atti femesprum 2003 - Università di Bologna

Commenti

Transcript

atti femesprum 2003 - Università di Bologna
�������������
�� ����������
���������������
����� �������������
�������������
�������
� �����������
���������
�
Volume Atti
Olbia Italy
22°25
maggio 2003
pagina bianca lasciata intenzionalmente
XI Congresso
XIV Congresso
Internazionale
della Federazione
Mediterranea
Sanità
edella
Produzione
Ruminanti
Internazionale
Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
Hotel Luna Lughente
Olbia (Sassari)
22 °25
maggio 2003
VOLUME ATTI
XI Congresso
Internazionale
della Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
COMITATO SCIENTIFICO
Prof. Sergio Coda
Prof. Angelo Mario Cosseddu
Dott. Salvatore De Palmas
Prof. Basilio Floris
Prof. Arcangelo Gentile
Prof. Walter Pinna
Prof. Giampaolo Pintori
Prof.Antonio Pugliese
COMITATO ESECUTIVO DIRETTIVO ATTUALE
Presidente:
Prof. Antonio Pugliese, Università Messina
Vice Presidente:
Prof. Bogo Fatur, Università Lubiana
Segretario Tesoriere:
Prof. Arcangelo Gentile, Università Bologna
Consiglieri:
Prof. Giovanni Cubeddu, Università Sassari
Prof. Massimo Morgante, Università Padova
COMITATO ORGANIZZATORE
Presidente:
Prof. Giovanni Cubeddu
Vice Presidente:
Prof. Giuseppe Moniello
Vice Presidente:
Dott. Andrea Sarria
Tesoriere:
Prof. Antonio Scala
Segretario:
Prof. Remo Basilio Floris
RELAZIONI
22 - 23 MAGGIO 2003
Lezione Magistrale
Scala Antonio, Poglayen Giovanni, Giannetto Salvatore
L’ECHINOCOCCOSI-IDATIDOSI: TASSONOMIA, MORFOBIOLOGIA E NOTE
EPIDEMIOLOGICHE E DI CONTROLLO APPLICATE IN SARDEGNA (ITALIA).
Prof. Carlo Valente (Perugia, Italia)
“INFEZIONI DA ROTAVIRUS E DA E.COLI NEI PICCOLI RUMINANTI”
Prof. Pablo Díez-Baños (Lugo, Spagna)
“LA CRIPTOSPORIDIOSI DEI PICCOLI RUMINANTI: IMPORTANZA
E METODI DI CONTROLLO”
Prof. Maurizio Severini (Perugia, Italia)
“IL RUOLO DEL VETERINARIO ISPETTORE NEL SISTEMA DI GARANZIE PER LA
SICUREZZA DELLE CARNI”
XI Congresso
Internazionale
della Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
5
LETTURA MAGISTRALE
L’ECHINOCOCCOSI-IDATIDOSI: TASSONOMIA, MORFOBIOLOGIA E NOTE
EPIDEMIOLOGICHE E DI CONTROLLO APPLICATE IN SARDEGNA (ITALIA).
Scala Antonio, Poglayen Giovanni*, Giannetto Salvatore*
Dipartimento di Biologia Animale, Facoltà di Medicina Veterinaria, Sassari (Italy); *Dipartimento di Sanità Pubblica
Veterinaria, Facoltà di Medicina Veterinaria, Messina (Italy).
Riassunto
La lettura magistrale, condotta a tre voci, prende dapprima in considerazione gli aspetti relativi agli aggiornamenti
tassonomici del genere Echinococcus e successivamente, attraverso un’accurata documentazione ottenuta al microscopio
ottico e a scansione, esamina gli aspetti morfologici di Echinococcus spp. e delle relative forme larvali (metacestodi) ritenuti
più interessanti ai fini della comprensione della fisiologia del parassita e del suo potere patogeno. Verranno inoltre riferiti
particolari sulla struttura e sulla resistenza delle uova ed analizzate le cause della persistenza dell’Echinococcosi-Idatidosi.
In particolare verrà presa in esame la situazione del “caso” Sardegna (Italia), attraverso una disamina dell’evoluzione storica
dei principali parametri epidemiologici dell’infestione nelle varie specie domestiche e nell’uomo e delle misure di controllo
intraprese nell’isola per cercare di controllare questa importante zoonosi.
Introduzione
L’Echinococosi è una malattia parassitaria causata da Cestodi del genere Echinococcus che vivono, allo stadio adulto,
nell’intestino di carnivori domestici e selvatici. Le forme larvali albergano invece in vari organi (fegato, polmone, cuore,
milza, cervello) di numerosi mammiferi, uomo compreso, determinando l’Echinococcosi cistica (EC), detta anche
Idatidosi.
L’EC è attualmente, tra le zoonosi parassitarie, quella che continua a richiamare sempre più l’attenzione dei sanitari di
molti Paesi a causa del grande significato sociale ed economico che la stessa assume. Spesso l’aggettivo di “emergente” o
“riemergente” definisce situazioni epidemiologiche relative a questa malattia.
Essa da sempre è considerata una delle più importanti parassitosi di spiccato interesse zoonosico anche da importanti
organismi internazionali e continua ad imperversare soprattutto nelle regioni in cui il binomio ovino-cane è ancora ben
rappresentato.
E’infatti oramai ampiamente assodato che seppure la parassitosi possa coinvolgere varie specie animali, uomo compreso,
sia soprattutto la stretta convivenza tra cane e ovino il fattore più importante per la persistenza della parassitosi in varie
regioni del mondo.
Tutto questo si perpetua ormai da tempi immemorabili, nonostante nei suoi confronti si siano spesso concentrati gli sforzi
di varie categorie (veterinari, medici, amministratori) per cercare di arginare una parassitosi che determina importanti
ripercussioni negative di vario tipo. Tuttavia, differenti cause, sociali, economiche nonchè politiche, spesso ne hanno reso
il suo controllo o l’eradicazione un traguardo non sempre raggiungibile.
TASSONOMIA
Dopo il crescente proliferare di specie (16) e sottospecie (13) ascrivibili al genere Echinococcus, negli anni 80 viene rivisitata
radicalmente la classificazione del taxon, e sulla base di criteri di valore diagnostico quali la morfologia, sviluppo dei
metacestodi, infestazione sperimentale, osservazioni epidemiologiche, relazione ospite-parassita e tecniche di biologia
molecolare, vengono riconosciute valide solo quattro specie: Echinococcus granulosus, E. multilocularis, E. oligarthrus e
E. vogeli. Più recentemente, Thompson e Lymbery (1995), avvalendosi soprattutto dell’efficacia diagnostica della PCR,
aggiungono altre due specie, E. ortleppi ed E. equinus. Nell’ambito di una stessa specie, inoltre, gli stessi Autori, individuano
un numero di 9 “ceppi” o “varietà” per E. granulosus e 3 per E. multilocularis. L’argomento è in costante evoluzione,
probabilmente non solo a livello di approfondimento biotecnologico, ma anche squisitamente biologico, con affermazione
/ scoperta di nuovi ceppi come recentemente accaduto in Fennoscandia dove è stato segnalato il decimo (G 10) di E.
granulosus con ciclo renna/lupo (Oksanen e Lavikainen, 2004). Il concetto stesso di “ceppo” necessita di chiarimenti che ne
semplifichino la comprensione, secondo Eckert et al. (2001) si tratta di - “gruppi di individui che differiscono statisticamente
da gruppi della stessa specie per frequenze geniche e per uno o più caratteri di potenziale significato nella epidemiologia
e nel controllo della malattia”- più semplicemente si tratta di varianti intraspecifiche caratterizzate da differenze genetiche
e da uno o più caratteri a valenza epidemiologica. Ad esempio, il ceppo bovino (G 5) si distingue anche per maggiori
dimensioni del parassita adulto (3,5 mm) e per una prepatenza nell’ospite definitivo di soli 35 giorni, mentre il ceppo
equino, non per tutti assurto al rango di specie (G 4), è caratterizzato da scarsa o nulla infettività per l’uomo. Degna di
nota la segnalazione di questo ultimo ceppo in Sicilia ad opera di Macchioni e Gallo nel 1967. La capacità di Echinococcus
ad evolversi e specializzarsi attraverso la formazione di ceppi è legata alla sua caratteristica di moltiplicarsi prevalentemente
in forma asessuata (autofecondazione + gemmazione a livello cistico). Se un gene recessivo si presenta contemporaneamente
nei due gameti questo può manifestarsi come doppio recessivo (potenzialmente mutante), successivamente la mutazione
viene amplificata nella cisti (che origina da un unico uovo) e stabilizzata nel successivo ospite definitivo. Ancora una
conferma di questa “vivacità biologica” del parassita viene da Salih e Abdullah (2002), che riportano i caratteri fenotipici di
cestodi adulti del genere Echinococcus isolati da cani della provincia di Ninevah in Iraq. Tali caratteri, non comparabili con
quelli delle specie precedentemente segnalate, vengono ascritti dagli stessi autori ad una nuova specie, E. iraqii. La maggiore
variabilità genetica di E. granulosus, oltre ad una sua caratteristica intrinseca, potrebbe anche essere ricondotta alla pressione
selettiva operata dall’uomo con la specializzazione realizzata nell’allevamento dei suoi ospiti.
In Italia, la specie più diffusa è senza dubbio E. granulosus, parassita su cui ci soffermeremo in questa sede rimandando per
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
7
le restanti specie al lavoro di Thompson e McManus (2002).
Mai precedentemente segnalata nel nostro Paese l’Echinococcosi multiloculare da E. multilocularis che i vecchi testi
denominavano anche “Bavaro – Tirolese” a sancirne l’estraneità nazionale, in seguito al massiccio (ed ancora parzialmente
compreso) aumento della biomassa parassitaria nelle regioni di endemia (Francia, Svizzera, Germania, Austria) sembrerebbe
aver fatto la sua comparsa in volpi di limitate aree alpine italiane del Nord Est con prevalenze ed intensità decisamente
ridotte; un fenomeno preoccupante da monitorare ma che sino ad ora non si è tradotto in casi umani (Manfredi et al., in
corso di stampa).
MORFOBIOLOGIA DEL PARASSITA
Il parassita adulto è lungo 2-7 mm ed è provvisto di scolice con quattro ventose distribuite equamente all’equatore e due
corone di uncini che misurano in lunghezza rispettivamente 22-39 e 31-49 micron. Le proglottidi sono solitamente tre e
quella gravida, prodotta ogni dieci giorni, può contenere oltre 1500 uova. I testicoli, in numero di 25-80, sono distribuiti
proporzionalmente prima e dopo il poro genitale, mentre la forma dell’utero è sacciforme con bordo irregolare.
Vive nell’intestino tenue dei canidi nei confronti dei quali manifesta una specie-specificità piuttosto marcata.
In Italia l’ospite definitivo per eccellenza è il cane. La volpe (Vulpes vulpes), è capace di ospitare solo alcuni ceppi di E.
granulosus ma, nel nostro Paese, non consente la piena evoluzione del parassita (Deiana e Arru, 1962). Il lupo (Canis lupus)
appare invece un efficace ospite definitivo essendo E. granulosus il parassita più rappresentato in questa specie in Italia.
La ridotta numerosità del carnivoro selvatico, solo recentemente uscito dal rischio di estinzione, e la dimostrata origine
domestica della sua infestione (assenza di un ciclo silvestre in grado di supportare i livelli di infestazione riscontrati nel
lupo) lo rendono però epidemiologicamente poco importante (Guberti et al., 1998).
Il cane si infesta mediante l’ingestione delle forme larvali (idatidi contenenti protoscolici vitali) presenti nei visceri o nelle
carni dell’ospite intermedio. I protoscolici una volta ingeriti, nell’arco di tempo di 6-92 ore, evaginano interamente e si
impiantano nelle ghiandole di Lieberkuhn tramite il rostello che, a differenza di altri Cestodi, ha una componente di natura
ghiandolare. Durante questo processo particolarmente attivo i protoscolici bruciano le loro riserve di glicogeno e utilizzano
gli ioni provenienti dai corpuscoli calcarei. La formazione delle proglottidi inizia dopo 11 giorni dall’infestazione mentre
i rami laterali dell’utero si evidenziano dopo ulteriori 7 giorni. L’eliminazione delle prime uova inizia dopo un periodo di
prepatenza di 34-58 giorni, mentre la vita media del parassita adulto è stimata tra i 6 e i 22 mesi. L’attività ghiandolare del
rostello provoca il rilascio della proglottide gravida che, liberata all’esterno con le feci, disperderà le sue uova nell’ambiente. I
fattori di dispersione possono essere inanimati come il vento e le precipitazioni, ma anche biologici comprendendo artropodi
(Calliphora spp., Percellio levis, Percus grandicollis), lombrichi, uccelli e mammiferi. La maggior parte permane in un raggio
di 180m, alcune sono state ritrovate a 10 km di distanza, mentre l’area interessata alla polluzione parassitaria raggiunge i
30.000 ettari. Le uova sono indistinguibili da quelle degli altri tenidi ospiti del cane, pertanto si stanno studiando tecniche
alternative alla coprologia come la PCR, la ricerca dei coproantigeni con Elisa o Western Blott. Le biotecnologie dimostrano
però in questo campo di applicazione nel nostro Paese problemi di specificità per interferenza con altri parassiti abituali
del cane (Varcasia e Scala, 2003). Forme di resistenza per eccellenza le uova di E. granulosus sono particolarmente sensibili
all’essiccamento e pertanto influenzate da variabili ambientali recentemente evidenziate anche con sofisticate metodiche di
indagine (Geografic Information System) in ambito nazionale (Poglayen et al., in corso di stampa). Gli estremi di questa
resistenza vanno da + 40° C a – 70°C mentre nell’ambiente pascolo si parla di circa un anno. Altre informazioni relative alle
uova riguardano la loro virtuale resistenza ai disinfettanti e la non devitalizzazione a seguito del trattamento antielmintico
del cane che quindi emette con le feci una enorme quantità di materiale potenzialmente rischioso. Indagini recenti hanno
dimostrato un processo di maturazione – invecchiamento mai precedentemente sospettato; le uova attraverserebbero tre
fasi successive, immature (non infettanti) all’emissione, lo diventerebbero successivamente, per poi andare incontro ad un
periodo di decadimento accompagnato da perdita dell’infettività ma mantenimento dell’attività immunogena per l’ospite
(Thompson e Lymbery, 1995). Si tratta di un processo estremamente interessante sia per i risvolti sulla reale pericolosità
per gli operatori di interventi diretti sul cane o sul parassita adulto, sia per l’immunologia del parassita che sta aprendo la
strada ad interventi vaccinali negli ospiti intermedi.
