMARIO Durante la gravidanza possono verificarsi fratture patologiche spontanee soprattutto a livello delle ossa del bacino e del collo femorale. Queste fratture sono probabilmente più frequenti di quanto si creda perchè non vengono diagnosticate o confuse con altre sindromi osteo-articolari. Una diagnosi precoce è invece fondamentale per i necessari provvedimenti impedendo lo sviluppo di limitazioni funzionali che andrebbero ad interessare donne giovani nel pieno delle attività lavorative e famigliari. Descriviamo un caso capitato recentemente alla nostra osservazione come aggiornamento di un medesimo report di circa 20 anni fa. pathological fractures of the pelvic ring and of the femoral neck which can occur during the last three months of pregnancy or immediately after delivery. These cases are probably more frequent than believed, difficult to determine and certainly underestimated or misinterpreted(2,3). An early diagnosis of this disease at the first sign of premonitory symptoms is essential in allowing us not only to control and treat the symptomatology but also to prevent pathological fractures, bone non unions and possible physical limitations, particularly serious for young women involved in work and family activities. A recent clinical case under our observation has induced and stimulated us to review the international literature and the state of the art 20 years after the publication of a previous report on the same subject(4). 45 It. J. Gynaecol. Obstet. 2016, 28: N.2 CASE STUDY A 34 year old woman 160 cm tall,weighing 59 kg, primipara in her 3rd pregnancy at 41st week of amenorrhoea, was admitted to the maternity ward of Bentivoglio Hospital at 2.01 am in labour. The course of her pregnancy had been normal, but in the last three weeks she complained of a pain in her left hip when weight bearing. There was no history of any previous trauma. Blood test levels were normal. At 2.28 am the patient gave birth to a male weighing 3395gm, Apgar 10-10. During the first few days after birth, left hip pain and mobility reduction in the lower left limb persisted, so the patient was visited by an orthopaedic consultant and x rays of the pelvis were performed. A compound fracture of the left ileo-pubiscus ramus was evidenced (Figure 1). The consultant advised bed rest for 2 weeks and to walk for small distances with two crutches for a further 20 days until the pain ceased. A complete recovery was reached about 90 days later. Figure 1. Compound fracture of the ileo-pubicus ramus. DISCUSSION 46 Low back pain, lumbar sciatica, hip and coccyx pain are very frequent in the last months of pregnancy and are usually considered to be caused by mechanical events, normal weight increase during the last three month period, a change in posture due to a lumbar hyperlordosis, Spontaneous pathological fractures in pregnancy or caused at the time of delivery. However hip pain can conceal a bone density reduction, that can lead, fortunately in few cases, to a pathological fracture(1,2). Transient osteoporosis before and post partum is a little known clinical syndrome; the event of pathological fractures are certainly more frequent than the small number of cases recorded in the scientific literature(7). It is interesting to note that in almost 20 years since the ten cases recorded in our previous report, at the present time only twelve more cases have been reported(5,6,7). The occurrence of fractures depends on the seriousness of the clinical case and the areas involved and is usually more frequent for the femoral neck, the ribs, the vertebral column and more rarely the ischiopubic rami. The mother’s weight and age, fetal weight and prolonged labour don’t seem to be risk factors. The majority of these patients however have a family history of osteoporosis and low levels of calcium and vitamin D intake and low sunlight exposure, even if there is a physiological increase in calcium absorption during pregnancy(5). The pathogenesis of this condition however remains unknown, whether described as transient osteoporosis or as algodystrofia. Anglo-American and French orthopaedic schools have different opinions on these fractures : respectively as a result of a transient osteoporosis occurring during pregnancy and lactation or included in the vast chapter of algodystrophy the pathogenesis of which is only partially understood. According to these authors, pregnancy and lactation can cause a calcium bone content reduction which varies from 3% to 7% according to fetal and neonatal needs , quickly reintegrated after weaning and not correlated to a future osteoporosis risk in post menopause(8,9,10). Most probably more factors are involved such as hormone levels, constitution, posture, body movement and the vascular condition of the patient. Multiple changes in fact influence bone metabolism in pregnancy, such as increase in calcium request by the fetus, especially during the last month of bone mineralization, change in nutritional habits and physical activity, as well as increase in hormone levels in puerperium or clinical pathological diseases in pregnancy resulting in hyperaemia of the pelvis. Much is still to be studied and understood about the changes in bone structure during pregnancy and if these changes are the direct consequence of pregnancy, or occur due to genetic Spontaneous pathological fractures in pregnancy factors already existing before pregnancy. The pain usually sets in a sudden and unexpected way with limping and sometimes reduced hip mobility. The symptomatology depends on the entity of the bone damages; obesity, strong mechanical pain, accentuated by weight bearing and movement, which disappears after rest, must be considered a predictive fracture risk symptom. Diagnosis is achieved mainly at a radiological and specialistic level, but can involve differential diagnostic problems with a simple overloaded throcanteric bursitis, a tubercular coxitis, a septic arthritis, an idiopathic femoral head necrosis and last but not least, lytic bone metastases. Rest and reduction in weight bearing are the best course of action in eliminating the problem. The treatment however is not well defined even if calcium, vitamin D and occasionally biphosphonates are often prescribed. As in the case presented, positive progress can be obtained and the problem is resolved in 2 to 3 months. The diagnosis of these cases may be hindered by the uncommon use of x-rays during pregnancy, although during the last three months, the possible negative effects for the fetus are reduced. Other exams, like MRI and ultrasonography, are not dangerous in pregnancy but rarely are a REFERENCES 1) Miller MJ, Low LK,Zielinski R.,Smith AR,De Lancey JOL,Brandon C. Evaluating maternal recovery from labor and delivery: bone and levator ani injuries.Am J Obst Gyn 2015, 213, 188-201 2) Karlsson MK,Ahlborg HG,Karlsson C..Maternity and bone mineral density. Acta Orthop 2005,76, 2-13, 3) Karlsson C,Obrant KJ,Karlsson M.Pregnancy and lactation confer reversible bone loss in humans. Osteoporos Int 2001 12(10) 828-34 4) Mignani G,Rotini R,Marchiodi L,Bianco T. Le fratture del collo femorale da osteoporosi gravidica. Giornale Italiano di Ortopedia e Traumatologia. 1994 ,XX,4, 523-31 5) Di Gregorio S,Danilowicz K.,Rubin Z., Mautalen C. Osteoporosis with vertebral fractures associated with pregnancy and lactation. Nutrition 2000; 16(11-12) 1052-5 G. Formelli et al. useful support in diagnosis. The x-ray shows a typical uniform low density, rarely patchy images of the femural head and the ischio-pubic rami (a characteristic of algodystrophia). Instead the MRI scans in the study of the hip in its initial stages can be inadequate, with results in common and similar images to avascular idiopathic osteonecrosis. In the event of hip pain in the last three months of pregnancy, a simple suspect or an early diagnosis, that lead to a reduction or elimination of weight bearing can avoid the emergence of pathological fractures leading to successive possible complications such as bone necrosis and bone non unions. In the presence of pathological fractures, above all concerning the proximal femur, an early diagnosis is mandatory in conserving the femur integrity, whereas in the case of a late diagnosis it is nearly always necessary (as has been described in two of our old cases reported), to proceed surgically with a complete prosthesis(4), a devastating operation particularly for young patients with high expectancy levels of physical activity and involved in work and family activities. Therefore, more than in any other fields, there is a need for a continuous interdisciplinary collaboration between obstetric and orthopaedic consultants in order to obtain an early diagnosis and resolution of these cases. 6) Sarli M.,Hakim C., Zanchetta J. Osteoporosis during pregnancy and lactation.Report of eight cases. Medicine 2005, 65 (6) 489-94 7) Stumpf UC,Kurth AA,Fassbender WJ Pregnancy associated osteoporosis: an underestimated and underdiagnosed severe disease.A review of two cases in short- and long-term follow up. Adv Med Sci 2007 ,52, 94-7 8) Ensom MH,Liu PY,Stephenson MD,Effect of pregnancy on bone mineral density in healthy women. Obstet Gynecol Surv 2002 57(2) 99-111 9) Kovacs CS Calcium and bone metabolism disorders during pregnancy and lactation. Endocrinol Metab Clin North Am 2011 40(4) 795-826 10) Khalkwarf HJ , Specker BL Bone mineral changes during pregnancy and lactation. Endocrine 2002 17(1) 49-53 47 Italian Journal of Gynaecology & Obstetrics June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868 The timing of elective caesarean delivery at term in Lombardy: a comparison of 2010 and 2014 Giuseppe Trojano1, Michele Vignali1, Mauro Busacca1, Sonia Cipriani2, Giovanna Esposito2, Camilla Bulfoni3, Fabio Parazzini2,4 Dipartimento Materno Infantile – ASST FBF-Sacco, Ospedale Macedonio Melloni Università degli Studi di Milano, Milan Italy 2 Fondazione IRCCS Cà Granda, Dipartimento Materno-Infantile, Ospedale Maggiore Policlinico, Università degli Studi di Milano, Milan, Italy 3 Dipartimento Materno-Infantile, Ospedale Niguarda, Milan, Italy 4 Dipartimento di Scienze Cliniche e di Comunità, Università di Milano, Milan, Italy 1 ABSTRACT Elective caesarean section (CS) before 39 completed weeks of gestation increases likelihood of respiratory morbidity in newborns and admissions in neonatal intensive care. Thus, guidelines have recommended that planned caesarean section should not be routinely carried out before 39 completed weeks of gestation. In this paper, we have analyzed the timing of elective CS after 37th completed weeks of gestation in 2010 and 2014 in Lombardy, a region of the North of