Le uova infettanti, ingerite dall’ospite intermedio, vanno incontro alla lisi dei blocchi poligonali di simil-cheratina
dell’embrioforo e all’attivazione dell’oncosfera a causa dell’azione di enzimi come la pepsina e la pancreatina. Dopo 30-120
minuti, l’oncosfera abbandona l’intestino e raggiunge, attraverso le vie linfatiche e venose, gli organi bersaglio rappresentati
dal fegato e dal polmone. Non di rado possono essere coinvolti anche i reni, la milza, il tessuto muscolare ed il sistema
nervoso.
Il metacestode maturo di E. granulosus è la cisti idatidea, ripiena di liquido trasparente e rivestita da tre strati che prendono
il nome, procedendo dall’interno verso l’esterno, di strato germinale, acellulare e connettivale. Il primo ha il compito di
generare le cisti nido con all’interno i protoscolici invaginati; lo strato acellulare, detto anche elastico, ha la funzione di
supporto alla tensione intracistica e costituisce una barriera di tipo immunitario ed infine lo strato connettivale prodotto
dalla reazione infiammatoria dell’organo parassitato. La forma è solitamente uniloculare, ma non di rado è possibile
osservare la formazione di cisti figlie che si localizzano all’interno della cisti madre (vescicolizzazione secondaria interna).
Interessante l’osservazione che questo fenomeno di filiazione è strettamente legato a fattori di “sofferenza” della cisti madre
che riceve l’insulto immunitario dell’ospite (Rogan, in corso di stampa).
L’aumento di volume della idatide è molto lento (1-5 cm per anno) e dipende dal ceppo del parassita, dalla specie ospite
e dal grado di infestazione.
EPIDEMIOLOGIA DELL’ECHINOCOCCOSI-IDATIDOSI IN SARDEGNA
In Sardegna la parassitosi, seppure “da sempre” massivamente presente, ancora oggi costituisce un problema sanitario per
il patrimonio zootecnico e per l’uomo di primario interesse. Inoltre la Sardegna nei confronti dell’Echinococcosi-Idatidosi
può essere definita un “caso”, in quanto isola con oltre 3 milioni di ovini, in cui è presente un alto grado di conoscenza
8
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
epidemiologica, ed è inoltre l’unica regione italiana in cui sono stati attuati piani di controllo.
Le prime indagini condotte nell’isola negli anni ’50, evidenziavano nei confronti di questa parassitosi una situazione
catastrofica, con tassi di prevalenza del 99,4 % negli ovini (Tanda, 1960) con il 100 % di soggetti parassitari che albergavano
idatidi fertili. Anche i livelli di positività per il cestode adulto nel cane si attestavano su livelli molto elevati, variabili dall’8%
(Papandrea, 1951) al 45,2% (Medda e Javedaia, 1960, Deiana e Arru, 1960; Arru et al., 1990).
L’infestione risultava colpire durante il triennio 1957-59 il 72,5% dei bovini, con valori del 95% nelle vacche (Tanda,
1960); successive indagini condotte nel 1979 rilevavano la parassitosi con prevalenze nettamente inferiori (32,4%) con
percentuali di fertilità pari allo 0,99 % (Arru et al., 1980). Nel periodo 1988-89 si sono evidenziati idatidi nel 28,5% dei
bovini controllati; di questi il 24,7% albergava cisti fertili (Gabriele et al., 1998).
Tale trend negativo del valore di positività per l’Idatidosi nei bovini è stato confermato da indagini condotte nel corso
del 1996 in cui le cisti di Echinococco venivano evidenziate “solo” nel 5% dei bovini allevati allo stato brado e semibrado
della parte nord-orientale dell’isola (Scala et al., 1997). E’ evidente quindi che allo stato attuale il ruolo del bovino
nell’epidemiologia dell’Echinococcosi-Idatidosi può essere considerato del tutto trascurabile.
Per ciò che concerne invece il suino si può riscontrare una situazione per certi versi sovrapponibile a quello che abbiamo
riportato per i bovini: prevalenze del 72,5% nel corso del triennio 1957-59 (Tanda, 1960), con una percentuale di
soggetti alberganti idatidi fertili del 35,5%; 50, 4% di maiali con idatidi nel 1979 dei quali il 10,1% con idatidi fertili
(Arru et el., 1980); 20,3% dei suini positivi che risultavano con cisti fertili nel 35,3% dei casi durante il periodo 198889 (Gabriele et al., 1998).
Anche nell’uomo la situazione epidemiologica è tale da essere considerata tra le più gravi nell’ambito del bacino del
Mediterraneo, avendo un’incidenza media annuale di circa il 9,8 %°°° con marcate differenze tra le varie province (Ecca
et al., 1998) ed evidenti fluttuazioni annuali (periodo 1969 - 1990 tra il 15 %°°° e l’8 %°°°); sempre nell’isola si sono
effettuati nell’uomo 165 interventi/anno e si è registrata una mortalità paria a 0,8/100.000 abitanti) (Conchedda et
al., 1997).
Attualmente in Sardegna il “trend” della parassitosi sembrerebbe aver subito alcune variazioni, tuttavia i dati inerenti
l’infestione nei vari ospiti, uomo compreso, sono purtroppo incompleti. Infatti, i dati epidemiologici a nostra disposizione,
ad eccezione dell’ovino, non sempre risultano adeguatamente aggiornati e quindi “affidabili”, in quanto è necessario far
riferimento ad indagini ormai datate, soprattutto nel cane.
I recenti dati acquisiti nell’ovino evidenziano una situazione ancora grave, ma diversa a seconda del distretto geografico
dell’isola monitorato.
Le indagini condotte su soggetti allevati nel nord della Sardegna evidenziano la presenza di idatidi nel 76% degli ovini
controllati, ma se prendiamo in considerazione ulteriori parametri epidemiologici riportati nella tabella successiva, quale la
% dei soggetti alberganti idatidi fertili, le infestioni miste (fegato + polmone) e la presenza di infestioni massive (oltre 10
idatidi/capo esaminato), si evince che la parassitosi stia subendo in questi territori una certa contrazione nel tempo (Scala
et al., 2000).
Distretto
Prevalenza
totale idatidosi
Infestione mista
(pol. + feg.)
% ovini con
idatidi fertili
% ovini con
ingestione
massiva
Autori
Sassari
(1988)
85,1%
62,4%
36,8%
26,6%
Gabriele et al. (1992)
Sassari
(1996/97)
76,7%^
62,6%
16,9%
30,1%
Gabriele et al. (1998)
Sassari
(1999)
75,6%
52,2%
6,9%
14,7%
Scala et al. (2000)
Sassari
(2003)
70,6%
38,5%
7,3%
13,8%
Dati in fase di
acquisizione
In questi distretti del nord Sardegna, in cui in effetti l’ovinicultura, ha raggiunto negli ultimi anni un elevato grado
di efficienza, le cause che avrebbero potuto determinare una riduzione di “pressione” parassitaria, in particolare della
diminuita fertilità delle idatidi, potrebbero essere secondo Bortoletti et al. (1990) riconducibili a differenti motivazioni:
“The epidemiological significance of sterile cysts is, at present, unknown and needs further study but some factors (probably
synergistically concurrent) can be considered: a) reduction of transhumant system (CENSIS: l° rapporto sulla situazione
sociale della Sardegna); b) anthelminthic treatment of dogs; c) unfavourable environmental conditions for viability and
maturation process of eggs; d) genetic selection of animals; e) improvements in holding standards”. Tra tutti questi fattori
elencati manca però a nostro avviso quello relativo ai trattamenti antielmintici praticati ormai di routine negli ovini anche
più volte all’anno con benzimidazolici, che come è noto costituiscono un presidio terapeutico importante anche in medicina
umana per ottenere la devitalizzazione delle idatidi. Infatti i trattamenti attuati in Sardegna con queste molecole risultano
essere il 47% del totale (Scala et al., 1999), cioè una quota di tutto rispetto probabilmente in grado di determinare una
certa riduzione di fertilità delle idatidi presenti.
Al contrario se si esaminano i dati scaturiti in un’indagine condotta recentemente da Soro et al. (2002) nel Goceano
(regione centrale dell’Isola) si registra purtroppo una situazione estremamente grave, con tassi di prevalenza del 92,8% e
27,1% degli ovini con idatidi fertili.
E’ evidente quindi che la diffusione dell’EC nell’isola assume delle caratteristiche non sempre uniformi.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
9
Soprattutto nel caso del Goceano la parassitosi continua ad imperversare incontrollata determinando ovviamente gravi
ripercussioni negative sociali, sanitarie ed economiche nel distretto.
In questo contesto in Sardegna si sono portate avanti nel tempo differenti campagne di eradicazione e/o controllo della
parassitosi che tuttavia non hanno sortito gli effetti sperati, nonostante l’impegno profuso delle diverse categorie professionali
impegnate.
In particolare la prima campagna di profilassi (l.r. 29/50) è stata condotta nel periodo 1960 –1965 e prevedeva un
trattamento semestrale obbligatorio e gratuito cani con bromidrato di arecolina. Essa è decollata nel 1960 in provincia
di Nuoro e nel 1962 anche in quelle di Sassari e Cagliari. In totale sono stati trattati circa 38.000 cani in provincia di
Cagliari, 19.000 in quella di Sassari e 17.000 in quella di Nuoro. Globalmente i risultati in relazione a questo impegno
sono stati nettamente inferiori alle aspettative. Era inoltre previsto nel piano anche un risanamento delle strutture relative
agli impianti di macellazione: 164 macelli previsti, 127 effettivamente realizzati e di questi solo 37 funzionanti, peraltro
non tutti con inceneritore. Nei restanti comuni continuavano ad operare strutture private e le macellazioni clandestine
seguitavano ad imperversare.
Un ulteriore obiettivo della prima campagna era inoltre rappresentato dalla lotta al randagismo, che ha comportato la
costruzione dei primi 20 canili e dettato precise norme in riferimento alla cattura, custodia ed eventuale abbattimento dei
cani randagi accalappiati. Tuttavia tali provvedimenti erano limitati solamente i grossi centri urbani. Venivano intraprese
anche misure di educazione sanitaria, ma inesorabilmente nel 1967 il piano naufragò. Nel 1974-1980 le attività ripresero in
modo saltuario in attuazione delle leggi regionali n° 1/69 e n° 39/73, tuttavia anche in questo caso la maggior parte degli
interventi previsti non furono realizzati.
L’emanazione d.p.r. n° 1035/80 che prevedeva l’obbligatorietà del trattamento antielmenitico di tutti i cani con praziquantel,
comportava anche in Sardegna dal settembre 1980 al maggio 1981 l’attuazione di questo tipo di profilassi, ma anche in
questo caso subiva un’interruzione improvvisa per trasferimento dei fondi al piano Peste Suina africana nel frattempo
attivato, in quanto questa infezione determinava importanti problemi economici e sanitari nell’isola.
Infine, con delibera della giunta regionale n. 28/67 del 18.6.87 la regione Sardegna promuove una nuova “Campagna
di eradicazione dell’Echinococcosi Idatidosi” e ne affida l’organizzazione e l’attuazione a un gruppo strategico
multidisciplinare e all’Istituto Zooprofilattico Sperimentale. Essa era caratterizzata da una durata di 10 anni (5 fase
intensiva, 5 mantenimento) e da una disponibilità finanziaria pari a 15 miliardi di vecchie Lire. I settori di intervento
erano fondamentalmente 4: 1) educazione sanitaria indirizzata verso la popolazione in generale (mass media), quella
scolastica (filmati, opuscoli, giochi didattici) e verso le categorie a rischio (allevatori, cacciatori ecc.); 2) controllo della
popolazione canina tramite l’istituzione di un’anagrafe canina, verifica del randagismo e trattamento antielmintico dei cani
con praziquantel; 3) controllo delle macellazioni, attraverso il ritiro e distruzione visceri parassitati provenienti da mattatoi
sprovvisti d’inceneritore, da macellazioni aziendali e da animali morti in campagna; 4) ricerca scientifica e monitoraggio
della campagna di eradicazione.
L’avvio (1991) prevedeva una fase intensiva nelle vecchie UUSSLL di Ales Ghilarza – Carbonia con una successiva
estensione delle attività nelle UUSSLL di Siniscola - Lanusei - Quartu S. Elena ed inizio attività Olbia - Senorbì – Sanluri
nel corso del biennio1992 – 1993.
L’attuazione di tale campagna comportava sul campo il controllo della popolazione canina, in particolare l’anagrafatura di
32.160 su 150.000 stimati e il trattamento antielmintico di 60.040 soggetti, mentre per il controllo delle macellazioni si
arrivò al ritiro ed incenerimento di 1.213 visceri parassitati; sul versante dell’educazione sanitaria venivano organizzati 450
incontri con gli allevatori e di 98 incontri con gli studenti presso altrettante scuole.
Nel 1993 la Regione Autonoma della Sardegna sospende i finanziamenti e blocca definitivamente le attività del piano di
eradicazione.
Risulta quindi evidente che motivazioni di vario tipo, quali quelle sopra accennate, negli anni hanno causato il naufragio
di tutte, o perlomeno in parte, delle iniziative programmate nelle varie campagne di eradicazione o controllo di questa
importante zoonosi sul territorio sardo. I limiti e gli ostacoli che hanno comportato una vanificazione degli obiettivi di tutte
queste campagne sembrerebbero essere, almeno in parte gli stessi individuati in altri distretti geografici, così come riportato
infatti da Eckert et al. (2000), che affermano: “…….., furthermore, financial restrictions and political instability are major
obstacles in control and prevention of echinococcosis …..”.