Italy, in order to evaluate whether there was a measurable change in clinical practice during the last years in the timing of the elective CS. We analyzed data of all deliveries Lombardy, in period of time between 1st January31th December 2010 and 1st January-31th December 2014. From all deliveries, we identified all elective CS deliveries at term.The frequency of elective CS in 37th and 38th week of gestation decreased respectively from 14,2% and 46,7% in 2010 to 13,7% and 44,6% in 2014 (chi square test 37-38 vs 39 or more p<0,05). Likewise the proportion of elective CS in 39th week of gestation increased from 28,4% in 2010 to 33,3% in 2014. This finding was statistically significant. Similar findings emerged when the analysis was performed separately in strata of women who had a pregnancy with a breech presentation and those who had a previous caesarean section/uterine scar. In conclusion, the results of this analysis suggest that obstetricians in Lombardy have responded to the increasing evidence on the benefits of delaying elective CS, but still a large number of elective Cs at term are performed before the 39th week of gestation. Keywords: Elective cesarian section; week of gestation 48 Correspondence to: [email protected] Copyright 2015, Partner-Graf srl, Prato DOI: 10.14660/2385-0868-43 SOMMARIO Il taglio cesareo elettivo eseguito prima della fine della 39 settimana compiuta di gestazione aumenta la probabilità di morbosità respiratoria dei neonati ed i ricoveri in terapia intensiva neonatale. Le linee guida, pertanto hanno raccomandato che un taglio cesareo elettivo non dovrebbe essere effettuato prima di 39 settimane compiute di gestazione. In questo articolo abbiamo analizzato il timing del taglio cesareo elettivo dopo la 37 settimana compiuta di gestazione nel periodo compreso tra il 2010 e 2014 in Lombardia per valutare se vi era stato un cambiamento quantificabile nella pratica clinica dell’epoca di esecuzione del cesareo elettivo durante gli ultimi anni. Sono stati analizzati i dati relativi a tutti i parti in Lombardia nel periodo compreso tra il 1° Gennaio 2010 e il 31 Dicembre 2010 ed il 1° Gennaio 2014 e il 31 Dicembre 2014. Fra tutti i parti, sono stati identificati i tagli cesarei elettivi a termine. La frequenza dei tagli cesarei a 37 e 38 settimane è diminuita rispettivamente dal 14.2 % e 46,7% nel 2010 al 13,7% e 44,6% nel 2014 (chi square test 37-38 vs 39 + settimane p<0,05). Allo stesso modo la proporzione di tagli cesarei elettivi a 39 settimane è aumentata dal 28,4% nel 2010 al 33,3% nel 2014. Questi dati sono risultati essere statisticamente significativi. Simili risultati sono emersi quando l’analisi è stata eseguita separatamente tra il gruppo di donne con feto in presentazione podalica e gruppo di donne con pregresso taglio cesareo/cicatrici uterine. In conclusione I risultati di questa analisi dimostrano che gli ostetrici in Lombardia hanno risposto all’evidenza crescente dei benefici del ritardo del taglio cesareo elettivo ma ancora un grande numero di tagli cesarei a termine sono eseguiti prima della 39 settimana di gestazione. G. Trojano et al. Timing of elective cesarean section INTRODUCTION In the last fifteen years several studies have suggested that elective caesarean section (CS) before 39 completed weeks of gestation increases likelihood of respiratory morbidity in newborns and admissions in neonatal intensive care (1-7). Following these results, since the mid 2000, guidelines have recommended that planned caesarean section should not be routinely carried out before 39 completed weeks of gestation(8,9). Along this line, recently the proportion of elective CS after the 39th week of gestation has been proposed as indicator of quality of obstetric care(10). At our knowledge the impact in the routine clinical practice of these guidelines in Italy have not been investigated. In this paper, we have analyzed the timing of elective CS after 37th completed weeks of gestation in 2010 and 2014 in Lombardy, a region of the North of Italy, in order to evaluate whether there was a measurable change in clinical practice during the last years in the timing of the elective CS . In conclusion, the results of this analysis suggest that obstetricians in Lombardy have responded to the increasing evidence on the benefits of delaying elective CS, but still a large number of elective Cs at term are performed before 39 week of gestation. MATERIALS AND METHODS This is a population-based study using data from a regional data-base. In Lombardy, a standard form is used to register all births and neonatal discharges from public or private hospitals. All admissions and discharges are codified according to the International Classification of Diseases 9th edition – Clinical Modification (ICD-9-CM), Italian version. For all deliveries, information is available for maternal age, maternal country of birth and reason for admission. Further at delivery, a specific form is filled by midwifes including information on pregnancy on maternal characteristics type of conception (spontaneous/non spontaneous (i.e., after ART or medically induced ovulation only), course of pregnancy, delivery and maternal outcome at birth (CedAP data base). Data from this data base have been linked with the hospital discharge data base in order to obtain detailed information on delivery, pregnancies and maternal and paternal characteristics. We analyzed data of all deliveries Lombardy, in period of time between 1st January31th December 2010 and 1st January-31th December 2014. From all deliveries, we identified all elective CS deliveries. Further, we computed the distribution of elective CS at term in the considered calendar period according to week of gestation at surgery. Gestational age was considered as completed week of gestation. Further, we repeated the analysis for each of these two groups: women who had a pregnancy with a breech presentation and those who had a previous caesarean section/ uterine scar. According to the Italian law, this study constituted service evaluation and did not require ethics approval because it considered the analysis of anonymous data collected in routine data base. RESULTS During the period 1st January-31th December 2010 a total of 97.407 deliveries were registered in the CEDAP data base. The corresponding figures for the period 1st January-31th December 2014 was 87.548. After exclusion of records with missing information about gestational age at birth, a total of 17.894 elective CS were identified in 2010 and 15.299 (85,5%) of those were performed at term (≥37 weeks of gestation). The corresponding figures for 2014 were 15.007 and 12.634 (84,2%). The distribution of elective CS at term according to selected factors and calendar period are considered in Table 1. In 2014 mothers who underwent elective CS at term were, in comparison with those who underwent it in 2010, older, more frequently nulliparous and reported more frequently a previous CS. Table 2 considers the distribution of elective CS at term according to the week of gestation in 2010 and 2014. The frequency of elective CS in 37th and 38th week of gestation decreased respectively from 14,2% and 46,7% in 2010 to 13,7% and 44,6% in 2014 (chi square test 37-38 vs 39 or more p<0,05). Likewise the proportion of elective CS in 39th week of gestation increases from 28,4% in 2010 to 33,3% in 2014. This finding was statistically significant. Similar findings emerged when the analysis was performed separately in strata of women who had a pregnancy with a breech presentation and those who had a previous caesarean section/uterine scar. 49 It. J. Gynaecol. Obstet. 2016, 28: N.2 Table 1. Distribution of elective CS at term according to selected factors and calendar period. Table 2. Distribution of elective CS at term according to week of gestation, neonatal presentation and previous CS in 2010 and 2014. 50 Timing of elective cesarean section G. Trojano et al. Timing of elective cesarean section DISCUSSION The general results of this analysis show that during the period 2010-2014 a shift from 38th to 39th week of gestation occurred in the timing of elective CS in Lombardy. Before of discussing these results potential limitations should be considered. In general analysis based on large data set may suffer some limitations on accuracy. In particular, we have no information on the quality of definition of gestational age. However, in Italy less than 4% of pregnant women undergo the first examination after the 12 week of gestation(11). Further any miss classification should tend to reduce the differences among calendar periods. We have considered all deliveries, thus at least in part our results may be affected by the inclusion in the analysis of elective CS due to conditions that might necessitate intervention before 39 weeks gestation. It is unlikely however that the proportion of these conditions markedly changed from 2010 to 2014. The trend observed in our analysis is consistent with the findings of previous large population based studies conducted in different populations. For example in the UK the proportion of REFERENCES 1) van den Berg A, van Elburg RM, van Geijn HP, Fetter WP. Neonatal respiratory morbidity following elective caesarean section in term infants. A 5-year retrospective study and a review of the literature. Eur J ObstetGynecolReprod Biol. 2001;98(1):9–13. 2) Zanardo V, Simbi KA, Vedovato S, Trevisanuto D. The influence of timing of elective cesarean section on neonatal resuscitation risk. PediatrCrit Care Med. 2004;5(6):566–570. 3) Hansen AK, Wisborg K, Uldbjerg N, Henriksen TB. Risk of respiratory morbidity in term infants delivered by elective caesarean section: cohort study. BMJ. 2008;336(7635):85–87. 4) Tita AT, Landon MB, Spong CY, Lai Y, Leveno KJ, Varner MW, Moawad AH, Caritis SN, Meis PJ, Wapner RJ, Sorokin Y, Peaceman AM, O’Sullivan MJ, Sibai BM, Thorp JM, Ramin SM, Mercer BM. Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD) Maternal-Fetal Medicine Units Network (MFMU) Timing of elective repeat cesarean delivery at term and neonatal outcomes. N Engl J Med. 2009;360(2):111–120. 5) Clark SL, Miller DD, Belfort MA, Dildy GA, Frye DK, Meyers JA. Neonatal and maternal outcomes associated with elective term delivery. Am J ObstetGynecol. 2009;200(2):e151–154. 156. 6) Farchi S, Lallo DD, Franco F, Polo A, Lucchini R, Calzolari F, De Curtis M. Neonatal respiratory morbidity and mode of delivery in a population-based elective CS done between 39 and 40 weeks increased from 39% to 63% from 2000 to 2009(12). In the USA, organizations have begun using indicators to monitor the proportion of elective CS performed after 39 completed weeks on women with an uncomplicated pregnancy(10). A recent paper has suggested that a 95% rate of elective delivery after 39 weeks would be a reasonable national quality benchmark in the USA(13). In the previous quoted UK analysis the current rate was about 80%(12). In conclusion, the results of this analysis suggest that obstetricians in Lombardy have responded to the increasing evidence on the benefits of delaying elective CS. This analysis gives some favorable support to the role of guideline in improving obstetric routine practice, but still a large number of elective Cs at term are performed before the 39th week of gestation in Lombardy. COMPETING INTERESTS The authors declare that they have no competing interests. study of low-risk pregnancies. ActaObstetGynecol Scand. 2009. pp. 1–4. 7) Yee W, Amin H, Wood S. Elective cesarean delivery, neonatal intensive care unit admission, and neonatal respiratory distress. Obstet Gynecol. 2008;111(4):823–828. 8) National Collaborating Centre for Women’s and Children’s Health. Caesarean section: Clinical Guideline. 2004. 9) ACOG Committee Opinion No. 394, December 2007. Cesarean delivery on maternal request. ObstetGynecol. 2007;110(6):1501. 10) Main EK. New perinatal quality measures from the National Quality Forum, the Joint Commission and the Leapfrog Group. CurrOpinObstetGynecol. 2009. 11) Certificato di assistenza al parto (CedAP) Analisi dell’evento nascita http://www.salute.gov.it/ imgs/C_17_pubblicazioni_2024_allegato.pdf 12) Gurol-Urganci I, Cromwell DA, Edozien LC, Onwere C, Mahmood TA van der Meulen JH The timing of elective caesaren delivery between 2000 and 2009 in England. BMc pregnancy and childbirth 2011; 11:43 13) Clark SL, Frye DR, Meyers JA, Belfort MA, Dildy GA, Kofford S, Englebright J, Perlin JA. Reduction in elective delivery at < 39 weeks of gestation: comparative effectiveness of 3 approaches to change and the impact on neonatal intensive care admission and stillbirth. Am J ObstetGynecol. 2010;203(5):e441– 446. 449 51 Italian Journal of Gynaecology & Obstetrics June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868 Centiles of weight at term birth according to maternal nationality in a Northern Italian region Fabio Parazzini1,2, Sonia Cipriani2, Giuseppe Bulfoni2, Paola Agnese Mauri1, Giorgia Carraro2, Salvatore Andrea Mastrolia3, Mauro Busacca4, Giuseppe Trojano4 Dipartimento di Scienze Cliniche e di Comunità, Universita’ degli Studi di Milano, Milan Italy Fondazione IRCCS Cà Granda, Dipartimento Materno-Infantile, Ospedale Maggiore Policlinico, Milan, Italy 3 Dipartimento di Ostetrica e Ginecologia AOU Policlinico di Bari Università degli Studi di Bari, Bari, Italy 4 Dipartimento Materno-Infantile, ASST FBF-Sacco Ospedale Macedonio Melloni, Università degli Studi di Milano, Milan, Italy 1 2 ABSTRACT Country specific birthweight curves may reflect the ethnic composition of that population and may offer information on the “true“ birth weight distribution of new births from native and foreign mothers. In consideration of the fact that in Italy now about 30% new births born in foreigners, we analyzed the centiles of weight at birth separately for the native Italian women and foreign ones. We considered data of all deliveries in a Northern Italian Region (Lombardy) with a population of about 10 millions inhabitants, in period of time between 1st January 2010 and 31th December 2014. Gestational age was considered as completed week of gestation. On the basis of these data we computed the 10th, 50th and 90th centile values of neonatal birthweight from the 37th to 42nd week of gestation at delivery for the total population and separately for native Italian and the five more common nationality of non Italian women (i.e. women born in Morocco, Albania and Romania, China and Egypt). These nationality were considered since they represent at least the 5% of all foreigner mothers. The values of centiles were higher in males than in females in all the gestational weeks and the different maternal nationality populations. Lower centiles values were observed in babies born by Italian women, the higher been observed in babies born by Chinese women and Maroccan and Egyptian ones with differences of about 100-200gr among babies born form mother with these nationality in comparison with babies born by Italian mothers. This descriptive analysis of centiles of weight at birth in Lombardy provides Italian obstetricians and neonatologist with curves of fetal growth more closely representing the population under curve. Keywords: Centiles; birth; weight 52 Correspondence to: [email protected] Copyright 2015, Partner-Graf srl, Prato DOI: 10.14660/2385-0868-44 SOMMARIO Curve di peso alla nascita specifiche di una area geografica riflettono la composizione etnica di quella popolazione e possono offrire informazioni sulla “vera” distribuzione del peso nascita di nuove nascite da madri autoctone e straniere. In considerazione del fatto che in Italia ormai circa il 30% di nuovi nati nasce da madri straniere, abbiamo analizzato i centili di peso alla nascita separatamente per i nati da donne italiane native e da donne nate in altre nazioni. Abbiamo preso in considerazione i dati di tutte i parti avvenuti in Lombardia nel periodo compreso tra il 1° gennaio 2010 ed il 31 dicembre 2014. Sulla base di questi dati abbiamo calcolato il valore del 10°, 50° e 90° centile di peso alla nascita per i nati a termine (37°-42° settimana di gestazione al parto) per la popolazione totale e separatamente per le madri nate in Italia e le madri nate nelle cinque nazioni più comuni tra le donne non italiane (Marocco, Albania e Romania, Cina ed Egitto). I valori dei centili erano più alti nei maschi rispetto alle femmine in tutte le settimane di gestazione e le diverse nazionalità della madre. Sono stati osservati valori inferiori dei centili nei bambini nati da donne italiane, i più alti valori dei centili sono stati osservati nei bambini nati da donne cinesi, marocchine ed egiziane con differenze di circa 100-200gr tra i bambini nati da madri con queste nazionalità rispetto ai bambini nati da madri italiane . Questa analisi descrittiva dei centili di peso alla nascita in Lombardia offre agli ostetrici ed ai neonatologi curve di crescita fetale che meglio rappresentano la nostra popolazione. F. Parazzini et al. Centiles of weight at birth in Lombardy INTRODUCTION The available percentiles of weight at birth by gestational age vary widely. Published data shown, for the same gestational week, differences of hundreds of grams for the median values or for the 5th and 95th percentiles(1-5). Part of these differences are due to the criteria used for the definition of study births. For example, some studies have excluded pathological pregnancies, but some differences are likely due to the different populations considered. In fact maternal ethnicity is a determinant of low birth weight. It has been suggested that birthweight centiles are generally higher among term infants born to mothers who immigrate in elevated income countries than those of infants born in their respective native countries(6). Thus it is important to be available data from each countries or regions. In fact, country specific birthweight curves may reflect the ethnic composition of that population and may offer information on the “true“ birth weight distribution of new births from native and foreign mothers. In Italy percentiles of weight at birth for gestational age have been published in 1995 and 2010(7-9). These analysis, however, have not presented separately the percentiles according to maternal nation of birth. Nowadays in Italy now about 30% new births born in foreigners so, it is useful to analyze the centiles of weight at birth separately for the native Italian women and foreign ones. Further, it has been shown that birthweight mean increased over recent decades, thus up-todate centiles for birthweight for gestational age are useful in clinical practice(10). METHODS This is a population-based study using data from a regional data-base. In Lombardy, a standard form is used to register all births and neonatal discharges from public or private hospitals. All admissions and discharges are codified according to the International Classification of Diseases 9th edition – Clinical Modification (ICD-9-CM), Italian version. For all deliveries, information is available for maternal age, maternal country of birth and reason for admission Further at delivery, a specific form is filled by midwives including information on pregnancy on maternal characteristics type of conception (spontaneous/ non spontaneous (i.e., after ART or medically induced ovulation only), course of pregnancy, delivery and maternal outcome at birth (CedAP data base). Data from this data base have been linked with the hospital discharge data base in order to obtain detailed information on delivery, pregnancies and maternal characteristics. We analyzed data of all deliveries in a Northern Italian Region (Lombardy) with a population of about 10 millions inhabitants, in period of time between 1st January 2010 and 31th December 2014. Gestational age was considered as completed week of gestation. On the basis of these data we computed the 10th, 50th and 90th centile values of neonatal birthweight from the 37th to 42nd week of gestation at delivery for the total population and separately for native Italian and the five more common nationality of non Italian women (i.e. women born in Morocco, Albania and Romania, China and Egypt).These nationalities were considered since they represent at least the 5% of all foreigner mothers. In the computation of centiles we used the methods reported in previous publications(11,12) to evaluate the quality of birthweight data, we compared the information reported in CedAP data-base and SDO data-base. We applied the Tukey’s methodology(12) for identifying outliers. For each data-base separately, we considered the distribution of birthweight by sex and gestational age. The cases with birthweight lower than the first quartile minus twice the interquartile range (lower Tukey limit) or higher than the third quartile plus twice the interquartile range (upper Tukey limit) were considered outliers. CedAP values were considered in the analysis. In the cases where CedAP value was an outlier and SDO value were not, CedAP data-base value was corrected with SDO data-base value. Then we applied Tukey’s methodology to CedAP data-base distribution and eliminated outliers cases. RESULTS We identified in the CedAP data-base a total of 361.756 singleton babies, born in Lombardy region (Northern Italy) during the period 1st January 2010 to 31st December 2014. This data-base was linked with SDO (discharge register) data-base: 8.189 (2,3%) records were deleted due to a lack of link between the two data base After the exclusion of cases with missing values on gestational age, sex of newborn and birth weight (n=2850, 0,8%) and deletion of cases with outlier values of birthweight (n=1250, 0,4%) we considered 349.467 newborns. Among this, 330.007 (94,4%) term births 53 It. J. Gynaecol. Obstet. 