Tuttavia non tutto è perduto! E’ evidente che le “routinarie” e “classiche” misure di controllo da sole sono in parte destinate
al fallimento, ma insieme a tutta una serie di importanti innovazioni in campo zootecnico, l’acquisizione di un nuovo
spirito sociale e soprattutto la recente istituzione nell’isola del Centro Nazionale di Referenza dell’Echinococcosi-Idatidosi
presso l’Istituto Zooprofilattico della Sardegna si potrebbe raggiungere un risultato importante. Soprattutto l’istituzione del
nuovo Centro Nazionale di Referenza potrà sicuramente dare ulteriore impulso a tutte queste iniziative, in particolar modo
incentivando la ricerca sull’aspetto sicuramente più promettente quale quello della messa a punto di un vaccino in grado
di impedire lo sviluppo delle idatidi nell’ovino, l’ospite intermedio più importante nell’epidemiologia della parassitosi
nell’isola. I risultati della ricerca in tal senso sono confortanti e meritano fiducia (Lightowlers e Gauci, 2001; Tola et al.,
2002). Tuttavia l’obiettivo di controllare l’EI deve essere perseguito con fiducia e perseveranza, soprattutto con l’aiuto e
collaborazione di tutte le maestranze interessate, ai fini di comprendere e combattere le cause “storiche” che determinano
la persistenza della parassitosi nell’isola. Queste sono date soprattutto dallo scarso valore commerciale delle carni ovine che
comportano quindi il permanere del fenomeno delle macellazioni clandestine, l’abbandono delle carcasse sui pascoli che
diventano preda dei numerosi ed incontrollati cani randagi e vaganti onnipresenti. E’ evidente quindi che una adeguata
valorizzazione delle carni ovine, anche attraverso la “messa a punto” di prodotti derivati alternativi, quali salsicce, prosciutti,
ecc., insieme ad un’adeguata incentivazione delle macellazioni “regolari” con una politica di agevolazione delle stesse,
potrebbero costituire una buona linea di profilassi da perseguire.
10
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Bibliografia
Arru E., Nieddu A.M., Huber H.O., Balbo S.M. – L’idatidosi in Italia con particolare riguardo alla Sardegna e alla Sicilia. Atti
Tavola Rotonda Congresso Società Italiana di Parassitologia,, “Echinococcosi Idatidosi” Alghero (SS), 29-31, 1980.
Arru E., Cerchi S., Ligios C., Masala S., Schianchi G. – Diffusione attuale dell’Echinococcosi-Idatidosi in Sardegna. Atti Tavola
Rotonda Congresso Società Italiana di Parassitologia, 16, 9-19,1990.
Bortoletti G., Gabriele F., Seu V., Palmas C. – Epidemiology of hydatid disease in Sardinia: a study of fertility of cysts in sheep. Journal
of Helminthology, 64, 212-216, 1990.
Conchedda M., Palmas C., Bortoletti G., Gabriele F., Ecca A.R. – Hydatidosis: a comprehensive view of the Sardinian case. Parassitologia,
39, 359-366, 1997.
Deiana S., Arru E. – Indagini sulla diffusione di “Echinococcus granulosus” in cani di Sassari. Atti Congresso Internazionale di Idatidologia,
7, 190-194, 1960.
Deiana S., Arru E. – Echinococcus granulosus in Vulpes vulpes della Sardegna. Rivista di Parassitologia, 23(4), 267-275, 1962.
Ecca A.R., Bortoletti G., Conchedda M., Palmas C., Gabriele F. – Human hydatidosis in Sardinia. A retrospective survey. Parassitologia,
40 (Suppl.1), 49, 1998.
Eckert J., Conraths F.I., Turkmann K., Echinococcosis: an emergine or re-emerging zoonosis? International Journal for Parasitology, 30,
1283-1294 (2000).
Eckert J., Gemmel M.A., Meslin F.X., Pawlowski Z.S. - Manual on Echinococcosis in Humans an Animals: a Public Health Problem of
Global Concern. WHO/OIE, Paris (France), 2001.
Gabriele F., Arru E., Firinu A., Palmas C., Bortoletti G. – Valutazione della gravità dell’Idatidosi nell’ovino nelle diverse provincia della
Sardegna. Parassitologia, 34 (suppl. 1), 178-179, 1992.
Gabriele F., Conchedda M., Capra S., Ecca A.R., Palmas C., Bortoletti G. – Sheep hydatidosis in Sardinia: 1996-1997 survey.
Parassitologia, 40 (suppl. 1), 59, 1998.
Guberti V., Zaffaroni E., Morabito P., Lanfranchi P. – Epidemiologia di Echinococcus granulosus nel lupo in Italia. Parassitologia, 40
(suppl. 1), 80, 1998.
Gabriele F., Conchedda M., Ecca A.R., Palmas C., Seu V., Bortoletti G. – L’idatidosi nel bestiame in Sardegna. L’Igiene Moderna, 110,
13-22, 1998.
Lightowlers M.W., Gauci C.G. – Vaccines against cysticercosis and hydatidosis. Veterinary Parasitology, 101, 337-352, 2001.
Macchioni G., Gallo C. - Sulla presenza in Italia dell’Echinococcus granulosus equinus Williams e Sweatman, 1963. Aspetti epizoologici
e studio morfo-biologico del parassita. Annali della Facoltà di Medicina Veterinaria di Pisa, 20, 58-77, 1967.
Manfredi M.T., Di Cerbo A.R., Trevisiol K., Bregoli M., Ferro Milone N., Orusa R., Bazzoli S. -. Epidemiological study on Echinococcus
multilocularis in Red fox (Vulpes vulpes) in Northern Italy. Parassitologia, in corso di stampa.
Medda A., Iadevaia R. – Nuova tecnica per un più sicuro accertamento della presenza di Echinococcus granulosus (Batsch, 1786)
nell’intestino di Canis familiaris. Parassitologia, 2, 237-240, 1960.
Oksanen, A., Lavikainen, A. - Echinococcosis in Fennoscandia. International Archives of the Hydatidosis. 35, 62, 2004.
Papandrea E. – Indagini sulla diffusione delle elmintiasi del cane in Sardegna. Atti S.I.S.Vet., 5, 490-492, 1951.
Poglayen, G., Giannetto, S., Brianti, E. – Climate and Environmental Factors linked to high prevalence ovine cystic echinococcosis in
Sicily (Italy). International Archives of the Hydatidosis, in corso di stampa.
Rogan T. - The origin of daughter cysts in Cystic Echinococcosis. International Archives of The Hydatidosis,in corso di stampa.
Salih N. e Abdullah I. – Echinococcus iraqii (Cestoda: Taeniidae) from stray dogs in Ninevah province, Iraq. Rivista di Parassitologia, 19,
111-118, 2002.
Scala A., Ligios C., Satta G., Gaetani W., Sini T. – Parassitosi bovine: rilievi epidemiologici in Sardegna. Praxis Vet., 18 (3), 10-13,
1997.
Scala A., Bitti P.L., Fadda M., Pilia A., Varcasia A. - I trattamenti antiparassitari negli allevamenti ovini della Sardegna. Proceedings 7°
Congress of Mediterranian Federation for Health and Production of Ruminants, 267-272, 1999.
Scala A., Pintori A., Uras P., Delogu M.L. – Hepatic and pulmonary hydatidosis of sheep in the province of Sassari: data from a recent
survey. Parassitologia, 42 (suppl. 1), 223, 2000.
Soro C., Sardo D., Scala A. - Epidemiologia delle principali endoparassitosi degli ovini nel goceano. ATTI S.I.P.A.O.C., 15, 98, 2002.
Tola S., Ibba B., Chessa G., Idini G., Rosa N., Fusco M., Foddai A., Varcasia A., Rocca S., Masala S. – Produzione di una proteina
ricombinante a scopo vaccinale contro Echinococcus granulosus. Atti SIPAOC, 15, 90, 2002.
Tanda S. – Osservazioni sull’Echinococcosi (Idatidosi) degli animali macellati in Sassari. Veteterinaria Italiana, 11, 3-14, 1960.
Thompsons R.C.A., Lymbery A.J. – Echinococcus and Hydatid Disease, CAB International, Wallingford, Oxon (UK), 1995.
Thompson R.C.A., McManus D. – Towards a taxonomic revision of the genus Echinococcus. Trend in Parasitology, 18, 452-457, 2002.
Varcasia A., Scala A. - La diagnosi di Echinococcosi nel cane: stato dell’arte e prospettive future. Summa, 20(5),11-19, 2003.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
11
INFEZIONI DA ROTAVIRUS ED ESCHERICHIA COLI ENTEROTOSSICO
NEI PICCOLI RUMINANTI
Valente C.*, Marenzoni M. L*., Cuteri V**
* Università di Perugia,. ** Università di Camerino
Le sindromi enteriche dei piccoli ruminanti sono malattie a decorso generalmente acuto, caratterizzate da diarrea, che
interessano animali neonati. L’importanza di queste malattie si desume dalle inchieste condotte su vasta scala dalle quali
risulta che, oltre al costo dei farmaci e manodopera, il 15 % degli animali allevati viene a morte nei primi due mesi di vita
e che gli agenti infettivi concorrono almeno per il 10-15% .
Numerosi sono gli agenti virali, Adenovirus, Astrovirus, Coronavirus e Rotavirus, ospiti dell’apparato enterico, capaci di
indurre alterazioni di vario tipo. Tra le enteriti virali che hanno suscitato maggiore interesse vanno menzionate le forme
sostenute da Rotavirus (1). Sono agenti di malattia compresi nella famiglia Reoviridae e come tutti i componenti di questo
raggruppamento sono costituiti da un RNA segmentato che comporta una grande variabilità antigenica. Si tratta di virus
diffusi in tutto il mondo, nell’uomo, negli animali domestici e negli uccelli. I Rotavirus provenienti dalle diverse specie
animali sono sierologicamente correlati anche se è possibile geneticamente e antigenicamente differenziarli. La diffusione
nell’ambiente di Rotavirus avviene attraverso la eliminazione del virus da parte di soggetti adulti infetti che non ammalano
ma sono in grado di contagiare i neonati. La trasmissione da un ospite all’altro è stata riprodotta sperimentalmente e
l’esistenza di Rotavirus negli agnelli è stata documentata nel 20-30% dei casi di diarrea. Le indagini sierologiche hanno
dimostrato che Rotavirus è endemico nella popolazione ovina, come tra l’altro è stato dimostrato nell’uomo, nel bovino
e suino. La presenza di anticorpi circolanti, pur avendo un grande valore epidemiologico, non equivale ad uno stato
di resistenza dell’animale in quanto sono prevalentemente le IgA secretorie che preservano gli animali dalla malattia.
Le conoscenze attuali, contrariamente a quanto succedeva nei primi tempi in cui il “reolike”venne segnalato, per averlo
osservato al microscopio elettronico, da Mebus nel vitello, i Rotavirus vengono coltivati su linee cellulari di rene si scimmia
dopo essere stati a contatto con tripsina. Come in altre specie animali Rotavirus infetta e distrugge le cellule epiteliali
dell’intestino tenue causando atrofia e conseguente malassorbimento con sindrome enterica. La somministrazione di
vaccini, intervenendo sulle femmine gravide, consente, previa suzione del colostro, di proteggere i neonati.
Anche i microrganismi coinvolti in queste sindromi sono numerosi, E. coli, Salmonella, Campylobacter, Clostridium,
Cryptosporidium e possono variare in funzione del Paese, della razza animale e del tipo di allevamento. .Escherichia coli, ospite
abituale dell’intestino degli ovini, è uno degli agenti maggiormente coinvolto nelle sindromi enteriche (2). Solo un numero
contenuto di E. coli è in grado di determinare alterazioni enteriche in virtù di alcuni attributi di virulenza rappresentati
da un antigene piliare (K99) che aderisce agli enterociti e da un’ enterotossina a basso peso molecolare, modesta attività
antigenica e termostabile (ST). L’azione combinata dei caratteri di virulenza di questi stipiti di E. coli, denominati ETEC,
determina una colonizzazione intestinale ed un eccesso di secreto fluido.. L’azione patogena del microrganismo, che altera
il sistema di regolazione dei liquidi intestinali, rimane localizzata all’intestino coinvolgendo prevalentemente il tratto del
tenue. La verifica della enterotossigenicità di E. coli è stata sperimentata sull’agnello inoculato per via orale o direttamente
attraverso le anse intestinali. Gli stipiti ETEC, in sede sperimentale, sono capaci di indurre secreto fluido anche in un
segmento isolato di anse intestinali. Gli stipiti ETEC sono stati isolati nel 20-40 % di agnelli con diarrea (Scozia, Italia ed
USA) Solitamente gli agnelli hanno una età compresa tra 2-5 giorni, presentano una diarrea fluida, disidratazione e restano
in decubito incapaci di poppare il latte materno. La conoscenza degli ioni che vengono eliminati con la diarrea è importante
poiché devono essere ricostituiti in sede di terapia. Nei soggetti ammalati la mortalità può raggiungere valori del 75%.
Malgrado le due forme morbose, quella virale e quella sostenuta da E. coli, vengano riportate separatamente, in natura,
succede spesso che siano contemporaneamente entrambe presenti negli stessi animali. Questo giustifica il fatto che spesso,
nel momento di controllare le enteriti, si preferisca inoculare un vaccino bivalente che comprenda oltre ai virus anche gli
stipiti di E. coli ETEC.
Bibliografia
1.Snodgrass D.R. e coll, (1977). A survey of Rotaviruses in sheep in Scotland, Vet. Rec., 100, 341-352
2. Valente C. (1995) Malattie infettive degli animali domestici, Galeno Editrice, Perugia,121-150.
12
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Summary
ENTERIC DISEASES CAUSED BY ROTAVIRUS AND ENTEROTHOXIGENIC.ESCHERICHIA
COLI IN SMALL RUMINANTS
Valente C.*, Marenzoni M. L*., Cuteri V**
* Università di Perugia,. ** Università di Camerino
.
Enteritis in young small ruminants, less than one week old, are characterized by a rapid onset. Dysentery can result in
significant mortality, about 10 % , or economic loss from reduced condition, drugs and labour. Numerous agents are
involved and many survey have documented the importance of different infectious agents.
Viral enteritis attracted much interest and virus are now regarded as significant causes of diarrhoea. Rotavirus in particular
has been shown to occur globally in man and his domesticated mammals. Rotavirus from different species are serologically
related, but are usually distinguishable by genetic and antigenic analysis. The existence of Rotavirus in lambs has been
confirmed and the virus infection was detected in 25 per cent of scouring lambs. Antibody surveys suggest that rotavirus
is endemic in sheep population, as has been found in man, cattle and pigs. Lamb rotavirus infects and destroys the mature
absorptive villus epithelial cell of the small intestine, leading to villus atrophy and a malabsorptive diarrhoea.
Escherichia coli is a normal inhabitant of the bowel of sheep. Only a minority of strains of E. coli are capable of
causing diarrhoea and knowledge of the virulence factors involved is well documented. E. coli enteropathogenic (ETEC)
capable of causing diarrhoea posses an antigenic pilus, K99, which enables them to adhere to intestinal epithelium and
produce an enterotoxin, heat-stable (ST) with low molecular weight and non antigenic activity.. The enteropathogenicity
was performed by either oral inoculation of neonatal lambs or by inoculation of ligated intestinal loops. Strains ETEC
have been isolated from 20-40 per cent of scouring lambs that usually exhibit fluid diarrhoea, weakness and mortality rate
up to 75 per cent..