2016, 28: N.2 (gestational age ≥37 weeks) were considered in present analysis. The distribution of maternal characteristics and course of pregnancy of considered births are shown in Table 1 according to maternal nationality. Italian women were older and nulliparae and more frequently reported non spontaneous conception and previous cesarean section. The 10th, 50th and 90th centiles of weight at birth for gestational age in the total population and in strata of maternal nationality are shown in Table 2. The values of centiles were higher in males than in females in all the gestational weeks and the different maternal nationality populations. Table 1. Distribution of maternal characteristics according to country of birth. 54 Centiles of weight at birth in Lombardy Lower centiles values were observed in babies born by Italian women, the higher been observe in babies born by Chinese women and Moroccan and Egyptian ones. DISCUSSION The objective of the present analysis is to offer information on centiles of weight at birth for term births in Italian and not Italian women, considering women who delivered in the period 2010-2014 in Lombardy. Potential limitations of this analysis should be briefly discussed. Information considered are based on routinely Centiles of weight at birth in Lombardy F. Parazzini et al. Table 2. Centiles of weight at birth according to gestational age and maternal country of birth. 55 It. J. Gynaecol. Obstet. 2016, 28: N.2 collected data base. However, the quality and completeness of data considered was generally satisfactory . For example there was no missing values on birth weight and gestational week of delivery was missing in less than 1% of cases. We have no information on the quality of definition of gestational age. However, in Italy, less than 4% of pregnant women undergo the first examination after the 12 week of gestation(13). The results of this analysis shows differences of about 100-200gr among babies born form mother with different nationality in comparison with babies born by Italian mothers. These differences are consistent with those reported in other countries(14). The discussion of these differences is REFERENCES 56 1) Dobbins TA, Sullivan EA, Roberts CL, Simpson JM. Australian national birthweight percentiles by sex and gestational age, 1998–2007. Med J Aust. 2012;197(5):291–4; 2) Sankilampi U, Hannila ML, Saari A, Gissler M, Dunkel L. New population-based references for birth weight, length, and head circumference in singletons and twins from 23 to 43 gestation weeks. Ann Med. 2013;45(5–6):446–54 3) Goldenberg RL, Cutter GR, Hoffman HJ, Foster JM, Nelson KG, Hauth JC. Intrauterine growth retardation: standards for diagnosis. Am J Obstet Gynecol. 1989 Aug;161(2):271-7. Review 4) Bonellie S, Chalmers J, Gray R, Greer I, Jarvis S, Williams C. Centile charts for birthweight for gestational age for Scottish singleton births. BMC Pregnancy Childbirth. 2008 Feb 25;8:5. doi: 10.1186/1471-2393-8-5. 5) Fok TF, So HK, Wong E, Ng PC, Chang A, Lau J, Chow CB, Lee WH; Hong Kong Neonatal Measurements Working Group Updated gestational age specific birth weight, crown-heel length, and head circumference of Chinese newborns. Arch Dis Child Fetal Neonatal Ed. 2003 May;88(3):F229-36 6) Boshari T, Urquia ML, Sgro M, De Souza LR, Ray JG Differences in birthweight curves between newborns of immigrant mothers vs. infants born in their corresponding native countries: systematic overview. Paediatr Perinat Epidemiol. 2013 Mar;27(2):118-30 7) Parazzini F, Cortinovis I, Bortolus R, Fedele L, Decarli A. Weight at birth by gestational age in Italy.Hum Reprod. 1995 Jul;10(7):1862-3. 8) Gagliardi L, Macagno F, Pedrotti D, Coraiola N, Centiles of weight at birth in Lombardy beyond the scope of this analysis. The presented figures give the “true” centiles in Lombardy, thus they reflect the different age and parity distribution of mothers born in different countries. In conclusion this descriptive analysis of centiles of weight at birth in Lombardy provides Italian obstetricians and neonatologist with curves of fetal growth more closely representing the population under cure. In particular it offers information at our knowledge not available before on the distribution of centiles of weight at birth on babies born from foreign mothers in Italy and underlines the role of using birth weight curves tailored to maternal country of birth(15). Furlan R, Agostini L, Milani S. Standard antropometrici neonatali prodotti dalla task-force della Società Italiana di Neonatologia e basati su una popolazione italiana Nord-Orientale. Riv Ital Ped 1999; 25: 159-169. 9) Bertino E, Spada E, Occhi L, Coscia A, Giuliani F, Gagliardi L, Gilli G, Bona G, Fabris C, De Curtis M, Milani S. Neonatal anthropometric charts: the Italian neonatal study compared with other European studies. J Pediatr Gastroenterol Nutr. 2010 Sep;51(3):353-61. doi: 10.1097/MPG.0b013e3181da213e. 10) Bonellie S, Chalmers j Gray R Greer I Jarvis S Williams C centile charts for birth weight for gestational age for Scottish singleton births BMC Pregnancy Childbirth 2008 Feb 25; 8:5 11) Li Z, Umstad MP, Hilder L, Xu F, Sullivan EA Australian national birthweight percentiles by sex and gestational age for twins, 2001-2010. BMC Pediatrics 2015:15;148. 12) Tukey JW. Exploratory data analysis, vol. 231. Reading, MA: Addison-Wensley; 1977. 13) Certificato di assistenza al parto (CeDAP) Analisi dell’evento nascita http://www.salute.gov.it/ imgs/C_17_pubblicazioni_2024_allegato.pdf 14) Ray JG, Sgro M, Mamdani MM, Glazier RH, Bocking A, Hilliard R, Urquia ML. Birth weight curves tailored to maternal world region. J Obstet Gynaecol Can. 2012 Feb;34(2):159-71 15) Marcelo L. Urquia PhD MSc , Howard Berger MD, Joel G. Ray MD MSc; for the Canadian Curves Consortium Risk of adverse outcomes among infants of immigrant women according to birth-weight curves tailored to maternal world region of origin CMAJ, 2015, 6:187(1) Italian Journal of Gynaecology & Obstetrics June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868 Altered lamin A expression as a possible prognostic biomarker in endometrioid endometrial cancers Lucia Cicchillitti1, Giacomo Corrado2, Mariantonia Carosi3, Rossella Loria1, Malgorzata Ewa Dabrowska3, Giuseppe Trojano4, Emanuela Mancini2, Giuseppe Cutillo2, Rita Falcioni1, Giulia Piaggio1, Enrico Vizza2 Department of Research, Advanced Diagnostics and Technological Innovation, Area of Translational Research, “Regina Elena” National Cancer Institute, Rome, Italy. 2 Department of Experimental clinical Oncology, Gynecologic Oncology Unit, “Regina Elena” National Cancer Institute, Rome, Italy. 3 Department of Research, Advanced Diagnostics and Technological Innovation, Anatomy Pathology Unit “Regina Elena” National Cancer Institute, Rome, Italy. 4 Department of Obstetrics and Gynaecology, ASST Fatebenefratelli-Sacco M. Melloni Hospital, Milan, Italy 1 ABSTRACT Endometrial cancer (EC) is a major cause of mortality for patients worldwide. EC is classified as type I, also called the endometrioid type (EEC), or type II based on histologic properties. Although most cases of low grade EECs do not behave aggressively, in rare instances, even low-grade, well-differentiated EECs can progress in a highly aggressive manner, and the prognosis for recurrent or metastatic EEC remains poor. In this study, we performed a retrospective cohort of several formalinfixed, paraffin-embedded (FFPE) specimens from patients with EEC to find novel clinical and biological features to help the diagnosis and consequently the treatment EEC. Total RNA and proteins were extracted and analyzed, respectively, by quantitative PCR and western blotting. We found that alteration of lamin A levels is associated with EEC development, thus indicating its possible role as novel potential biomarker. Interestingly, loss of lamin A was consistently associated with lower estrogen receptor (ERs) expression in low grade EEC, whereas in higher grade it was significantly related with E-cadherin mRNA (CDH1) reduced levels. Our data strongly indicate lamin A as a novel predictive biomarker of aggressiveness with a potential for a more systematic integration in clinical practice for individualized therapy in EEC. Keywords: Endometrioid Endometrial Cancer, Estrogen Receptor, Lamin A, E-Cadherin. Correspondence to: [email protected] Copyright 2015, Partner-Graf srl, Prato DOI: 10.14660/2385-0868-45 SOMMARIO Il cancro dell’endometrio è una delle principali cause di mortalità per i pazienti in tutto. E’ classificato, in base alle caratteristiche istologiche, in due tipi, il tipo I, chiamato anche tipo endometrioide (EEC), e il tipo II. Sebbene la maggior parte dei casi di basso grado non si comportino in modo aggressivo, in rari casi, anche i tumori dell’endometrio di basso grado e ben differenziato possono progredire in modo molto aggressivo e la prognosi in caso di recidiva o metastasi a distanza rimane infausta. In questo studio, abbiamo condotto una analisi retrospettiva su diversi tessuti inclusi in paraffina (FFPE) da pazienti con tumore di tipo endometrioide (EEC) allo scopo di identificare nuovi markers per aiutare la diagnosi e di conseguenza il trattamento dei tumori dell’endometrio. In questo studio L’RNA e le proteine estratti sono stati analizzati rispettivamente mediante PCR quantitativa e western blotting. Abbiamo osservato che alterati livelli di lamin A sono associati allo sviluppo del tumore dell’endometrio, indicando il suo possibile ruolo come potenziale biomarcatore. La diminuzione dei livelli di lamin A è strettamente associata a riduzione dei livelli dei recettori degli estrogeni nei tumori di basso grado, mentre è associata in maniera significativa a riduzione di espressione di mRNA di E-Caderina (CDH1) nei tumori di alto grado.I nostri studi indicano la Lamin A come un nuovo biomarcatore prognostico da utilizzare nella pratica clinica per il trattamento personalizzato del cancro dell’endometrio. 57 It. J. Gynaecol. Obstet. 2016, 28: N.2 INTRODUCTION 58 Endometrial cancer (EC) is a major cause of mortality for patients worldwide. Most EC cases are sporadic, with only 10% considered familiar(1). In general, patients with EC have a good prognosis since early diagnosis is frequent and the disease has usually not spread beyond the uterus. EC is clinically classified into two groups to assess the risk for metastatic and recurrent disease, type I and type II. Type I, also called the endometrioid type (EEC) because of its histologic similarity to the endometrium, accounts approximately 70–80% of sporadic EC and is characterised by hyperoestrogenic risk factors, low stage and grade, and favourable outcome. By contrast, type II cancers are associated with higher patient age, high stage and grade, non-endometrioid histology, and poor prognosis. However, the clinical and prognostic value of this distinction is suboptimal with substantial phenotypic overlap; about 20% of type I cancers recur with a median survival of 7–12 months, while 50% of type II cancers do not(2). EC patients require more effective systemic therapy than is presently available to well selected patient populations to increase the likelihood of benefits. In order to improve therapy it is important to understand the processes which inhibit and stimulate cancer progression. Currently, adjuvant and systemic treatment of recurrent and metastatic EC are based on conventional chemotherapy and anti-hormonal treatment. The cellular action of estrogens is mediated trough the estrogen receptors (ERs) that belong to the nuclear steroid receptor superfamily. Two distinct ERs, defined as ER-α and ER-β, have been identified. In the human uterus, ER-α is the predominant subtype(3-5). Expression of ERs has been correlated with stage, histologic grade and survival(6-7). Loss of ERs has been significantly associated with aggressive phenotype and poor survival in EC patients. In particular, early stage, well differentiated ECs usually retain ERs expression, whereas advanced stage, poorly differentiated tumours often lack one or both receptors. Recently, it has also been observed an association between lack of ER-α and epithelialmesenchymal transition (EMT)(8). EMT enables epithelial cells to acquire a like mesenchymal potential with increase motility and ability to extravasate and circulate. The process of EMT is associated with the progressive redistribution or downregulation of the apical and basolateral epithelial cell-specific tight and adherens junction proteins such as E-cadherin and cytokeratin, and novel expression of mesenchymal Lamin A as novel molecular prognostic biomarker for EC molecules such as vimentin and N-cadherin. Importantly, some promising studies showed that targeting EMT markers might be an interesting and successful tool in future cancer therapy(9-11). In EC, aberrant expression of major EMT markers have been identified in metastatic disease and associated with adverse prognosis, such as such as lower expressions of E-cadherin and alphacatenin, and overexpressions of N-cadherin, betacatenin, vimentin, and matrix metalloproteinases, thus indicating the prognostic impact of EMT status(12). Numerous studies suggest that reduced or absent lamin A expression is a common feature of a variety of different cancers, including small cell lung cancer (SCLC), skin basal cell and squamous cell carcinoma, testicular germ cell tumour, prostatic carcinoma, leukemia and lymphomas(13-18). Expression and function of lamin A are involved in regulation of gene expression in health and disease through interplay with cell cycle progression, DNA replication, signal transduction pathways, transcription factors, chromatinassociated proteins and tissue homeostasis and the reduction in its expression frequently correlates with proliferative capacity and differentiation state. Lamin A is a type V intermediate filament (IF) protein encoded by the LMNA gene and a major nuclear architectural protein important for maintaining nuclear membrane inner structure integrity and function(19).Disruption of one or more of these functions due to lamin mutations cause a group of inherited diseases affecting various tissues and organs or causing accelerated ageing(20-24). In this study, we analysed several EEC tissues to find novel clinical and biological features to help the diagnosis and consequently the treatment of early EEC. We observed a large decrease in the levels of lamin A mRNA (LMNA) and protein levels in EEC as compared with benign tissues. Moreover, LMNA loss further increased in higher grade EEC tissues. Interestingly, clustering of the mRNA expression of ERs and LMNA indicated an association between low expression of LMNA and loss of ERs in low grade EECs, thus suggesting a potential role of lamin A in EC invasiveness and aggressiveness in less aggressive ECs. In grade 3 EECs, generally expressing very low levels of ERs and lamin A, these correlation did not occur. Several papers support the hypothesis that E-Cadherin expression patterns in high-grade EC are associated with more aggressive characters and poor prognosis to ECs(25-27). We observed a L. Cicchillitti et al. Lamin A as novel molecular prognostic biomarker for EC significant correlation between decreased LMNA expression with lower E-cadherin mRNA (CDH1) levels in high grade ECs. Altogether, our findings strongly support the potential role of lamin A status in EC aggressiveness and its role as prognostic biomarker in association with ER status or with CDH1 expression in low grade or high grade EECs, respectively. Moreover, our results indicate that evaluation of LMNA expression related with ERs status may be used as predictive biomarker in low grade EECs. MATERIALS AND METHODS Patient cohort A retrospective cohort of formalin-fixed, paraffin-embedded (FFPE) specimens from patients with endometriod endometrial cancer (EEC, n=80) and normal tissue specimens (NE, n=13) from patients who underwent a hysterectomy to treat other benign disease were collected. According with the histologic grade, we analysed 31 grade 1 (G1), 14 grade 2 (G2) and 35 grade 3 (G3) samples. Biopsies were sampled for primary tumors in hysterectomy specimens. RNA extraction and RT-PCR Total RNA derived from FFPE tissues was extracted using the PureLink™ FFPE Total RNA Isolation Kit (Invitrogen) following the manufacturer’s instructions and reversetranscribed using PrimeScript RT reagent kit (Takara). The quality of the total RNA was measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington DE, USA). Quantitative PCR (qPCR) was performed using SYBR Select (Applied Biosystems) on an ABI Prism 7500 apparatus (Applied Biosystems). mRNA expression was normalized for 18S rRNA levels. Relative mRNA expression was calculated using the comparative Ct method (2−ΔΔCt). Primers LMNA fw GGACAATCTGGTCACCCGC LMNA rv TGGCAGGTCCCAGATTACATG ESR1 fw TACTGACCAACCTGGCAGACAG ESR1 rv TGGACCTGATCATGGAGGGT ESR2 fw AGTTGGCCGACAAGGAGTTG ESR2 rv CGCACTTGGTCGAACAGG CDH1 fw CCCACCACGTACAAGGGTC CDH1 rv ATGCCATCGTTGTTCACTGGA 18S rRNA fw CCTGGATACCGCAGCTAGGA 18S rRNA rv GCGGCGCAATACGAATGCCCC Immunoblotting The paraffin from thin sections of FFPE specimens was melted at 72°C for 20 minutes using heat in the presence of a specially designed Melting Buffer contained in the PureLink™ FFPE Isolation Kit used for RNA extraction (Invitrogen). Tissues were then separated from the melted paraffin by centrifugation. Proteins were extracted in a high pH lysis buffer (20 mM Tris HCl pH 9.0, 0.2 M Glycine, 2% (w/v) SDS). The samples were first incubated on ice for 5 min, and mixed by vortexing, then boiled at 100°C for 20 min followed by an l hour incubation at 80° C for 2 hours. After extraction, any remaining unsolubilized material was pelleted at 14000 × g for 20 minutes, and protein concentration of total protein extracted was determined by the BCA Protein Assay (Pierce Chemicals Co., Rockford, IL, USA). The Pierce BCA Protein Assay is a detergent compatible formulation and the protein standards were prepared using the same lysis buffer as the samples. Proteins were resolved by SDS-PAGE and electrotransferred to nitrocellulose. Each membrane was blocked with 5% non-fat dry milk in Tris buffered saline-Tween-20 (TBST) for 1 hour at room temperature and subsequently incubated with primary antibody for 16 hours at 4˚C. The following antibodies were used: anti-Lamin A (Santa Cruz), and anti-β actin (Sigma-Aldrich). Immunoreactivity was detected by sequential incubation with HRP-conjugated secondary antibody. Statistical analysis Data were reported as mean and standard deviation. Differences were considered statistically significant when P≤0.05. Student T test was performed for the comparison of results from qRTPCR (*P<0.05, **P<0.01, ***P<0.001). RESULTS Lamin A protein and mRNA altered expression levels are associated with EEC aggressiveness. A retrospective study was performed in a cohort of FFPE specimens from patients with EEC and of benign (NE) specimens from patients who underwent a hysterectomy to treat other benign disease (n = 13). According with the histologic grade, we analysed 31 grade 1 (G1), 14 grade 2 (G2), 35 grade 3 (G3) EC tissues. Biopsies were sampled for primary tumors in hysterectomy specimens. Histologic are represented in Table 1. To assess the possible involvement of lamin A in EEC, its protein expression levels were assessed by western blotting using an anti-lamin 59 It. J. Gynaecol. Obstet. 2016, 28: N.2 Table 1. Clinicopathological features of 80 EECs. RT= adjuvant radioteraphy; CHT=adjuvant chemoteraphy. BMI= body mass index; MI= myometrial infiltration. 