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
13
CRIPTOSPORIDIOSIS EN PEQUEÑOS RUMIANTES: IMPORTANCIA
Y MEDIDAS DE CONTROL.
Prof. Dr. P. Díez-Baños & Profa. Dra. Mª P. Morrondo-Pelayo.
Parasitología y Enfermedades parasitarias. Dpto. de Patología Animal. Facultad de Veterinaria de Lugo.
Universidad de Santiago de Compostela (España).
Summary
Among numerous infections and parasitic agents causing neonatal ruminants diseases point up Cryptosporidium parvum.
The infection take place in the first hours of life in which neonato swallow oocysts from his mother as a example of fecal-oral
transmission. C. parvum is a primary pathogen and/or together with other enteropathogens and every day is more frequently
diagnosticated. It is world-wide spread, with rates of farm infection up to 52 % and it can be infected all animals at the end
of lambing periods when environmental contamination is very high (soil, feeders, drinkingplaces, udders, etc). Oocysts are
very resistant which increase its transmission risk, specially in crowding and deficients hygienic-sanitary conditions that
may favour the contacts healthy and infected animals. Besides economic significance C. parvum infection is a zoonosis
Cryptosporidiosis is associated with enteric clinical signs including severe diarrhoea in neonato with increased number of
faecal oocysts, dehydration, inappetence, listlessness and loss of weight. Mortality can reach to 10 % when C. parvum is the
only agent present. There is a loss more than 2 Kg in 35 days in lambs infected by C. parvum in comparison with healthy
ones.
There are not many drugs with efficacy against C. parvum, halofuginone lactato, paronomicine, lasalocide, and decoquinate
were investigated. Nawadays only reduction of oocysts in faeces and lower severity of diarrhoeas were observed, but there
is not a efficacious treatment. Syntomatic applications in cryptosporidiosis including separation of infected animals,
fluidotherapie, supression of milk, probiotics, etc, only reduce rates of morbility and mortality of infected animals.
Specific adquired immunity and active immunity of neonato are beneficial in absence of a efficacy treatment. Investigations
on immunoprofilaxis of cryptosporidiosis lead to (a) Antibodies in colostrum of hiperimmunized pregnant females at the
end of gestation (b) Monoclonal antibodies as a preventive treatment (c) Resistant factor from linfocites culture medium
of immunized animals against C. parvum.
In spite of success in a vaccine of C. parvum there is not commercial availability. It is necessary to adopt hygienic-sanitary
measures and to avoid accummulation of envrironmental oocysts as a source of infection to neonato. Moreover is necessary
to avoid infection of healthy animals through knowledge of main risks of Cryptosporidum infection and to adopt most
adequate preventive measures in each farm.
Introducción
La criptosporidiosis es una parasitosis de amplia distribución entre los rumiantes neonatos, cuya manifestación más es el
síndrome diarreico neonatal. Sus repercusiones en la producción animal son importantes no solo por las tasas de mortalidad
que causa, sino por la influencia sobre el retraso del crecimiento de los animales jóvenes y los costes que se derivan.
Aunque los criptosporidios se conocen desde hace tiempo en muchas especies animales y en el hombre, hasta la década
de los 80 no se estudió con profundidad su capacidad patógena para producir diarreas en terneros y corderos infectados
naturalmente y en ausencia de otros agentes enteropatógenos. Sin embargo, la etiología del síndrome diarreico de los
neonatos es muy compleja, actuando habitualmente, además de Cryptosporidium virus (rotavirus o coronavirus), bacterias
como Escherichia coli, Salmonella, Clostridium, Proteus, Pseudomona y los hongos Candida. Lo que sí está claro es que al
mejorar la atención hacia los criptosporidios, se le ha dado un nuevo enfoque al síndrome diarreico de los recién nacidos.
Así pues, la criptosporidiosis se presenta con mayor significación en rumiantes de 1 semana de vida, aunque también se
ven afectados hasta los 15 días, si bien parece que con manifestaciones más leves. La vía de infección es la fecal-oral, y en el
inicio de un brote de criptosporidiosis tiene mucha influencia las madres portadoras, que eliminan ooquistes en sus heces
pero no desarrollan el proceso, así como los primeros neonatos infectados. La infección puede comenzar ya a las pocas
horas del nacimiento de los corderos, cuando los recién nacidos ingieren ooquistes presentes en el medio o al mamar de
ubres contaminadas.
Acciones nocivas.
Los criptosporidios se desarrollan de forma directa en el intestino de sus hospedadores, en especial en el intestino delgado,
con intensa destrucción de enterocitos en los que se multiplica. La multiplicación del parásito tiene lugar en el borde
luminar de las vellosidades intestinales, de modo que primero son englobados por la membrana de la célula hospedadora,
formando una vacuola parasitófora, y quedan en situación intracelular pero extracitoplasmática; además hay una zona
electrodensa, entre la célula hospedadora y el parásito, a través de la cual se alimenta éste.
Prosigue la multiplicación, rompiendo la célula hospedadora e invadiendo otros entericitos próximos. Esta intensa
multiplicación origina la atrofia parcial y la fusión de vellosidades intestinales, de modo similar a lo que sucede en
infecciones por rotavirus. Definitivamente hay un cuadro de malabsorción a la vez que sobreviene un desequilibrio rápido
de electrolitos, al verse alteradas la permeabilidad de la mucosa intestinal y la motilidad. Finalmente, el signo clínico
más destacado es la diarrea, como consecuencia de la pérdida de agua fecal y de electrolitos, cuya composición llega a ser
parecida a la del propio plasma sanguíneo.
Las heces son blandas, o fluidas, de color amarillento y olor fétido; en ocasiones pueden tener restos de fibrina o de sangre
y mucus. La duración de la diarrea es variable, desde 3-5 días en casos menos graves, hasta 1-2 semanas en brotes más
intensos. En todo caso siempre es importante la intervención de las respuestas inmunitarias como se verá en el apartado de
inmunoprofilaxis.
14
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
A la diarrea y eliminación cuantiosa de ooquistes se unen la deshidratación, el dolor abdominal, la falta de apetito y el
retraso del crecimiento o pérdida de peso, que es acumulable durante el periodo de crecimiento posterior; la muerte puede
sobrevenir entre un 10-25 % de los animales, pudiendo incrementarse si actúan a la vez otros patógenos intestinales.
Otros factores de patogenicidad de los criptosporidios.
Algunos autores han estudiado y descrito la actuación de otros factores para explicar con más detalle las acciones patógenas
de estos parásitos, identificando y caracterizando diversos factores de virulencia. Algunos actúan sobre la adherencia y
fusión celular, mediante factores que favorecen la intervención de moléculas que median la adhesión; son por ejemplo,
la glicoproteína llamada gp900, o el antígeno CPS-500 que es un glicolípido. No se sabe cómo se produce la rotura de la
membrana celular durante la invasión por Cryptosporidium, pero sí se sabe que puede estar causado por proteasas (cisteina,
aminopeptidasa) o fosfolipasas que parecen tener un papel activo en los estadios iniciales de la infección.
También son candidatas a una acción patógena importante la enterotoxina hemolítica conocida como hemolisina H4, que
curiosamente es homóloga a la hemolisina de Escherichia coli enteropatógenos 0157 H7, y diversas “Heat shock proteins”
(HSP), entre las que la denominada HSP 70 es muy similar a la que poseen las cepas más patógenas de Toxoplasma
gondii.
Se ha comprobado un efecto citopático sobre las células epiteliales afectadas, pero también sobre otras células próximas,
de modo que hay que suponer la activación de algunos factores que originan un fenómeno de apoptosis o de muerte
programada de células cercanas a las parasitadas.
Todos estos estudios sugieren de los determinantes de la patogenia necesitan más investigación y en especial si se tiene en
cuenta que no se comportan del mismo modo en todos los aislados de C. parvum.
Importancia de la criptosporidiosis ovina y caprina.
Los primeros casos de esta parasitosis en ovino y caprino proceden de Australia en los años 1974 y 1981, respectivamente.
Desde entonces, se han ido citando en numerosos países como agente único y en ausencia de otros enteropatógenos, y.
en algunos países la criptosporidiosis de corderos y cabritos parece ser uno de los principales patógenos de las diarreas de
neonatos.
En España, la presencia de C. parvum en el ganado ovino se denunció por primera vez en 1985 (Rojo et al). Posteriormente,
se han ido realizando numerosas citas de casos aparecidos en explotaciones con diarreas en corderos neonatales y cabritos,
pero también se ha puesto de manifiesto en granjas escogidas de modo aleatorio, donde no había problemas intestinales
evidentes. En trabajos realizados sobre un número de explotaciones representativo, se han obtenido prevalencias de hasta
el 57 %, lo que representaría pérdidas económicas considerables. No obstante, los resultados respecto de la incidencia de la
criptosporidiosis son muy variables, dependiendo de cómo se tomen las muestras y si los datos se refieren por explotación
o por animales afectados de forma individual. Cuando se han analizado granjas al azar, los porcentajes oscilaron entre
un 14,7 % y 84,4 % de rebaños positivos, pasando por otros porcentajes del 24, 40,2 y 52. En cambio, los resultados
individuales reducen mucho esas cifras, pues se han hallado desde un 12,2 a 45 % de participación de C. parvum en
corderos diarreicos.
Las ovejas que son portadoras asintomáticas pueden explicar el mantenimiento de infecciones por C.parvum entre periodos
de partos.
En relación con el caprino, estudios efectuados al azar, mostraron que el 42,1 % de los rebaños eran positivos, con un 13,5
% de los cabritos afectados (Martín, 2000).
De las investigaciones revisadas se deduce que no existe asociación entre la presencia de infecciones por criptosporidios y las
localizaciones geográficas; por el contrario, es más un problema propio de establos, en los que las mayores prevalencias se
señalan en periodos de parideras. Además, las ovejas que son portadoras asintomáticas pueden explicar bien el mantenimiento
de infecciones por C. parvum entre los periodos de partos.
Factores de riesgo para la transmisión de la criptosporidiosis
La fuente esencial de infección son las deyecciones con los numerosos ooquistes de Cryptosporidium procedentes de animales
infectados; el paso siguiente es la contaminación medioambiental (suelos, paredes, comederos, ubres, etc), que posibilita
su llegada a animales receptivos.
En primer término destaca la enorme capacidad de multiplicación de C. parvum, de modo que un cordero o cabrito afectado
eliminaría hasta más de un millón de ooquistes por gramo de heces al día, lo que da idea de la fuente de contaminación
ambiental tan alta que suponen unos pocos casos de criptosporidiosis ovina y caprina. Además, es suficiente con muy
pocos ooquistes para infectar un cordero neonato como se ha demostrado experimentalmente. Resulta evidente también la
relación existente entre la edad de los hospedadores y las cifras de ooquistes que eliminan.
La resistencia de los ooquistes en el medio es muy notable, de tal forma que se mantienen viables frente a compuestos
desinfectantes comunes y a temperaturas no excesivamente extremas. En cambio, la desecación anula pronto la capacidad
infectante de los ooquistes.
Las circunstancias de mala higiene y de manejo inadecuado de los rebaños ovinos y caprinos son determinantes en la
presentación de criptosporidiosis, especialmente si se considera que la transmisión es directa por la vía fecal-oral. Los
animales neonatos diarreicos son un peligro inminente para los vecinos sanos recién nacidos, por eso cuando la paridera se
concentra en poco tiempo, y hay un cierto grado de hacinamiento, el riesgo de transmisión se multiplica enormemente y
los brotes de diarrea son muy probables.
Así pues, el descuido o la falta de medidas higiénicas facilitan el acúmulo de grandes concentraciones de ooquistes en el
entorno y con ello se estima que existe un riesgo elevado de infección.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
15
Referencias para el diagnóstico de la criptosporidiosis
No se pueden indicar diferencias claras entre las sintomatología de la criptosporidiosis y procesos debidos a otros
enteropatógenos de neonatos, de modo que la clínica no confirma el diagnóstico etiológico, aunque sí resultan muy
orientativos por ejemplo todos los antecedentes del brote.
Las distintas técnicas laboratoriales permiten confirmar fácilmente la presencia de ooquistes de C. parvum. Son esféricos de
un tamaño aproximado de 5 um y poseen cuatro esporozoitos de forma semilunar.
Las diferentes tinciones (métodos de Ziehl-Neelsen, Heine, auramina-rodamina, etc) de las extensiones directas a partir
de heces o sobre material previamente concentrado, permiten observar al microscopio los ooquistes, y también hacer
determinaciones semicuantitativas para tener una idea de la intensidad de excreción de C. parvum, haciendo recuentos del
número de ooquistes presentes por campo microscópico examinado.
Nunca debe prescindirse de la necropsia puesto que siempre aporta datos de interés acerca de las imágenes del intestino
lesionado, características del contenido intestinal, importancia y distribución de la enteritis, etc. La histopatología resulta
útil para apreciar las alteraciones estructurales y la posición en el borde luminar de las distintas formas de multiplicación
del parásito.
Dado que el síndrome diarreico de los recién nacidos responde a etiología diversa, y en ocasiones incluso hay infecciones
mixtas conjuntamente, es necesario descartar otros agentes patógenos y estimar concretamente los que intervienen
activamente en cada caso.
Se completa el diagnóstico con técnicas inmunológicas, que son de más utilidad para estudiar grupos de animales y para
la obtención de datos epidemiológicos. La inmunofluorescencia basada en anticuerpos policlonales y muy especialmente
monoclonales, así como los métodos inmunoenzimáticos de captura de antígenos parasitarios en heces, proporcionan
buenos resultados. Es necesario disponer de anticuerpos monoclonales con buen umbral de detección de ooquistes, y con
una sensibilidad y especificidad aceptables, que eviten reacciones cruzadas con otros coccidios.
Las técnicas inmunológicas que detectan inmunoglobulinas frente a C. parvum en suero, han mejorado el diagnóstico y el
conocimiento de la respuesta inmune; no obstante, todavía no es posible diferenciar bien los anticuerpos adquiridos de la
madre a través de calostro, de los propios de los neonatos en las primeras semanas de vida.
Las actuales técnicas de biología molecular, de gran especificidad y sensibilidad, hacen posible la detección de portadores
asintomáticos, siendo más aplicadas actualmente en la práctica en humanos que en animales debido a sus elevados costes
económicos.