60 Figure 1A. Representative immunoblottings of proteins extracted from benign (NE), G1, G2 and G3 EEC FFPE tissues with anti-Lamin A antibody. Anti-β actin was used as loading control. Lamin A as novel molecular prognostic biomarker for EC Lamin A as novel molecular prognostic biomarker for EC A antibody. Results showed a large reduction of lamin A protein levels in EC compared with benign tissues (Figure 1A). To investigate if lamin A down-modulation occurred also at mRNA level, we performed qRT-PCR analysis. Results displayed that LMNA levels in EECs were significantly lower than those in corresponding non-cancerous tissues (Figure 1B), indicating the involvement of an altered modulation at transcriptional levels of lamin A expression in EECs. Interestingly, decreased LMNA expression correlated with histological differentiation significantly, thus suggesting a potential role of lamin A as predictive marker of EC aggressiveness (Figure 1B and Table 2). Lamin A levels were very similar in G2 and G3 , whereas a significant Figure 1B. Average expression of LMNA mRNA expression examined by qRTPCR±SD in EEC tissues. mRNA expression was normalized for 18S rRNA levels. The error bars indicate the standard error. Statistical significance: *P<0.05, **P<0.01, ***P<0.001. The error bars indicate the standard error. L. Cicchillitti et al. reduction was observed in G2-G3 compared with G1 samples, thus suggesting that lamin A loss maybe an early event in EC. Low levels of lamin A are associated with myometrial invasion In our cohort of tissues, clinicopathologic features indicated that 25,8%, 28,5% and 68,5% of G1, G2 and G3 EECs analyzed displayed myometrial infiltration >50%, respectively (Table 1). Very interestingly, all G1 and G2 samples from tumors with myometrial invasion > 50% showed low levels of LMNA, thus suggesting a possible role of lamin A in tumor invasion prevalently in early stage of EECs. Lamin A mRNA levels are associated with ER loss in low grade EECs Expression of ERs has been correlated with EEC stage, histologic grade and survival. It has been shown that high levels of ERs directly correlate with better tumor differentiation and less myometrial invasion. In particular, loss of ERs has been significantly associated with aggressive phenotype and poor survival in EEC patients(28). It is worth to note that the ER-α is predominant subtype in the human ERs and that a significant correlation between ER-α protein and ESR-1 mRNA expression has been previously estimated by microarray and qPCR analysis(29). Therefore, we firstly evaluated mRNA expression levels of ER-α (ESR1) in our cohort of samples. Our data demonstrate that loss of ESR1 expression correlates with an aggressive clinopathologic phenotype, confirming data in literature (Figure 2A and Table 2). To explore potential biologic role of lamin A in process contributing the aggressive phenotype of ECs, we focused our attention on transcriptional differences between EECs expressing (ERs positive) and not expressing (ERs negative) both ER-α and ER-β, and LMNA mRNA levels. Clustering of the mRNA expression of ERs and LMNA indicated a significant association Table 2. Clustering of LMNA, ERs, and CDH1 expression levels. EEC histological grade in relation to levels of ERs, LMNA and CDH1 expression. Lamin A, ESR1, ESR2, and CDH1 mRNA was examined by qRT-PCR. Cut off=ECC over benign samples ≤ 0,5 61 It. J. Gynaecol. Obstet. 2016, 28: N.2 Figure 2A. Average expression of ESR1 mRNA examined by qRT-PCR±SD in EECs (G1, G2, and G3) and benign FFPE tissues (NE). mRNA expression was normalized for 18S rRNA levels. Figure 2B. LMNA expression in ERs negative compared with ERs positive (fold over control) EEC tissues. Statistical significance: *P<0.05. The error bars indicate the standard error. Lamin A as novel molecular prognostic biomarker for EC between lack of ERs expression, decreased LMNA expression (fold over control < 0,5) and higher histologic differentiation grade (Figure 2B and Table 2). Very interestingly, all ERs negative G1 and G2 EEC samples expressed concomitantly low LMNA levels (Table 2). Analysis performed in G3 EEC specimens, generally expressing very low levels of ERs and LMNA, displayed a different behavior since no differences in LMNA expression levels were detected in ERs positive compared with ERs negative tissues (Figure 2B), thus indicating that LMNA down-modulation associated with ERs loss may be an early event in EC transformation. Loss of lamin A is associated with E-cadherin status in high grade ECs Several papers support the hypothesis that E-Cadherin expression patterns in high-grade EC are associated with more aggressive characters and poor prognosis to ECs(30, 36-38). Analysis of CDH1 mRNA status in our cohort of ECCs confirmed these studies. In fact, as shown in Table 2, we found that 48,4%, 64,3%, and 77,1% displayed low levels of CDH1 levels (fold over control < 0,5) in G1, G2 and G3 EECs, respectively, thus indicating that an increase number of cases with higher grade generally display reduced expression levels of CDH1 compared with lower grade ECs. To assess the possible correlation between CDH1 mRNA levels and LMNA expression in our cohort of EC samples, we compared CDH1 levels in samples expressing low LMNA levels (fold over control < 0,5) with those expressing higher LMNA levels (fold over control > 0,5). Interestingly, we observed a significant decrease of CDH1 levels in tissues expressing low levels of LMNA compared to those expressing higher levels only in G3 EEC tissues (Figure 3). These evidences suggest an association between decreased lamin A expression and low levels of CDH1 in high grade EECs, thus further indicating a possible involvement of lamin A in tumor differentiation and aggressiveness and suggesting its role in EMT. DISCUSSION 62 Figure 3. CDH1 expression and LMNA status. Average of CDH1 mRNA expression examined by qRT-PCR±SD in EEC tissues expressing low levels of LMNA compared with positive LMNA tissues- The error bars indicate the standard error. Cut off=ECC over benign samples ≤ 0,5. Statistical significance: **P<0.01. The error bars indicate the standard error. Although three quarters of ECs are confined to the uterus and treated at an early stage, 15%–20% recur after primary surgery with limited effect of systemic therapies in metastatic disease(2,31-34). Thus, one important clinical challenge is to accurately predict risk of recurrence within this good prognosis patient subgroup in order to well selected patient populations for more extensive surgery and adjuvant therapy. The aim of our Lamin A as novel molecular prognostic biomarker for EC study is to identify novel biomarkers with a potential for a more systematic integration in clinical practice for individualized therapy in EC. We focused our attention on the expression of lamin A, a nuclear protein involved in cell differentiation and cancer development. The expression of lamin A is often reduced or absent in cells that are highly proliferative, including various human malignancies such as colon cancer, cervical cancer, lung cancer, prostate cancer, gastric cancer, ovarian cancer and leukemia and lymphoma(13,18). Assessment of lamin A protein and mRNA levels in our cohort of FFPE tissues displayed a large and significant decrease of its expression compared with benign samples. Moreover, we observed a significant correlation between lamin A loss and advanced stage disease and a correlation with increased myomerial infiltration. It is worth to note that we observed a significant reduction of LMNA mRNA levels in G1 compared with higher grades, whereas no differences in its expression levels were detectable between G2 and G3 EECs, thus suggesting that alteration of LMNA expression maybe an early event in EC. The identification of patients with poor prognosis among the presumed low-risk endometrioid G1 and G2 cases represents a particular therapeutic challenge. Subgroup analyses of prognostic factors among patients with endometrioid histology have confirmed a prognostic value of ERs expression in curettage specimens in retrospective studies(6-8). In fact, patients with ERs negative EEC are more often diagnosed with higher grade and advanced stage disease (7). Thus, we clustered mRNA L. Cicchillitti et al. expression of LMNA and ERs. Our data indicated a significant association between low LMNA expression and lack of ERs in G1 and G2 EECs, suggesting that lamin A may represent a novel prognostic biomarker in low grade EC. Alterations in E-cadherin expression have been linked to decreased cell–cell adhesion, metastatic potential, tumor dedifferentiation, and deep myometrial invasion in endometrial and other carcinomas. The hallmarks of EMT in cancer cells include changed cell morphology and increased metastatic capabilities in cell migration and invasion(35). A recent meta-analysis indicated that EC patients with reduced expression of E-cadherin may have a poorer prognosis than those with normal or higher expression of E-cadherin in high grade ECs(36) and that down-regulation of E-cadherin plays a major role in EMT and associates with myometrial invasion, histologic grade and metastasis(37,38). In this study, we observed that a significant decrease of CDH1 mRNA was associated with LMNA loss in G3 tumors, suggesting the possible involvement of altered LMNA expression in EMT in high grade EEC. Our data strongly indicate lamin A as a novel putative biomarker in EC. We hypothesizes that lamin A down-modulation in association with ERs status or CDH1 levels in low grade or high grade tumors, respectively, may represents a predictive marker of aggressiveness in EECs. Our findings also support the concept that divergent molecular pathways are involved in different histological grade of ECs. 63 It. J. Gynaecol. Obstet. 2016, 28: N.2 REFERENCES 64 1) Amant F, Moerman P, Neven P, Timmerman D, Van Limbergen E, Vergote I. Endometrial cancer. Lancet 2005; 388 (9484): 491-505. 2) Salvesen HB, Carter SL, Mannelqvist M, et al. Integrated genomic profiling of endometrial carcinoma associates aggressive tumors with indicators of PI3 kinase activation. Proc Natl Acad Sci USA 2009; 106: 4834–39. Dedes KJ, Wetterskog D, Ashworth A, Kaye SB, Reis-Filho JS. Emerging therapeutic targets in endometrial cancer. Nat Rev Clin Oncol 2011; 8: 261–71). 3) Utsunomiya H, Suzuki T, Harada N, Ito K, Matsuzaki S, Konno R, et al. Analysis of estrogen receptor alpha and beta in endometrial carcinomas: correlation with ER beta and clinicopathologic findings in 45 cases. IntJ Gynecol Pathol . 2000; 4: 335-41. 4) Weihua Z, Saji S, Makinen S, Cheng G, Jensen EV, Warner M, et al. Estrogen receptor (ER) beta, a modulator of ERalpha in the uterus. Proc Natl Acad Sci USA. 2000; 11: 5936-41. 5) Thomas C, Gustafsson JA. The different roles of ER subtypes in cancer biology and therapy. Nat Rev Cancer, 2011; (8) 597-608. 6) Zhang Y, Zhao D, Gong C, Zhang F, He J, Zhang W, Z et al. Prognostic role of hormone receptors in endometrial cancer: a systematic review and metaanalysis. World J Surg Oncol. 2015;13:208. 7) Backes FJ, Walker CJ, Goodfellow PJ, Hade EM, Agarwal G, Mutch D, et al. Estrogen receptor-alpha as a predictive biomarker in endometrioid endometrial cancer. Gynecol Oncol. 2016;141(2):312-7. 8) Dong Y, Si JW, Li WT, Liang L, Zhao J, Zhou M, et al. miR-200a/miR-141 and miR-205 upregulation might be associated with hormone receptor status and prognosis in endometrial carcinomas. Int J Clin Exp Pathol. 2015 Mar 1;8(3):2864-75. 9) Zhou XM1, Zhang H, Han X . Role of epithelial to mesenchymal transition proteins in gynecological cancers: pathological and therapeutic perspectives. Tumour Biol. 2014 Oct;35(10):9523-30. 10) Tanaka Y, Terai Y, Kawaguchi H, Fujiwara S, Yoo S, Tsunetoh S, et al. Prognostic impact of EMT (epithelial-mesenchymal-transition)-related protein expression in endometrial cancer. Cancer Biol Ther. 2013 Jan;14(1):13-9. 11) Abouhashem NS, Ibrahim DA, Mohamed AM. Prognostic implications of epithelial to mesenchymal transition related proteins (E-cadherin, Snail) and hypoxia inducible factor 1α in endometrioid endometrial carcinoma. Ann Diagn Pathol. 2016 Jun;22:1-11. 12) Wei-Ning Yang, Zhi-Hong Ai, Juan Wang, YanLi Xu, Yin-Cheng Teng. Correlation between the overexpression of epidermal growth factor receptor and mesenchymal makers in endometrial carcinoma. J Gynecol Oncol. 2014 Jan;25(1):36-42. 13) Foster CR, Przyborski SA, Wilson RG, et al. Lamins as cancer biomarkers J Biochem Soc Trans. 2010;38(Pt 1):297–300. 14) Prokocimer M, Davidovich M, Nissim-Rafinia M, Wiesel-Motiuk N, Bar DZ, Barkan R, et al Nuclear Lamin A as novel molecular prognostic biomarker for EC lamins- key regulators of nuclear structure and activities, J Cell Mol Med. 2009; 13: 1059–85. 15) Capo-chichi CD, Cai KQ, Simpkins F, Ganjei-Azar P, Godwin AK, Xu XX. Nuclear envelope structural defects cause chromosomal numerical instability and aneuploidy in ovarian cancer. BMC Med. 2011; 9-28. 16) Capo-chichi CD, Cai KQ, Smedberg J, Ganjei-Azar P, Godwin AK, Xu XX. Loss of A-type lamin expression compromises nuclear envelope integrity in breast cancer. Chin J Cancer. 2011; 30: 415–25. 17) Belt EJ, Fijneman RJ, van den Berg EG, Bril H, Delisvan Diemen PM, Tijssen M, et al. Loss of LMNA/C expression in stage II and III colon cancer is associated with disease recurrence. Eur J Cancer 2011; 47: 1837–45. 18) Wu Z, Wu L, Weng D, Xu D, Geng J, Zhao F. Reduced expression of LMNA/C correlates with poor histological differentiation and prognosis in primary gastric carcinoma. J Exp Clin Cancer Res. 2009; 28-8. 19) Dechat T, Pfleghaar K, Sengupta K, Shimi T, Shumaker DK, Solimando L, et al. Nuclear lamins: major factors in the structural organization and function of the nucleus and chromatin. Genes Dev. 2008 Apr 1;22(7):832-53. 20) Maraldi NM , Capanni C , Del Coco R , Squarzoni S, Columbaro M, Mattioli E , et al. Muscular laminopathies- role of preLMNA in early steps of muscle differentiation. Adv Enzyme Regul. 2011;51:246-56. 21) Camozzi D, Capanni C, Cenni V, Mattioli E, Columbaro M, Squarzoni S, et al. Diverse lamindependent mechanisms interact to control chromatin dynamics. Focus on laminopathies. Nucleus. 2014; 5: 427-40. 22) Mattioli E, Columbaro M, Capanni C, Maraldi NM, Cenni V, Scotlandi K, et al. PreLMNA-mediated recruitment of SUN1 to the nuclear envelope directs nuclear positioning in human muscle. Cell Death Differ. 2011;18:1305-15. 23) Worman HJ, Schirmer EC. Nuclear membrane diversity- underlying tissue-specific pathologies in disease? Curr Opin Cell Biol. 2015; 34: 101-12. 24) Barrowman J, Hamblet C, George CM, Michaelis S. Mol Biol Cell. Analysis of prelamin A biogenesis reveals the nucleus to be a CaaX processing compartment. Mol Biol Cell. 2008 Dec;19(12):5398-408. 25) Schlosshauer PW, Ellenson LH, Soslow RA. Catenin and E-Cadherin Expression Patterns in High-Grade Endometrial Carcinoma Are Associated with Histological Subtype. Mod Pathol 2002;15(10):1032–1037. 26) Fujimoto J, Ichigo S, Hirose R, Sakaguchi H, Tamaya T. Suppression of E-cadherin and alphaand beta-catenin mRNA expression in the metastatic lesions of gynecological cancers. Eur J Gynaecol Oncol 1997; 18: 484–487. 27) Sakuragi N, Nishiya M, Ikeda K, Ohkouch T, Furth EE, Hareyama H, et al. Decreased E-cadherin expression in endometrial carcinoma is associated with tumor dedifferentiation and deep myometrial invasion. Gynecol Oncol 1994; 53: 183–189. Lamin A as novel molecular prognostic biomarker for EC 28) Zhang Y, Zhao D, Gong C, Zhang F, He J, Zhang W, et al. Prognostic role of hormone receptors in endometrial cancer: a systematic review and metaanalysis. World J Surg Oncol. 2015 Jun 25;13:208. 29) Wik E, Ræder MB, Krakstad C, Trovik J, Birkeland E, Hoivik EA, et al. Lack of estrogen receptor-α is associated with epithelial-mesenchymal transition and PI3K alterations in endometrial carcinoma. Clin Cancer Res. 2013;19(5):1094-105.. 30) N-cadherin protein, encoded by the CDH2 gene, promotes tumor cell survival, migration and invasion, and a high level of its expression is often associated with poor prognosis. Gynecol Oncol. 2014 Jan; 25(1): 36–42. 31) Rose PG. Endometrial carcinoma. N Engl J Med. 1996; 9: 640-49. 32) Creasman WT. Prognostic significance of hormone receptors in endometrial cancer. Cancer 4 (Suppl) 1993; 1467-70. 33) Morrow CP, Bundy BN, Kurman RJ, Creasman WT, Heller P, Homesley HD, et al. Relationship between L. Cicchillitti et al. surgicalpathological risk factors and outcome in clinical stage I and II carcinoma of the endometrium: a Gynecologic Oncology Group study. Gynecol Oncol 1991; 55-65. 34) Prat J. Prognostic parameters of endometrial carcinoma. Hum Pathol. 2004;6: 649-62.). 35) Kalluri, R.; Weinberg, R.A. The basics of epithelialmesenchymal transition. J. Clin. Invest. 2009, 119, 1420–28. 36) Zheng X, Du XL, Jiang T. Prognostic significance of reduced immunohistochemical expression of E-cadherin in endometrial cancer-results of a metaanalysis. Int J Clin Exp Med. 2015 Oct 15;8(10):18689-96. 37) Mirantes C, Espinosa I, Ferrer I, Dolcet X, Prat J, Matias-Guiu X. Epithelial-to-mesenchymal transition and stem cells in endometrial cancer. Human Pathology, vol. 44, no. 10, pp. 1973–1981, 2013. 38) Montserrat N, Mozos A, Llobet D, Dolcet X, Pons C, de Herreros AG, et al to mesenchymal transition in early stage endometrioid endometrial carcinoma. Human Pathology, vol. 43, no. 5, pp. 632–643, 2012. 65 Riassunto delle Caratteristiche del Prodotto 1. DENOMINAZIONE DEL MEDICINALE: MECLON ® “20% + 4% crema vaginale” MECLON® “200 mg/10 ml + 1 g/130 ml soluzione vaginale”. 2. COMPOSIZIONE QUALITATIVA E QUANTITATIVA: Crema vaginale. 100 g contengono: Principi attivi: Metronidazolo 20 g; Clotrimazolo 4 g. Eccipienti: contiene sodio metil p-idrossibenzoato e sodio propil p-idrossibenzoato. Per l’elenco completo degli eccipienti, vedere paragrafo 6.1. Soluzione vaginale. Flacone da 10 ml. 10 ml contengono: Principio attivo: Clotrimazolo 200 mg. Flacone da 130 ml. 130 ml contengono: Principio attivo: Metronidazolo 1 g. Eccipienti: contiene sodio metil p-idrossibenzoato e sodio propil p-idrossibenzoato. Per l’elenco completo degli eccipienti, vedere paragrafo 6.1. 3. FORMA FARMACEUTICA: Crema vaginale. Soluzione vaginale. 4. INFORMAZIONI CLINICHE: 4.1 Indicazioni terapeutiche: Crema vaginale. Cervico-vaginiti e vulvo-vaginiti causate da Trichomonas vaginalis anche se associato a Candida albicans, Gardnerella vaginalis ed altra flora batterica sensibile. MECLON® crema vaginale può essere impiegato anche nel partner a scopo profilattico. Soluzione vaginale. Coadiuvante nella terapia di cervico-vaginiti, vulvo-vaginiti causate da Trichomonas vaginalis anche se associato a Candida albicans, Gardnerella vaginalis ed altra flora batterica sensibile. MECLON® soluzione vaginale può essere impiegato anche dopo altra terapia topica od orale, allo scopo di ridurre il rischio di recidive. 4.2 Posologia e modo di somministrazione: Crema vaginale. Somministrare profondamente in vagina il contenuto di un applicatore una volta al giorno per almeno sei giorni consecutivi, preferibilmente alla sera prima di coricarsi, oppure secondo prescrizione medica. Nelle trichomoniasi, maggior sicurezza di risultato terapeutico si verifica con il contemporaneo uso di Metronidazolo per via orale sia nella donna non gestante che nel partner maschile. Per un’ottimale somministrazione si consiglia una posizione supina, con le gambe leggermente piegate ad angolo. Per ottenere una migliore sterilizzazione è preferibile spalmare un po’ di MECLON® crema vaginale anche esternamente, a livello perivulvare e perianale. Se il medico prescrive il trattamento del partner a scopo profilattico, la crema deve essere applicata sul glande e sul prepuzio per almeno sei giorni. Istruzioni per l’uso: Dopo aver riempito di crema un applicatore, somministrare la crema in vagina mediante pressione sul pistone, fino a completo svuotamento. Soluzione vaginale. Somministrare la soluzione vaginale pronta una volta al giorno, preferibilmente al mattino, oppure secondo prescrizione medica. Nella fase di attacco l’uso della soluzione vaginale deve essere associato ad adeguata terapia topica e/o orale. L’irrigazione va eseguita preferibilmente in posizione supina. Un lento svuotamento del flacone favorirà una più prolungata permanenza in vagina dei principi attivi e quindi una più efficace azione antimicrobica e detergente. Istruzioni per l’uso: Dopo aver versato il contenuto del flaconcino nel flacone, inserire la cannula vaginale sul collo del flacone stesso. Introdurre la cannula in vagina e somministrare l’intero contenuto. 4.3 Controindicazioni: Ipersensibilità verso i principi attivi od uno qualsiasi degli eccipienti. 4.4 Avvertenze speciali e opportune precauzioni d’impiego: Evitare il contatto con gli occhi. Il consigliato impiego contemporaneo di Metronidazolo per via orale è soggetto alle controindicazioni, effetti collaterali ed avvertenze descritte per il prodotto summenzionato. Evitare il trattamento durante il periodo mestruale. Tenere il medicinale fuori dalla portata e dalla vista dei bambini. 4.5 Interazioni con altri medicinali e altre forme di interazione: Nessuna. 4.6 Gravidanza e allattamento: In gravidanza il prodotto deve essere impiegato solo in caso di effettiva necessità e sotto il diretto controllo del medico. 4.7 Effetti sulla capacità di guidare veicoli e sull’uso di macchinari: MECLON ® non altera la capacità di guidare veicoli o di usare macchinari. 4.8 Effetti indesiderati: Dato lo scarso assorbimento per applicazione locale dei principi attivi Metronidazolo e Clotrimazolo, le reazioni avverse riscontrate con le formulazioni topiche sono limitate a: Disturbi del sistema immunitario: Non nota (la frequenza non può essere definita sulla base dei dati disponibili): reazioni di ipersensibilità. Patologie della cute e del tessuto sottocutaneo: Molto rari (frequenza <1/10.000): fenomeni irritativi locali quale prurito, dermatite allergica da contatto, eruzioni cutanee. L’eventuale manifestarsi di effetti indesiderati comporta l’interruzione del trattamento. 4.9 Sovradosaggio: Non sono stati descritti sintomi di sovradosaggio. 