Medidas de Control de la criptosporidiosis
Tratamiento específico
La mayor parte de los intentos de tratamiento farmacológico frente a los criptosporidios animales y humanos no han
tenido el éxito deseado. Se han probado numerosos coccidiostáticos y antibióticos, de los que solo algunos han demostrado
cierto grado de eficacia, representada sobre todo por la disminución del número de ooquistes eliminados en la heces y por
la menor intensidad de las alteraciones digestivas, principalmente la disminución del proceso diarreico, pero no resuelven
totalmente la infección.
El lactato de halofuginona se ha ensayado como preventivo en explotaciones con historial de diarreas, dándolo en las primeras
24-48 horas de vida y también en casos de diarreas administrado a las 24 horas de su inicio. Las dosis más frecuentemente
usadas en corderos neonatos son 0,5 mg/Kg peso vivo/día, durante 3 días consecutivos. Por norma general, los resultados
fueron una menor eliminación de ooquistes y presencia de diarreas mucho menos acentuadas. Cuando el tratamiento se
acompañó de medidas de sintomáticas, los resultados mejoraron sensiblemente.
La lasalocida parece mostrarse eficaz en la profilaxis de critosporidiosis en terneros, pero en esos casos resultó tóxico a las
dosis ensayadas, lo que le hace incompatible con su comercialización y lo mismo sucedió en pruebas con dosis de 1 g/ por
oveja y día en el pienso.
En animales experimentales de 0-28 días de edad, la paromomicina, a dosis de 25-100 mg/kg y día, redujo la eliminación
de ooquistes fecales y la intensidad de las diarreas.
Por su parte el decoquinato se ha utilizado en cabritos infectados experimentalmente de 1-2 días de edad, a la dosis de 2,5
mg/kg pv, durante 10-21 días postinfección; fue bien tolerado y la intensidad de la infección se redujo notablemente y
también disminuyeron la cantidad de ooquistes excretadosy el tiempo de excreción.
Medidas de aplicación sintomática
Cobran más importancia una vez iniciada la enfermedad con objeto de controlar la mortalidad y la morbilidad en el rebaño.
El primer paso debe ser el rápido y eficaz aislamiento en un lazareto de los corderos o cabritos enfermos y con diarrea, con
el fin de impedir que se vea muy contaminado el ambiente y los otros animales sanos.
Esos animales diarreicos no deben alimentarse con leche, por las dificultades que tienen para su correcta digestión y en
cambio sí debe aplicárseles sueros con electrolitos y glucosa. La flora normal intestinal puede recuperarse con preparados
a base de Lactobacillus. Los inhibidores de la motilidad intestinal están contraindicados porque impedirían la normal
evacuación de los parásitos y facilitarían la actuación de sus toxinas al propiciar su absorción y fijación en el intestino.
Cuando haya concomitancia de bacterias enteropatógenas se precisará la antibioterapia adecuada a cada caso.
El control medioambiental higiénico-sanitario y de manejo conforma las medidas más prácticas para evitar el contagio
de los criptosporidios a los neonatos, y contribuye a prevenir la difusión de la parasitosis hacia animales normales.
Se debe procurar la limpieza y desinfección de las naves al menos una vez por semana para impedir la presencia de ooquistes
y otros patógenos en el ambiente. Para ello, es suficiente con agua caliente a presión y la posterior desecación directamente
sobre suelos, paredes, comederos, etc. Si se opta por los desinfectantes, es necesario tener en cuenta la resistencia de los
16
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ooquistes ante los productos más habituales y emplear por ejemplo sales de sodio o de amonio a las concentraciones
indicadas.
Se debe evitar el hacinamiento y separar los lotes de corderos o cabritos convenientemente, para que no estén todos en un
mismo recinto. Además, es importante que tomen el calostro suficiente a las primeras horas de vida, que contribuirá a una
mejor resistencia no solo frente a la criptosporidiosis sino también a otros patógenos neonatales.
Inmunoprofilaxis para el control de la criptosporidiosis
Al igual que sucede con procesos diarreicos de origen vírico o bacteriano, los esfuerzos en este sentido se dirigen a lograr
la inmunidad de los neonatos a través de sus madres. La obtención del calostro y leche hiperinmune ante C. parvum, se
consigue inmunizando las ovejas madres en el último tramo de la gestación. En experiencias realizadas mediante vacunación
combinada por vía intramuscular (1 mes antes del parto) e intramamaria (a las dos semanas de la primera) se evidenció un
aumento importante de los anticuerpos específicos en el calostro y leche durante los 20 primeros días post-parto.
El material “vacunal” consistió en antígenos de los estadios infectantes del parásito (ooquistes y esporozoítos) que actúan
directamente, como ya se apuntó previamente, en el contacto y entrada de los parásitos en los enterocitos. Sin embargo,
es evidente que el avance de la inmunoprofilaxis pasa por conocer mejor y definir bien qué compuestos, entre todos los
antigénicos del parásito, pueden determinar la respuesta inmunitaria protectora más eficaz.
Por el momento, de las experiencias de inmunoprofilaxis en corderos que tomaron el calostro y leche de sus madres
inmunizadas, se deducen resultados muy positivos, que se traducen por un retraso del inicio de la enfermedad, menor
duración e intensidad de ésta, así como la importante reducción de la eliminación de ooquistes (hasta un 77 % según los
casos) y un apreciado incremento de peso, cifrado en más de dos Kg en el primer mes, respecto de corderos testigo no
inmunizados, Martín Gómez (2000).
No obstante, como afirman los autores de estas experiencias, habrá que esperar algún tiempo para referirse a vacunas
comerciales frente a los criptosporidios.
Referencias bibliográficas.
Causapé Valenzuela, A.C. (1997). Contribución al conocimiento de la criptosporidiosis ovina y métodos de control. Tesis doctoral.Facultad
de Veterinaria. Universidad de Zaragoza (Spain).
Martín Gómez, S.(2000). Contribución al conocimiento de la inmunoprofilaxis de la criptosporidiosis ovina. Tesis doctoral. Universidad de
León (Spain).
Morrondo Pelayo, MP. and Díez Baños, P. (1998) Criptosporidiosis de los rumiantes. Información Veterinaria, nº 193 : 53-58.
Naciri, M., Mancassola, R., Reperant, J.M., Canivez,O., Quinque, B., and Yvore,P. (1994). Treatment of experimental ovine
cryptosporidiosis with ovine or bovine hyperimmune colostrum. Vet. Parasitol. 53: 173-190.
Naciri, M., Mancassola, R., Yvore, P., Peeters, J.E. (1993). The effect of halofuginona lactate on experimental Cryptosporidium parvum
infections in calves. Vet. Parasitol., 45: 199-207.
OKhuysen, C.P. and Chappell, C.L. (2002). Cryptosporidium virulence determinants- are we there yet ? Int. J. Parasitol., 32: 517-525.
Ortega-Mora, L.M., Requejo-Fernández, J.A., Pilar-Izquierdo, M., Pereira Bueno, J.M. (1999). Role of adult sheep in transmisión of
infection by Cryptosporidium parvum to lambs: confirmation o periparturient rise. Int. J. Parasitol., 29:1261-1268.
Ortega-Mora, L.M., Troncoso Ramón, J.M., Rojo-Vázquez, F.A. and Gómez Bautista, M. (1993). Serum antibody response in lambs
naturally and experimentally infected with Cryptosporidium parvum. Vet. Parasitol., 50: 45-54.
Quílez, J., Vergara-Castiblanco, C.A., Ares-Mazás, M.E., Sánchez-Acedo.C. del Cacho, E. and Freire-Santos, F. (2002). Serum antibody
response and Cryptosporidium parvum oocyst antigens recognized by sera from naturally infected sheep. Vet. Parasitol., 104: 187-197.
Rojo-Vázquez, F.R., Gass, A. and Alunda, J.M. (1985). Denuncia en España de la criptosporidiosis ovina. IV Congreso Nacional de
Parasitología, Tenerife, p. 166.
Troncoso Ramón, J.M. (1992). Cryptosporidium parvum en la diarrea neonatal en pequeños rumiantes y algunos aspectos epizootiológicos de
la criptosporidiosis de corderos. Tesis doctoral. Facultad de Veterinaria. Universidad Complutense Madrid.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
17
IL RUOLO DEL VETERINARIO ISPETTORE NEL GARANTIRE
LA SICUREZZA SANITARIA DELLA CARNE.
Severini M.
Dipartimento di Scienze degli Alimenti – Sezione di Sicurezza e Qualità degli Alimenti di Origine Animale.
Università degli Studi di Perugia, Italia.
Nella storia del mondo moderno, gli alimenti di origine animale, ed in particolare la carne ed il latte, sono stati tra i primi
ad essere oggetto di controlli sanitari accurati e sistematici in molti Paesi. La responsabilità di tali controlli è stata, in genere,
attribuita ai veterinari (Hood and Johansen, 1957). Infatti, si trattava soprattutto di impedire che alimenti ottenuti da
animali portatori di eventuali malattie trasmissibili agli esseri umani (zoonosi) fossero destinati al consumo, con il rischio
di provocare l’insorgenza di gravi patologie (Dolman, 1957). Il ruolo del veterinario, quindi, è sempre stato centrale nel
controllo delle carni degli animali macellati, ma ha riguardato anche altri prodotti primari ed i prodotti trasformati a base
di carne, latte, uova, ecc., seppure con varie differenze da Paese a Paese. In Italia, ad esempio, il veterinario è stato fin dagli
inizi del 1900 il principale responsabile del controllo di tutti gli alimenti di origine animale e dei loro derivati.
Quest’ attività ha dato in molti Paesi un efficace contributo alla lotta contro alcune gravi zoonosi, tra cui la tubercolosi e la
brucellosi, ed ha permesso per lungo tempo di proteggere la salute dei consumatori dal rischio di contaminazioni biologiche.
Per quanto riguarda il latte si è trattato soprattutto di un controllo dell’igiene della mungitura e del trasporto, associato
ad una valutazione dello stato sanitario degli animali in produzione. Per quanto riguarda la carne, invece, l’attività è stata
imperniata sulla visita degli animali prima della macellazione e sull’ispezione delle carni (ispezione “ante mortem” e “post
mortem”), nonché sul controllo dell’igiene delle operazioni di macellazione. Il veterinario, cioè, doveva non solo accertare
la sanità degli animali e delle carni rispetto alle malattie (parassitarie, batteriche, virali) pericolose per il consumatore, ma
doveva assicurare anche che le carni prodotte non fossero state significativamente esposte a contaminazione batterica durante
la macellazione. In genere, le norme di legge hanno previsto che il veterinario assistesse all’intero processo lavorativo, per lo
meno quando l’entità della produzione era rilevante. Queste attività di controllo veterinario sono state ovunque di grande
importanza nel prevenire la trasmissione di gravi zoonosi agli esseri umani attraverso gli alimenti. Tuttavia, va ricordato che
per quanto riguarda il latte un ruolo decisivo nella lotta a malattie come la tubercolosi è stato giocato dai trattamenti termici
effettuati in modo industriale e dal confezionamento del prodotto prima dell’ immissione in commercio.
Con l’aumentare dell’uso di sostanze medicamentose negli animali e di pesticidi in agricoltura e con l’intensificarsi dei processi
di industrializzazione in certe aree del mondo sono emersi in modo sempre più rilevante i rischi di una contaminazione da
parte di sostanze presenti nell’ambiente (contaminanti chimici ambientali, quali pesticidi e metalli pesanti) o somministrate
in modo legale o illegale direttamente agli animali (es. residui di sostanze farmacologiche, ormoni, tireostatici), nonché
di contaminazioni crociate da parte di pericolosi microrganismi. Di fronte a questi nuovi pericoli i tradizionali interventi
di controllo si sono rilevati scarsamente efficaci (Severini e Romanelli, 1980; Hathaway and McKenzie, 1989; Berends
et al., 1993). Si è reso sempre più necessario ricorrere ad analisi di laboratorio che consentissero di svelare la presenza di
contaminanti, che per lo più non determinano significative manifestazioni cliniche negli animali e/o evidenti e specifiche
alterazioni anatomo-patologiche negli organi sottoposti ad ispezione nel macello.
Nei Paesi dell’ Unione Europea (UE), analogamente a quanto avveniva negli USA, sono stati predisposti ed adottati piani
nazionali per il monitoraggio ed il controllo della presenza di residui, innanzitutto nelle carni e successivamente anche in
altri prodotti primari. In Europa sono gli anni dei ” piani nazionali residui”. Questo strumento si è rivelato di grande
importanza per conoscere il grande problema delle contaminazioni chimiche, ma ha anche mostrato alcuni suoi limiti nel
riuscire a prevenire il rischio della presenza di residui negli alimenti. Quindi, è risultato evidente che, per esplicare la sua
efficacia, questa attività di monitoraggio e sorveglianza necessitava di essere inserita in maniera funzionale ed organica in
un più vasto contesto di misure di controllo integrate a livello di filiera.
In questo stesso periodo, infatti, si è andato sviluppando il concetto di controllo di filiera, e cioè di un controllo integrato
che deve interessare tutte le singole fasi del processo produttivo. In ciascuno “step” devono essere adottate tutte le misure
necessarie per individuare ed eliminare i pericoli sanitari ed offrire garanzie che possano essere utilizzate per impostare
nel modo più efficace possibile i controlli nello “step” successivo (Severini et al., 1995). Ogni fase deve essere garantita e
costituire il presupposto per i controlli da adottare nella fase seguente, e così via fino a giungere al momento del consumo
dell’alimento (Severini, 1985). Il concetto è stato espresso come controllo ” from farm to fork” (dall’allevamento alla
tavola) e anche come LISA (“Longitudinal Integrated Safety Assurance). In tal modo si intende affermare il principio che
la sicurezza sanitaria di un alimento è il risultato di una sequenza di interventi organici ed integrati tra loro, i cui risultati
vengono certificati fase per fase ed accompagnano il prodotto (dall’animale ai suoi derivati) lungo tutta la filiera fino al
termine dell’intero processo produttivo (Snijders et al., 1989). Una corretta informazione/formazione dei consumatori
dovrebbe completare il sistema di sicurezza alimentare. In questo contesto ha avuto notevole importanza anche l’adozione del
sistema HACCP (Hazard Analysis Critical Control Point), soprattutto per quanto riguarda i prodotti lavorati e trasformati.
L’Unione Europea, inoltre, ha emanato leggi che attribuivano maggiore responsabilità e coinvolgimento del produttore
nel garantire la sanità degli alimenti. Ai gestore delle imprese alimentari è stato gradualmente imposto di adottare piani di
“autocontrollo” che, applicando il sistema HACCP, consentissero di individuare i maggiori pericoli insiti nello specifico
sistema produttivo e di tenere sotto controllo le fasi più rischiose per la sicurezza dell’alimento prodotto.