5. PROPRIETÀ FARMACOLOGICHE: 5.1 Proprietà farmacodinamiche: Categoria farmacoterapeutica: Antinfettivi ed antisettici ginecologici/Associazioni di derivati imidazolici - Codice ATC: G01AF20. Meccanismo d’azione/ effetti farmacodinamici: Il MECLON ® è una associazione tra Metronidazolo (M) e Clotrimazolo (C). Il (M) è un derivato nitroimidazolico ad ampio spettro di azione antiprotozoaria e antimicrobica. Ha effetto trichomonicida diretto ed è attivo su cocchi Gram-positivi anaerobi, bacilli sporigeni, anaerobi Gram-negativi. Presenta attività spiccata sulla Gardnerella vaginalis. Non è attivo sulla flora acidofila vaginale. Il (C) è un imidazolico con spettro antifungino molto ampio (Candida, etc.). È attivo anche su Trichomonas vaginalis, cocchi Gram-positivi, Toxoplasmi, etc. È stato documentato che l’associazione Clotrimazolo-Metronidazolo dà luogo ad effetti di tipo additivo, pertanto essa è in grado di conseguire tre vantaggi terapeutici principali: 1) Ampliamento dello spettro d’azione antimicrobica, per sommazione degli effetti dei due principi attivi; 2) Potenziamento dell’attività antimicotica, antiprotozoaria ed antibatterica; 3) Abolizione o ritardo della comparsa dei fenomeni di resistenza. Studi microbiologici in vitro hanno dimostrato che l’attività trichomonicida e antimicotica risulta potenziata quando il (M) e il (C) sono associati nelle stesse proporzioni che sono presenti nel MECLON®. Anche l’attività antibatterica esaminata su diversi ceppi di microorganismi è risultata elevata ed è emerso un potenziamento di essa quando i due principi attivi del MECLON® vengono associati. 5.2 Proprietà farmacocinetiche: Dalle indagini farmacocinetiche sui conigli, cani e ratti risulta che dopo ripetute applicazioni topiche di MECLON® non si rilevano concentrazioni apprezzabili di Clotrimazolo e Metronidazolo nel sangue. Per applicazione vaginale nella donna il (M) e il (C) vengono assorbiti in una percentuale che varia tra il 10% e il 20% circa. 5.3 Dati preclinici di sicurezza: La tossicità acuta del MECLON® nel topo e nel ratto (os) è risultata molto bassa, con una mortalità di appena il 20% dopo 7 giorni, a dosi molto elevate (600 mg/Kg di (C) e 3000 mg/Kg di (M), sia da soli che associati). Nelle prove di tossicità subacuta (30 giorni) il MECLON®, somministrato per via locale (genitale) nel cane e nel coniglio, non ha determinato alcun tipo di lesione nè locale nè sistemica anche per dosi molte volte superiori a quelle comunemente impiegate in terapia umana (3-10 Dtd nel cane e 100-200 Dtd nel coniglio; 1 Dtd = dose terapeutica/die per l’uomo = ca. 3,33 mg/Kg di (C) e ca. 16,66 mg/Kg di (M)). Il MECLON® somministrato durante il periodo di gravidanza per via topica vaginale nel coniglio e nel ratto non ha fatto evidenziare alcun segno di sofferenza fetale per dosi die di 100 Dtd, nè influssi negativi sullo stato gestazionale. 6. INFORMAZIONI FARMACEUTICHE: 6.1 Elenco degli eccipienti: Crema vaginale. Eccipienti: Stearato di glicole e polietilenglicole; Paraffina liquida; Sodio metile p-idrossibenzoato; Sodio propile p-idrossibenzoato; Acqua depurata. Soluzione vaginale. Flacone da 10 ml. Eccipienti: Alcool ricinoleilico; Etanolo; Acqua depurata. Flacone da 130 ml. Eccipienti: Sodio metile p-idrossibenzoato; Sodio propile p-idrossibenzoato; Acqua depurata. 6.2 Incompatibilità: Non sono note incompatibilità con altri farmaci. 6.3 Periodo di validità: Crema vaginale: 3 anni. Soluzione vaginale: 3 anni. 6.4 Precauzioni particolari per la conservazione: Questo medicinale non richiede alcuna particolare condizione per la conservazione. 6.5 Natura e contenuto del contenitore: MECLON® crema vaginale. Tubo in alluminio verniciato internamente con resine epossidiche e fenoliche. Gli applicatori monouso sono di polietilene. Tubo da 30 g + 6 applicatori monouso. MECLON® soluzione vaginale. Flaconi di polietilene a bassa densità; flaconcini di polietilene; cannule vaginali di polietilene. 5 flaconi da 10 ml + 5 flaconi da 130 ml + 5 cannule vaginali monouso. 6.6 Precauzioni particolari per lo smaltimento e la manipolazione: Nessuna istruzione particolare. 7. TITOLARE DELL’AUTORIZZAZIONE ALL’IMMISSIONE IN COMMERCIO: ALFA WASSERMANN S.p.A. - Sede legale: Via E. Fermi, n. 1 - Alanno (PE). Sede amministrativa: Via Ragazzi del ‘99, n. 5 - Bologna. 8. NUMERI DELL’AUTORIZZAZIONE ALL’IMMISSIONE IN COMMERCIO: MECLON® crema vaginale: A.I.C. n. 023703046. MECLON® soluzione vaginale: A.I.C. n. 023703059. 9. DATA DELLA PRIMA AUTORIZZAZIONE/RINNOVO DELL’AUTORIZZAZIONE: 11.05.1991 (GU 07.10.1991) / 01.06.2010. 10. DATA DI REVISIONE DEL TESTO: Determinazione AIFA del 27 Ottobre 2010. 20% + 4% crema vaginale, tubo da 30 g + 6 applicatori. Prezzo: € 12,50. 200 mg/10 ml + 1 g/130 ml soluzione vaginale, 5 flac. 10 ml + 5 flac. 130 ml + 5 cannule. Prezzo: € 13,80. Medicinale non soggetto a prescrizione medica (SOP). CLASSE C. 1. DENOMINAZIONE DEL MEDICINALE: MECLON® “100 mg + 500 mg ovuli”. 2. COMPOSIZIONE QUALITATIVA E QUANTITATIVA: Un ovulo da 2,4 g contiene: Principi attivi: Metronidazolo 500 mg; Clotrimazolo 100 mg. Per l’elenco completo degli eccipienti, vedere paragrafo 6.1. 3. FORMA FARMACEUTICA: Ovuli. 4. INFORMAZIONI CLINICHE: 4.1 Indicazioni terapeutiche: Cerviciti, cervico-vaginiti, vaginiti e vulvo-vaginiti da Trichomonas vaginalis anche se associato a Candida o con componente batterica. 4.2 Posologia e modo di somministrazione: Lo schema terapeutico ottimale risulta il seguente: 1 ovulo di MECLON® in vagina, 1 volta al dì. 4.3 Controindicazioni: Ipersensibilità verso i principi attivi od uno qualsiasi degli eccipienti. 4.4 Avvertenze speciali e opportune precauzioni d’impiego: Evitare il contatto con gli occhi. Il consigliato impiego contemporaneo di Metronidazolo per via orale è soggetto alle controindicazioni, effetti collaterali ed avvertenze descritte per il prodotto summenzionato. MECLON® ovuli va impiegato nella prima infanzia sotto il diretto controllo del medico e solo nei casi di effettiva necessità. Tenere il medicinale fuori dalla portata e dalla vista dei bambini. 4.5 Interazioni con altri medicinali e altre forme di interazione: Nessuna. 4.6 Gravidanza e allattamento: In gravidanza il prodotto deve essere impiegato solo in caso di effettiva necessità e sotto il diretto controllo del medico. 4.7 Effetti sulla capacità di guidare veicoli e sull’uso di macchinari: MECLON® non altera la capacità di guidare veicoli o di usare macchinari. 4.8 Effetti indesiderati: Dato lo scarso assorbimento per applicazione locale dei principi attivi Metronidazolo e Clotrimazolo, le reazioni avverse riscontrate con le formulazioni topiche sono limitate a: Disturbi del sistema immunitario: Non nota (la frequenza non può essere definita sulla base dei dati disponibili): reazioni di ipersensibilità. Patologie della cute e del tessuto sottocutaneo: Molto rari (frequenza <1/10.000): fenomeni irritativi locali quale prurito, dermatite allergica da contatto, eruzioni cutanee. L’eventuale manifestarsi di effetti indesiderati comporta l’interruzione del trattamento. 4.9 Sovradosaggio: Non sono stati descritti sintomi di sovradosaggio. 5. PROPRIETÀ FARMACOLOGICHE: 5.1 Proprietà farmacodinamiche: Categoria farmacoterapeutica: Antinfettivi ed antisettici ginecologici/Associazioni di derivati imidazolici - Codice ATC: G01AF20. Meccanismo d’azione/effetti farmacodinamici: Il MECLON® è una associazione tra metronidazolo (M) e clotrimazolo (C). Il (M) è un derivato nitroimidazolico ad ampio spettro di azione antiprotozoaria e antimicrobica. Ha effetto trichomonicida diretto ed è attivo su cocchi Gram-positivi anaerobi, bacilli sporigeni, anaerobi Gram-negativi. Presenta attività spiccata sulla Gardnerella vaginalis. Non è attivo sulla flora acidofila vaginale. Il (C) è un imidazolico con spettro antifungino molto ampio (Candida, etc.). È attivo anche su Trichomonas vaginalis, cocchi Grampositivi, Toxoplasmi, etc. È stato documentato che l’associazione ClotrimazoloMetronidazolo dà luogo ad effetti di tipo additivo, pertanto essa è in grado di conseguire tre vantaggi terapeutici principali: 1) Ampliamento dello spettro d’azione antimicrobica, per sommazione degli effetti dei due principi attivi; 2) Potenziamento dell’attività antimi- cotica, antiprotozoaria ed antibatterica; 3) Abolizione o ritardo della comparsa dei fenomeni di resistenza. Studi microbiologici in vitro hanno dimostrato che l’attività trichomonicida e antimicotica risulta potenziata quando il (M) e il (C) sono associati nelle stesse proporzioni che sono presenti nel MECLON®. Anche l’attività antibatterica esaminata su diversi ceppi di microorganismi è risultata elevata ed è emerso un potenziamento di essa quando i due principi attivi del MECLON® vengono associati. 5.2 Proprietà farmacocinetiche: Dalle indagini farmacocinetiche sui conigli, cani e ratti risulta che dopo ripetute applicazioni topiche di MECLON® non si rilevano concentrazioni apprezzabili di Clotrimazolo e Metronidazolo nel sangue. Per applicazione vaginale nella donna il (M) e il (C) vengono assorbiti in una percentuale che varia tra il 10% e il 20% circa. 5.3 Dati preclinici di sicurezza: La tossicità acuta del MECLON® nel topo e nel ratto (os) è risultata molto bassa, con una mortalità di appena il 20% dopo 7 giorni, a dosi molto elevate (600 mg/Kg di (C) e 3000 mg/Kg di (M), sia da soli che associati). Nelle prove di tossicità subacuta (30 giorni) il MECLON®, somministrato per via locale (genitale) nel cane e nel coniglio, non ha determinato alcun tipo di lesione nè locale nè sistemica anche per dosi molte volte superiori a quelle comunemente impiegate in terapia umana (3-10 Dtd nel cane e 100-200 Dtd nel coniglio; 1 Dtd = dose terapeutica/die per l’uomo = ca. 3,33 mg/Kg di (C) e ca. 16,66 mg/Kg di (M)). Il MECLON® somministrato durante il periodo di gravidanza per via topica vaginale nel coniglio e nel ratto non ha fatto evidenziare alcun segno di sofferenza fetale per dosi die di 100 Dtd, nè influssi negativi sullo stato gestazionale. 6. INFORMAZIONI FARMACEUTICHE: 6.1 Elenco degli eccipienti: Eccipienti: Miscela idrofila di mono, di, tri-gliceridi di acidi grassi saturi. 6.2 Incompatibilità: Non sono note incompatibilità con altri farmaci. 6.3 Periodo di validità: 3 anni. 6.4 Precauzioni particolari per la conservazione: Questo medicinale non richiede alcuna particolare condizione per la conservazione. 6.5 Natura e contenuto del contenitore: 10 ovuli in valve in PVC, racchiusi in scatola di cartone. 6.6 Precauzioni particolari per lo smaltimento e la manipolazione: Nessuna istruzione particolare. 7. TITOLARE DELL’AUTORIZZAZIONE ALL’IMMISSIONE IN COMMERCIO: ALFA WASSERMANN S.p.A. - Sede legale: Via E. Fermi, n. 1 - Alanno (PE). Sede amministrativa: Via Ragazzi del ‘99, n. 5 - Bologna. 8. NUMERO DELL’AUTORIZZAZIONE ALL’IMMISSIONE IN COMMERCIO: A.I.C. n. 023703010. 9. DATA DELLA PRIMA AUTORIZZAZIONE/ RINNOVO DELL’AUTORIZZAZIONE: 27.11.1978 (GU 16.01.1979) / 01.06.2010. 10. DATA DI REVISIONE DEL TESTO: Determinazione AIFA del 27 Ottobre 2010. 100 mg + 500 mg ovuli, 10 ovuli. Prezzo: € 12,50. Medicinale non soggetto a prescrizione medica (SOP). CLASSE C.