Un ulteriore importantissimo approccio alla sicurezza alimentare è rappresentato dall’analisi del rischio (Codex
Alimentarius Commission, 1995; Buchanam, 1998). Come noto, questo metodo si articola in tre fasi principali: a) la
valutazione del rischio (Risk Assessment), b) la gestione del rischio (Risk Management), c) la comunicazione del rischio
(Risk Communication). A sua volta la fase di analisi del rischio viene articolata in: 1) identificazione del pericolo (Hazard
18
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Identification), 2) caratterizzazione del pericolo (Hazard Characterization), 3) Valutazione dell’esposizione (Exposure
Assessment), 4) caratterizzazione del rischio (Risk Characterization).
Per avere un quadro di riferimento che consenta di comprendere quale ruolo è chiamato oggi a giocare il veterinario ispettore
nel controllo degli alimenti di origine animale in una società economicamente sviluppata, può essere utile esaminare la
situazione dell’Unione Europea. Lo stato attuale è in fase di evoluzione perché una serie di nuove norme sono state adottate
di recente o sono in via di adozione, in applicazione di quanto previsto nel Libro bianco sulla sicurezza alimentare elaborato
dalla Commissione dell’UE nel 1999 e pubblicato nel 2000.
Nel nuovo sistema di sicurezza alimentare, al veterinario ispettore è attribuito un ruolo ben preciso e specifico nel controllo
delle carni fresche prodotte negli stabilimenti di macellazione o lavorate nei laboratori di sezionamento.
Nello stabilimento di macellazione, il cardine del controllo sanitario è rappresentato dall’ispezione degli animali in vita
(ispezione ante mortem) e dall’ispezione delle carni (ispezione post mortem).
L’ispezione ante mortem deve permettere di:
a) identificare gli animali destinati alla macellazione ed accertare se siano state rispettate le norme relative alla loro
identificazione,
b) verificare se il benessere degli animali è stato compromesso durante le fasi di carico e scarico o durante il trasporto,
c) valutare lo stato di pulizia/sporcizia della pelle o del vello per adottare le misure eventualmente necessarie a ridurre al
minimo il rischio di contaminazione delle carni durante la macellazione e la lavorazione,
d) accertare se gli animali presentino sintomi chiari o sospetti di una zoonosi o di una malattia trasmissibile agli altri
animali o segni che facciano sospettare la presenza di residui di sostanze chimiche in eccesso o non consentite.
E’ importante sottolineare la responsabilità che viene attribuita al veterinario ispettore nel controllare e garantire il rispetto
del benessere animale in questa delicatissima fase della filiera produttiva, in cui l’animale viene inevitabilmente sottoposto a
numerosi stimoli stressanti durante le operazioni di avvio al macello e poi nel corso dello stordimento e della macellazione.
Le conseguenze di questi stress possono ripercuotersi negativamente sia sulla sanità delle carni (es. rischio di batteriemia) e
sia sulla loro qualità (es. carni DFD e PSE).
Per alcune specie animali, allevate in condizione ben controllate, è previsto che parte dell’ispezione ante mortem possa
essere effettuata presso l’allevamento (suini, volatili, conigli). In tal caso l’ispezione presso lo stabilimento di macellazione
viene effettuata in modo semplificato.
E’ evidente che in tutto questo si attribuisce grandissima importanza all’efficienza dei sistemi d’identificazione degli animali
(tracciabilità) e di raccolta-trasmissione delle informazioni.
L’ispezione post mortem deve essere effettuata secondo procedure ben precise per ciascuna specie animale. Per tutte le
specie è previsto che le carcasse e le principali frattaglie siano sottoposte ad esame visivo. Per i bovini (con alcune differenze
in rapporto all’età sopra o sotto le sei settimane) è anche obbligatorio procedere alla all’incisione di alcuni linfonodi ed
organi che rivestono particolare significato per la lotta ad alcune zoonosi. Per gli ovini e caprini l’ispezione è sostanzialmente
solo visiva e vengono previste eventuali incisioni solo in caso di necessità. Per i solipedi le incisioni previste si limitano ai
polmoni (se destinati al consumo umano) ed al cuore. La stessa procedura è prevista per i suini. Tuttavia, le nuove norme
proposte consentirebbero (con il parere positivo dell’autorità competente) di effettuare il solo esame visivo quando si
trattasse di suini da ingrasso allevati in condizioni controllate, all’interno di sistemi integrati di produzione che garantiscano
un efficiente flusso d’informazioni tra l’azienda di provenienza e lo stabilimento di macellazione. Per i volatili ed i conigli
è prevista l’ispezione di un campione rappresentativo di esemplari. Alla selvaggina allevata si applicano le procedure delle
specie domestiche corrispondenti. Ovviamente, il veterinario può ricorrere, quando lo ritenga necessario, al prelievo di
campioni da sottoporre a particolari esami di laboratorio.
Nell’evoluzione della normativa dell’ UE, l’ispezione ante mortem ha assunto sempre più il significato di un controllo
integrato con i controlli effettuati presso l’allevamento (Severini et al., 1995). Nelle nuove proposte viene ulteriormente
sottolineata l’importanza determinante delle informazioni raccolte presso l’azienda di provenienza degli animali, della loro
corretta trasmissione al gestore dello stabilimento di macellazione e della loro acquisizione da parte del veterinario ispettore.
Quest’ultimo, poi, ha la possibilità di decidere ed organizzare gli interventi in sede d’ ispezione post mortem fino al punto,
per alcune specie animali, di effettuare un’ispezione semplificata e ridotta al solo esame visivo. In tal modo, verrebbero
eliminate manualità non indispensabili (ad esempio l’incisione di linfonodi ed organi), che addirittura potrebbero provocare
contaminazioni crociate. Questa integrazione delle attività ispettive con le informazioni che provengono dall’allevamento
rappresenta un chiaro esempio di controllo integrato di filiera. Inoltre, i risultati delle verifiche e dei controlli eseguiti dal
veterinario presso lo stabilimento di macellazione esitano nella bollatura delle carni che rappresenta la certificazione di una
garanzia relativa a questa specifica fase di produzione. Tale garanzia costituirà il presupposto per la gestione dei controlli
nelle fasi successive di lavorazione, di un’eventuale trasformazione e di commercializzazione. Nello stesso tempo, queste
informazioni vengono inserite in apposite banche dati e possono essere utilizzate sia per la programmazione generale degli
interventi sanitari sugli alimenti e sia per agire sulle fasi precedenti, che riguardano l’allevamento degli animali.
Tutto ciò si inserisce pienamente nel quadro dell’analisi del rischio come strumento per impostare la scelta e la gestione
delle politiche di sicurezza alimentare. L’intervento del veterinario ispettore nello stabilimento di macellazione deve, infatti,
essere concepito anche all’interno di specifici obiettivi sanitari decisi a livello nazionale e comunitario (es; lotta a determinate
zoonosi o malattie degli animali, controllo di specifici contaminanti chimici).
La garanzia della sanità delle carni viene fornita dal veterinario ispettore non solo sulla base delle informazioni ricevute
dall’allevamento e dei risultati delle attività ispettive (ante e post mortem) svolte, ma anche in conseguenza dei seguenti
principali elementi:
a) le carni sono state prodotte in stabilimenti autorizzati, che rispondono a criteri costruttivi precisi e tali da offrire
sufficienti garanzie igieniche, presso i quali vengono messe in atto idonee misure per la lotta agli organismi infestanti,
b) la manutenzione e pulizia/disinfezione delle strutture e delle attrezzature è fatta in modo corretto,
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
19
c)
i processi di lavorazione rispondono alle fondamentali norme igieniche (BPI, buone prassi igieniche; BPL, buone
prassi di lavorazione),
d) l’igiene del personale è soddisfacente e gli operatori sono adeguatamente formati in rapporto alle loro specifiche
mansioni,
e) lo stabilimento adotta adeguati sistemi di controllo per garantire la sicurezza del prodotto, mediante l’applicazione del
sistema HACCP e l’attuazione di controlli previsti da specifiche norme (es. controllo microbiologico delle carcasse,
controllo microbiologico delle superfici).
Tutto questo viene garantito attraverso una costante attività di verifica effettuata dal veterinario mediante controllo della
documentazione,” audit” periodici ed eventuali accertamenti su campioni prelevati direttamente. A completamento ed
integrazione del sistema di garanzie, ci sono le informazioni derivanti dai piani nazionali di controllo dei residui, che
permettono di conoscere i livelli di rischio a cui sono eventualmente esposti gli animali in rapporto alla loro specie,
categoria, età, sesso ed all’ area di provenienza.
Per quanto riguarda altri alimenti primari, come i prodotti della pesca, il veterinario ispettore, in alcuni Paesi come l’Italia, è
chiamato sia ad esercitare un controllo diretto su un campione di prodotto (per stabilire l’assenza di patologie ed alterazioni
e lo stato di freschezza) e sia a prelevare campioni per specifici accertamenti (es. azoto basico volatile totale, livello di
istamina).
Per altri prodotti alimentari e per i prodotti trasformati, al veterinario (ma non solo a lui) viene richiesto un tipo di
interveto che sostanzialmente consiste nella supervisione e verifica delle condizioni e dei processi produttivi, nonché delle
misure messe in atto dal produttore per garantire la sicurezza del prodotto, secondo quanto sopra esposto per le carni.
Infatti, è al produttore che viene attribuita la responsabilità primaria di assicurare la sanità dell’alimento. Il sistema di
tracciabilità/rintracciabilità del prodotto lungo tutta la filiera costituisce l’asse portante di questo controllo integrato di
filiera “dal produttore al consumatore”. E’ quindi indispensabile che questo sistema sia concepito ed applicato in modo
efficace, specialmente in un contesto in cui le filiere dei prodotti alimentari sono talvolta molto complesse, articolate e
coinvolgono più Paesi, con sistemi sanitari e di sicurezza alimentare diversi tra loro.
A proposito di quest’ultimo punto vorrei citare l’importantissima funzione svolta dal veterinario ispettore nel controllo
degli alimenti alla frontiera di accesso. Si tratta di un’attività che comporta sia la verifica della documentazione sanitaria
che accompagna le merci sia il controllo dei prodotti stessi, talvolta anche ricorrendo a prelievo di campioni per analisi di
laboratorio.
Desidero concludere questa sintetica esposizione sul ruolo del veterinario ispettore nel controllo degli alimenti di origine
animale, citando una frase contenuta nel capitolo 2 del Libro bianco sulla sicurezza alimentare dell’ UE in cui si afferma:
“Nel processo decisionale all’interno dell’UE si potrà inoltre tenere conto di altri fattori legittimamente pertinenti per
la protezione della salute dei consumatori e per la promozione di prassi eque nella commercializzazione dei prodotti
alimentari……..Esempi di questi altri fattori legittimamente pertinenti sono considerazioni ambientali, il benessere
animale, l’agricoltura sostenibile, le aspettative dei consumatori quanto alla qualità dei prodotti, un’adeguata informazione
e definizione delle caratteristiche essenziali dei prodotti nonché dei loro metodi di lavorazione e produzione”.
Bibliografia
Berends B.R., Snijders J.M.A. and van Logtestijn J.G. (1993). Efficacy of current EC meat inspection procedures and some proposed
revisions with respect to microbiological safety: a critical review. Veterinary Rec., 23, 411-415.
Buchanam R.L. (1998). Risk Assessment: a means for linking HACCP plans and public health. J. Food Prot., 61(11), 1531-1534.
Codex Alimentarius Commission (1995). Guidelines on the application of the principles of risk assessment and risk management to
food hygiene including strategies for their application, CX/FH 95/8.
Dolman C.E. (1957). The Epidemiology of meat-borne diseases. In: Meat Hygiene. FAO and WHO, Rome, Italy, pp. 11-108.
Hathaway S.C. and McKenzie A.I. (1989). Impact of ovine meat inspection system on processing and production costs. Veterinary Rec.,
124(8), 189-193.
Hood R.I. and Johansen H.H. (1957). Survey of meat-hygiene practices in Europe. FAO and WHO, Rome, Italy, pp. 311-339.
Severini M. (1985). Ipotesi di applicazione a livello di Centro carni delle informazioni raccolte in allevamento. Atti Giornate di Studio
sul Controllo degli Alimenti di Origine Animale, Perugia (Italia) 18-19 ottobre, pp. 25-33.
Severini M. e Romanelli V. (1980). Le contaminazioni chimiche degli alimenti di origine animale. Atti S.I.S.Vet., 34, 55-62.
Severini M., Julini M. e Facelli P. (1995). Attualità e prospettive dell’ispezione ante e post mortem presso gli stabilimenti di macellazione
della Unione Europea. Atti V Convegno Nazionale A.I.V.I., Veronafiere (Italia) 19-20 maggio, pp. 7-22.
Snijders J.M.A.,Smeets J.F.M. Harbers A.H.M. and van Logtestijn J.G. (1989). The evolution of meat inspection of slaughter pigs.
Fleischwirtschaft, 69, 1422-1424.
ATTI
GIOVEDÌ 22 MAGGIO 2003
ABBANDONO E OMESSA CUSTODIA DEGLI ANIMALI IN UN ALLEVAMENTO
BOVINO IN SEGUITO A UN CASO DI POSITIVITÀ ALLA BSE: OSSERVAZIONI
LEGISLATIVE E IMPLICAZIONI DI RISCHIO ALIMENTARE
G. M. Cubeddu, C. Fois, G. Panichi, W. Pinna, G. Moniello, B. Riitano
EPIDEMIOLOGIA DELLA SCRAPIE: AGGIORNAMENTO
Bona M.C., Barizzone F., Ferrari A, Caramelli M, Ru G.
LE MALATTIE GENETICHE DEL VITELLO DI RAZZA BRUNA
Gentile A., Testoni S., Castagnaro M.
RILIEVI CLINICI ED ISTOPATOLOGICI SU TRE CASI DI ATASSIA
PROGRESSIVA DELLO CHAROLAIS.
Viglietti A., Carta P., Usai G., Montisci A., Ruiu A., Capitta P., Ligios C.
XI Congresso
Internazionale
della Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
21
ABANDONMENT AND OMISSION OF TENDING THE BOVINES AFTER
A POSITIVITY CASE OF B. S. E. INSIDE A FARM: LEGISLATIVE OBSERVATIONS
AND IMPLICATIONS OF SANITARY RISK
G. M. Cubeddu1, C. Fois2, G. Panichi2, W. Pinna3, G. Moniello3, B. Riitano 4
1
Istituto di Patologia Speciale e Clinica Medica Veterinaria
Università di Sassari, Via Vienna, 2 07100 Sassari, Italy
2
AUSL N. 5, Servizi Veterinari Area A e C, via Carducci, 35 - 09170 Oristano, Italy
3
Sezione di Produzioni Animali del Dipartimento di Biologia Animale, Università di Sassari, Via
Vienna, 2 - 07100 Sassari, Italy, E-mail: [email protected];
4
Avvocato, Patrocinante in Cassazione, via Romeo Romei, 19 - 00136 Roma, Italy
Abstract
The authors report the examination of rules and laws of veterinary and sanitary police concerning the excursus of the first
case of BSE, which was verified in Sardinia (Italy) and was followed by the sequestration of the animals. The objective
responsibilities of the animals’ owners are underlined, considering the penal consequences, which derive from the
application of the article 672 of the Italian Penal Code. Considering the rules concerning the crime of omission to take
care and mismanagement of the animals, the law dictate of the same article (672) of the Penal Code is evaluated and the
observations are extended to some recent decisions of the Penal Court of Cassation. A critical review of concept of the
animals’ dangerousness is done, according both with the provisions of the articles 627 of the Penal Code and 2052 of the
Civil Code, which provide about damages caused by animals. The modern rules of animals’ welfare and protection applied
in the specific case are discussed. The unsuitability of an appeal of the animals’ owners to the Regional Administrative
Court is discussed, considering the danger for the animals and public sanity. Aiming to find a better application of the
rules and to stem the sanitary risks in similar episodes, the authors make and discuss some proposals.
ABBANDONO E OMESSA CUSTODIA DEGLI ANIMALI IN UN ALLEVAMENTO BOVINO
IN SEGUITO A UN CASO DI POSITIVITÀ ALLA BSE: OSSERVAZIONI LEGISLATIVE E
IMPLICAZIONI DI RISCHIO ALIMENTARE
G. M. Cubeddu1, C. Fois2, G. Panichi2, W. Pinna3, G. Moniello3, B. Riitano 4
1
Istituto di Patologia Speciale e Clinica Medica Veterinaria
Università di Sassari, Via Vienna, 2 07100 Sassari, Italy
2
AUSL N. 5, Servizi Veterinari Area A e C, via Carducci, 35 - 09170 Oristano, Italy
3
Sezione di Produzioni Animali del Dipartimento di Biologia Animale, Università di Sassari, Via
Vienna, 2 - 07100 Sassari, Italy, E-mail: [email protected];
4
Avvocato, Patrocinante in Cassazione, via Romeo Romei, 19 - 00136 Roma, Italy
Riassunto
Gli autori effettuano una disamina giuridico-normativa e di polizia veterinaria, a seguito dell’abbandono di bovini
sottoposti a sequestro, dopo la denuncia del primo caso di positività alla BSE in Sardegna. Vengono poste in risalto le
responsabilità oggettive, dei proprietari e del sindaco che si sostituisce al proprietario in applicazione del DPR 31 marzo
1979, considerando le possibili conseguenze penali derivanti dall’applicazione interpretativa dell’art. 672 del Codice Penale.
Alla luce delle disposizioni previste dal reato di omessa custodia e malgoverno di animali si valuta il dettato normativo
previsto dallo stesso articolo, estendendo le osservazioni ad alcune recenti sentenze della Cassazione Penale. Gli autori
passano quindi in rassegna critica: il concetto di pericolosità degli animali, accorpando alle disposizioni previste dall’art.
672 anche le norme dettate dall’art. 2052 del Codice Civile, che dispongono sui danni cagionati dagli animali; le moderne
regole di benessere e protezione animale applicate all’episodio descritto; l’inadeguatezza della possibilità di inoltrare un
ricorso al TAR da parte dei proprietari a fronte della necessità di prevenzione del rischio alimentare per gli animali e per
l’uomo
Introduzione
L’obiettivo della presente ricerca è quello di fare il punto dell’attuale legislazione italiana in riferimento all’ipotesi di
reato prevista dall’art. 672 (attualmente depenalizzato ai sensi dell’art. 33 lettera A della Legge 689/81) del Codice Penale
Italiano, ma anche, e soprattutto, in relazione alla disciplina conseguente alla omessa custodia e malgoverno di animali,
dopo l’abbandono dei bovini da parte del proprietario, a seguito di un caso di positività alla BSE. In prosecuzione di una
precedente nota (11), si riprende e integra la discussione sulle possibili modalità di attuazione delle normative che regolano
la materia, alla luce degli ultimi avvenimenti, e soprattutto del ricorso pendente al TAR della Sardegna, il quale si deve a
tutt’oggi pronunciare sul merito.
Materiale e metodi
Come dettagliatamente espresso nel precedente lavoro (11), in un allevamento di bovini ad alta produzione lattea in
provincia di Oristano in Sardegna, nel mese di ottobre 2001 veniva evidenziato in una bovina regolarmente macellata
un caso di non negatività alla BSE; il servizio veterinario della competente AUSL adottava le misure previste dalle norme
vigenti in campo comunitario, nazionale e regionale (10,13,14). Una volta avvenuta la conferma di positività alla malattia,
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
23
ufficializzata il 31/10/2001 da parte del Centro di Referenza Nazionale sulle Encefalopatie Spongiformi degli animali
di Torino, gli organismi competenti, anche per interpretare al meglio le legittime esigenze del proprietario, decidevano
per un abbattimento selettivo degli animali facenti parte della “Coorte”. Nonostante la proposta atta a limitare i danni
derivanti dall’abbattimento, il proprietario degli animali, dopo una serie di lunghe ed estenuanti trattative tendenti a non
far abbattere i bovini, abbandonava l’allevamento, ritenendosi esonerato da qualsiasi responsabilità e contemporaneamente
inoltrava ricorso al TAR regionale. Il sindaco del comune interessato, a seguito di ciò, emetteva con apposita ordinanza
un provvedimento di custodia cautelare affidando la gestione degli animali ad altri allevatori. Successivamente al
provvedimento, tramite azione congiunta lo stesso primo cittadino e l’AUSL competente
adivano le vie legali nei
confronti del proprietario.
Risultati
L’istanza avverso il provvedimento di abbattimento dei bovini, datata aprile 2002, per l’annullamento, previa sospensione
dell’esecuzione, veniva respinta in data 3/7/2002 dal TAR della Sardegna con la dicitura: “omissis…respinge la su indicata
domanda incidentale di sospensione”. A tutt’oggi il TAR non ha espresso alcun giudizio sul merito.
Si ritiene opportuno sottolineare che, dal momento in cui il proprietario ha lasciato l’allevamento, il sindaco, sulla base
delle disposizioni dettate dal D.P.R 31 marzo 1979 (8) che decreta la perdita di personalità giuridica da parte dell’ENPA,
e attribuisce ai comuni le funzioni prima affidate al suddetto ENPA, ha esercitato a tutti gli effetti la funzione vicariante,
con l’ausilio di altri allevatori e della stessa AUSL. A fronte delle denunce presentate, il sindaco aveva emanato disposizioni
che ponevano, con diritto di rivalsa, tutte le spese sostenute a carico del proprietario. Nonostante questa controversia
giuridico-burocratica, i bovini della “coorte” venivano regolarmente abbattuti mentre il latte prodotto in azienda veniva
regolarmente ritirato dal circuito alimentare e sottoposto a stoccaggio a parte. Una volta eseguito l’abbattimento dei
bovini, il proprietario si ripresentava in azienda, riprendendo la sua attività come se nulla, nel frattempo, fosse accaduto.
Non solo, immediatamente dopo la ripresa di possesso della stalla, inoltrava domanda di rimborso alla Regione, secondo
le disposizioni vigenti. La stessa Regione sospendeva il ristoro economico in presenza di un ricorso pendente alla Procura
della Repubblica da parte dell’AUSL. Qualche tempo dopo il Pubblico Ministero poneva momentaneamente termine alla
controversia con motivazione: “il fatto non sussiste”.
Osservazioni personali
La disamina degli avvenimenti offre l’opportunità di fare ulteriori osservazioni critiche nei confronti di questa fattispecie
giuridica. Le ipotesi conseguenti all’iter prospettatosi a seguito dei provvedimenti emanati dall’autorità amministrativa
e da parte del servizio veterinario della competente AUSL, favoriscono l’approfondimento sulla mancata applicazione,
da parte del P.M., dell’ipotesi del reato previsto dall’art. 672 del C.P. Essendo ben noti le procedure, le formalità, i
controlli, le analisi, approfondite e dettagliate previste dalla normativa europea in ordine alla prevenzione, al controllo e all’
eradicazione delle encefalopatie spongiformi, il quesito che si pone è se l’applicazione dell’art. 672 C.P.(indipendentemente
dalla questione se l’ipotesi ivi prevista sia da considerarsi di natura penale o amministrativa) sia idonea e sufficiente a
tutelare le implicazioni di rischio alimentare. E’ agevole rilevare che la norma dell’art. 672 del C.P. è inserita nel nostro
ordinamento giuridico penale tra le contravvenzioni di polizia e in particolare tra quelle concernenti l’incolumità pubblica e
ancora più dettagliatamente tra le contravvenzioni concernenti l’incolumità delle persone nei luoghi di pubblico transito o
nelle abitazioni. Il soggetto attivo di quella previsione è “chiunque lascia liberi o non custoditi con le debite cautele animali
pericolosi da lui posseduti o ne affida la custodia a persona inesperta, nonché chi in luoghi aperti abbandoni a se stessi
animali da tiro, da soma o da corsa o li lascia comunque senza custodia anche se non siano disciolti o li attacca o conduce
in modo da esporre a pericolo l’incolumità pubblica, nonché chi aizza o spaventa animali in modo da mettere in pericolo
l’incolumità delle persone”. Approfondita quindi la portata nonché i destinatari del precetto della norma richiamata, non
può non escludersi con certezza che la suddetta previsione legislativa sia applicabile all’ipotesi di abbandono e omessa
custodia di animali in allevamento bovino a seguito di positività alla BSE.
La giurisprudenza farebbe capire che la pericolosità sia esclusivamente in rapporto all’incolumità pubblica. Ma alla
luce di alcune sentenze ultime (Cassazione Penale sez. VI 10/10/90) la pericolosità si può ricondurre alla possibilità di
arrecare danni al patrimonio zootecnico e alla salute pubblica. Pertanto l’abbandono e l’omessa custodia degli animali
oggetto della presente disamina, potrebbero rientrare nella previsione di cui all’art. 500 del C.P., che tutela i delitti contro
l’economia pubblica e in particolare disciplina la diffusione, anche per colpa, di una malattia agli animali pericolosa per
l’economia ovvero per il patrimonio zootecnico. Ma tale ipotesi delittuosa sembra carente nella previsione del fatto rispetto
a quanto oggetto del nostro esame; infatti il dettato dell’art. 500 del C.P. disquisisce in merito soprattutto a diffusione di
malattie infettive, non rientrando peraltro la BSE in questa fattispecie, potendola annoverare tra le cosiddette patologie
“condizionate”. Si deve in proposito rilevare che il proprietario degli animali che, a seguito di sequestro dell’autorità
amministrativa, abbia abbandonato e/o omesso la custodia degli animali dell’allevamento, non può essere incriminato
sulla base della norma citata. Infatti, essendovi un provvedimento cautelare, necessariamente deve essere nominato anche
un custode e l’accettazione della custodia non è obbligatoria e comunque non accettabile e rinunziabile in qualsiasi
momento.
Ecco perché la misura cautelare è prevista e viene eseguita soltanto in determinati tassativi casi e soggetta ad una
particolare disciplina ed a precise responsabilità sia dell’organo imponente la misura cautelare stessa sia dall’esecutore della
medesima.
Conclusioni
L’evolversi degli avvenimenti descritti ribadisce, sotto molti aspetti, quanto affermato nella precedente nota in ordine alle
difficoltà interpretative nell’applicazione delle norme.
La non sussistenza del fatto (come da sentenza del P.M.) libera il proprietario dalla responsabilità oggettiva e anche dalla
24
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
conseguente eventuale ipotesi di reato previsto dall’art. 2052 del C.C. (danno cagionato da animali). Inoltre, le misure per
eventuali responsabilità e irregolarità nella fattispecie potrebbero essere applicate invece nei confronti del sindaco il quale,
a tutti gli effetti si è dovuto, ai sensi di legge, sostituire al proprietario.
Bisogna, allo stato attuale, necessariamente attendere la sentenza in merito del TAR per poter valutare con certezza
chi dovrà pagare le spese sostenute per la gestione e custodia degli animali durante il periodo dell’abbandono da parte del
proprietario. Nondimeno si ritiene opportuno porre in rilievo come l’uso del ricorso al TAR potrebbe creare un pericoloso
precedente, capace a sua volta di innescare, in caso di conferma di positività alla BSE in altri allevamenti, o in occasione
di altre misure restrittive dettate dal Regolamento di Polizia Veterinaria, un percorso giudiziario di non facile risoluzione.
Pertanto emerge a tutt’oggi l’esigenza primaria di fare chiarezza su queste incertezze interpretative. Purtroppo un primo
approccio con le più recenti disposizioni in materia sembra confermare la non rispondenza alle esigenze richieste.
Si ritiene, per concludere, che il tema vada ulteriormente studiato ai fini dell’individuazione di adeguate misure
legislative, soprattutto di efficacia propositiva in sede internazionale alla luce della legislazione comparata dei Paesi
dell’Unione Europea. E’auspicabile, infine, l’emanazione di norme facilmente applicabili alla fattispecie in oggetto in grado
di evitare equivoci e incertezze giuridico-amministrative che possono recare ulteriori danni al comparto zootecnico.
Bibliografia
1) BENAZZI P.. (1994)- Il regolamento di polizia veterinaria, Società Editrice Esculapio (BO).
2) Cassazione Penale sez. VI 10/10/1990
3) Cassazione Penale sez. III 22/10/1992
4) CINOTTI S., PECCOLO G. (1997) - Protezione animale, UTET
5) Codice Penale - art. 500, art. 672, art.727
6) Codice Civile - Libro IV delle obbligazioni
7) D.L. 26 marzo 2001, n. 146 – Attuazione della Direttiva 98/58/CE relativa alla
protezione degli animali negli allevamenti
8) D.P.R 31 marzo 1979
9) KREYSA J., (2000) – Geographical risk of bovine spongiform encephalopathy
(GBR), Proceedings of the 6th Internationale Feed Production Conference, Piacenza
27-28 Novembre 2000, 106-121
10) Legge 25/07/2001 n. 305
11) MONIELLO G. , CUBEDDU G. , FOIS C. , XIMENES L. A., PINNA W.
Implications of feeding hygiene and animal welfare following untended bovines after
a positive case of BSE. Atti X Fe.Me.S.P.Rum., Tunis (Tunisie) 22-24 sett 2002
12) PEZZA F. (1997) - Diritto e legislazione veterinaria, UTET
13) Regolamento CE n.999/2001 del 22/05/2001
14) Regolamento CE n. 1326/2001 del 29/06/2001
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
25
EPIDEMIOLOGIA DELLA SCRAPIE: AGGIORNAMENTO
Bona M.C., Barizzone F., Ferrari A, Caramelli M, Ru G.
Introduzione
Negli anni recenti l’attenzione nei confronti delle TSE dei piccoli ruminanti da parte dell’Unione Europea ha assunto
maggior rilevanza, legata alle conseguenze di tipo economico e all’allarme evocato dalla potenziale diffusione della BSE
nelle popolazioni ovicaprine.
Lo Scientific Steering Committee (SSC) della Commissione Europea ritiene infatti che anche le popolazioni ovi-caprine del
nostro continente siano state esposte ad alimenti potenzialmente con+taminati e quindi esista la possibilità di circolazione
dell’agente della BSE tra le nostre greggi.
Studi sperimentali hanno inoltre dimostrato che ovini alimentati con materiale bovino infetto sviluppano la BSE, con
sintomi e lesioni indistinguibili dalla scrapie. Inoltre la BSE nell’ovino si comporterebbe come la scrapie, da un lato
coinvolgendo in maggior misura l’organismo, a partire dal sistema linfatico, e dall’altro potendo trasmettersi sia per via
orizzontale che per via verticale.
In Italia, la malattia è stata segnalata per la prima volta nel 1976 in Piemonte (Cravero et al., 1977) e sino al 1990 si sono
avuti 25 focolai, che hanno coinvolto all’incirca 50 animali. Nel 1991 la scrapie è stata inserita tra le malattie soggette a
denuncia obbligatoria (O.M. 10.05.1991), ed il primo focolaio è stato denunciato nel 1995.
Con il presente lavoro si intende fornire un aggiornamento sulle attività di sorveglianza epidemiologica della scrapie in Europa e
più specificatamente in Italia, descrivendo inoltre l’impatto che ha avuto l’Introduzione nel 2002 della sorveglianza attiva.
Infatti, con il Regolamento 999/2001/CE e successive modifiche, a partire dal 1 gennaio 2002 in tutti i paesi dell’ UE alla
sorveglianza passiva, basata su sistemi di segnalazione obbligatoria dei casi di malattia è stato affiancato un programma
di sorveglianza attiva. Tale programma basato sull’utilizzo dei test rapidi su un campione ampio e rappresentativo della
popolazione ovi-caprina di età superiore ai 18 mesi, appartenente alle categorie trovati morti e regolarmente macellati.
Il citato Reg. 999/2001/CE e la sua successiva modifica, Reg. 270/2002/CE, hanno inoltre introdotto l’analisi genetica
nell’ambito della sorveglianza della scrapie, poiché gli studi sinora effettuati indicano che il gene che codifica per la PrP presenta
vari polimorfismi in grado di influenzare la resistenza o meno alla scrapie negli ovini (Hunter et al,1994, Elsen et al, 2002).
Materiali e metodi
Il Centro di Referenza ha curato raccolta, verifica, elaborazione ed interpretazione dei dati nazionali. Il periodo considerato
è compreso tra il 1995, anno a cui risale il primo caso ufficialmente segnalato, dopo anni di apparente assenza della
malattia, e il 2002.
Per caratterizzare l’epidemiologia descrittiva della malattia sono stati utilizzati tassi grezzi di prevalenza e incidenza. La
maggior probabilità di identificare casi di malattia tra i trovati morti rispetto ai regolarmente macellati è stata calcolata in
termini di rapporto di prevalenza e relativo intervallo di confidenza al 95%, utilizzando Stata 8. La diffusione della malattia
è stata descritta dal punto di vista geografico e di andamento temporale. Infine la situazione italiana è stata confrontata con
i dati ufficiali europei reperibili dal sito Internet della Commissione Europea.
Risultati
Nei paesi dell’Unione Europea, nel corso del 2002, con la sorveglianza attiva sono stati testati 363.603 ovi-caprini di cui
438 sono risultati positivi (prevalenza di 12,0 casi per 10.000 test). Tra gli animali regolarmente macellati la prevalenza è
stata pari a 7,4, mentre tra i morti o abbattuti è risultata pari a 26,6, con una probabilità quindi di trovare un positivo nella
categoria degli animali morti 3,6 volte più grande rispetto alla probabilità di trovarlo tra i regolarmente macellati.
Con la sorveglianza passiva, sempre nel corso del 2002, sono stati testati 2.836 ovi-caprini di cui 663 sono risultati positivi;
la prevalenza è risultata del 23,4%. Escludendo i dati riferiti alla Germania che ha dichiarato un numero inspiegabilmente
elevato di sospetti (ben 1.707), la maggior parte dei quali sono poi risultati negativi, la prevalenza sale al 58,4%.
In Italia, grazie alla sola sorveglianza passiva tra il 1995 e il 2001 sono stati identificati 72 focolai con una media di 10-15
allevamenti coinvolti
��� � ogni anno (fig. 1 e fig. 2).
Fig 1
������������� ���������� ��� ������� ��
������� ��� ������� ���������
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
��
�
�
�
�
�
�
�
� �
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
��
�
��
�
�
�
�
�
�
��
��� �������
������� �������
���������
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
� �
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
Popolazione ovicaprina adulta
( milioni):
- ovini
8.22
- caprini
1.15
�
�
�
�
�
�
�
�
�
��
�
�
�
�
�
�
�
�
�
N° allevamenti: 129.150
26
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
��� �
��������� ��������� ��� �������
ANDAMENTO TEMPORALE DEI FOCOLAI
Fig 2
��
��
��
��
������
�������
��
��
��
��
��
��
��
�
��
�
�
�
����
����
�
�
����
����
����
����
����
����
����
Nell’ambito della sorveglianza passiva si osserva un picco nel 1997, poi negli anni successivi l’andamento è pressoché stabile.
Nel corso del 2002 il numero di focolai è risultato pari a 36 di cui 28 derivati da sorveglianza attiva e 8 da sorveglianza passiva.
La sorveglianza attiva ha interessato 27.723 animali (fig. 3), di cui 57 sono risultati positivi (33 appartenenti alla categoria
regolarmente macellati e 24 appartenenti alla categoria trovati morti); inoltre sono stati testati 1.251 animali abbattuti in sede di
focolaio e tra essi 60 sono risultati positivi (4,8%). Rispetto al numero di campioni richiesto all’Italia dall’UE è stato raggiunto
il 58,2% dei test nella categoria degli animali morti (3.492/6.000) e il 40,4% dei test nella categoria degli animali regolarmente
macellati ( 24.231/60.000).
Considerando la sola sorveglianza attiva, la prevalenza grezza è risultata pari a 20,6 casi per 10.000 test. Ai fini del calcolo della
prevalenza nelle singole categorie sono stati esclusi i campioni non idonei all’esecuzione del test rapido; ne deriva che la prevalenza
��� all’interno
�
della categoria regolarmente macellati è risultata essere di 13,7 per 10.000 test (33 positivi/24.155 testati), mentre nella
categoria trovati morti è risultata essere di 69,6 per 10.000 test (24 positivi/3.448 testati). La probabilità di trovare un positivo tra
CURVA EPIDEMICA NEL 2002
gli animali morti è circa 5 volte più grande che tra gli animali regolarmente macellati (5,1 con IC 95% 2,9-8,9).
�
�����
�
�����
�
�����
��������������
�
����
�
�
����
�
�
�
�
�
�
�
�
�
�
�
���
����
�
�
�
���
���
���
�� ���� �������
���
���
���
���
���
�� ���� ��������
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
��� �
����
�
���������� ������� ���������� �����
CURVA EPIDEMICA NEL 2002
Fig 3
����
���
���
���
���������� ������� ����� �� ���� �������
27
�
�
�
�
�
�
�
�
����
�
�
���
����
�
����
�
�
�
���
���
���
���
���
���
���
���
����
���
���
���
Il numero di regioni coinvolte è andato via via aumentando nel corso degli anni: l’incidenza cumulativa di allevamenti
�� ���� �������
�� ���� ��������
���������� ������� ����� �� ���� �������
colpiti per regione indica
nella Toscana e nell’Emilia
le regioni più
interessate; nel corso dell’ultimo anno sono state
coinvolte tre nuove regioni: Veneto, Calabria e Molise( fig 4).
Focolai: diffusione per regione e incidenza cumulativa ( 1995 – 2002)
Fig ���
4 �
Focolai: diffusione per regione e
incidenza cumulativa ( 1995 – 2002)
��������� ����������
��������������� ������������
���
�������
�������
������
�����
���
�� �������
���
���
���
���
���
���
���
Delle 13 segnalazioni di sospetto clinico di scrapie eseguite nel corso del 2002, 8 hanno dato origine ad altrettanti focolai
di malattia mentre 5 non sono state confermate dal punto di vista diagnostico.
Nel corso degli anni la malattia ha interessato prevalentemente la specie ovina (90 focolai su 108) anche se nel nostro paese
il coinvolgimento della specie caprina risulta importante (fig 5).
��� �
Fig 5
Complessivamente la sorveglianza attiva ha coinvolto 8.767 aziende (fig 6) in cui è stato testato almeno un capo e tra le
quali sono stati individuati i 28 focolai (prevalenza di aziende infette pari a 0,3% con IC 0,2-0,5). Considerando solo il
sottoinsieme di aziende in cui sono stati testati almeno 20 capi ( N = 185), la prevalenza sale al 5,4% ( IC 2,6-9,7).
��� �
28
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
������������ ������� ���������� � ������� ��
Fig 6
��� �
������������ ������� ���������� � ������� ��
�����������
������� ������� ������� �������
��� ��������
������ � �
����� ��� ��� ��
�����
��
���
����� ����
������ �� ��
���
��
���
����� ����
������ �� ���
���
��
���
����� ����
������ �� ����
���
��
���
����� ����
���������� ��������� ��� �� ����
�����
�����
������
�������
Nel nostro paese è stato determinato il genotipo della proteina prionica su 127 ovini risultati positivi alla scrapie; tutti gli
animali hanno presentato genotipi ritenuti suscettibili alla malattia e in particolare 98 sono risultati con genotipo ARQ/
ARQ, 28 con genotipo ARQ/AHQ ed 1 con genotipo ARQ/VRQ.
Infine il numero complessivo di capi coinvolti dalle procedure di abbattimento totale in Italia, come previsto dalla normativa
(D.M. 8 aprile 1999, Norme per la profilassi della scrapie negli allevamenti ovini e caprini), ammonta per il periodo 19952002 a circa 45 mila animali.
Discussione
Dai risultati sino ad ora a disposizione la scrapie appare ampiamente diffusa in tutto il territorio italiano, pur con prevalenze
regionali piuttosto basse.
Il picco di casi identificati nel 1997 è presumibilmente da mettere in relazione ad una possibile diffusione iatrogena della
malattia, legata all’utilizzo di un vaccino per l’agalassia contagiosa probabilmente contaminato con l’agente della scrapie (
Agrimi et al. ,1999; Caramelli et al., 2001).
I dati nazionali relativi al 2002 evidenziano come con l’avvio della sorveglianza attiva il numero dei focolai sia più che
raddoppiato, a riprova che la sola sorveglianza passiva è inefficace nel rilevare l’effettiva presenza della malattia.
Nell’ambito della sorveglianza attiva la prevalenza più elevata tra gli animali appartenenti alla categoria trovati morti rispetto ai regolarmente
macellati sottolinea l’importanza di porre l’attenzione sugli animali morti che rappresentano la categoria più a rischio.
L’incidenza intra-allevamento della scrapie è relativamente bassa (Young et al., 1964; Palsson, 1979; Ligios et al, 2003); i
risultati qui presentati dimostrano che testando più animali per allevamento, aumenta la probabilità di svelare la presenza
della malattia e quindi il dato di prevalenza. Ciò suggerisce che il numero delle greggi colpite dalla scrapie potrebbe essere
più elevato con una conseguente sottostima della situazione reale.
Nonostante l’Unione Europea classifichi i genotipi ARQ/ARQ e ARQ/AHQ come poco resistenti alla scrapie, i risultati ottenuti
mostrano che nella popolazione ovina italiana entrambi i genotipi hanno un elevato grado di suscettibilità alla malattia. In
particolare per il genotipo ARQ/AHQ negli altri stati membri non si osservano frequenze di animali positivi così elevate come in
Italia (European Commission Health & Consumer Protection Directorate-General. June 2003 Report on the monitoring and
testing of ruminants for the presence of trasmissible spongiform encephalopathy (TSE) in 2002).
In conclusione i dati derivanti dalla sorveglianza attiva hanno sottolineato l’importanza che la scrapie ha assunto in Italia.
L’andamento della situazione epidemiologica dovrà essere quindi monitorato nel tempo, puntando soprattutto su una
sorveglianza epidemiologica mirata alle categorie a rischio e approfondendo lo studio delle caratteristiche che la malattia
assume nel nostro Paese.
L’attivazione di strategie fondate sulla genetica, recentemente inserite nella normativa comunitaria, contribuirà probabilmente
ad arginare i problemi seri che la scrapie crea al comparto zootecnico ovicaprino.
Bibliografia
-
Agrimi U., Ru G., Cardone F., Pocchiari M., Caramelli M.(1999) Epidemic of transmissible spongiform encephalopaty in sheep
and goats in Italy. The Lancet, 353, 560-561.
Caramelli M., Ru G., Casalone C., Bozzetta E., Acutis PL., Calella A., Forloni G. (2001): Evidence for the transmission of scrapie
to sheep and goats from a vaccine against Mycoplasma agalactiae . The Veterinary Record, 148, 531-536
Cravero G., Guarda F., Dotta U., Guglielmino R. (1977) La scrapie in pecore di razza biellese. Prima segnalazione in Italia. La
Clinica veterinaria 100, 1-14.
Elsen JM., Barillet F., François D., Bouix J., Bibé B., Palhière I., (2002) Génétique de la sensibilité à la tremblante des ovins.
BullGTV 13, 123-128.
European Commission Health & Consumer Protection Directorate-General.( June 2003) Report on the monitoring and testing
of ruminants for the presence of transmissible spongiform encephalopathy (TSE) in 2002.
Hunter N., Goldmann W., Smith G., Hope J. (1994) The association of codon 136 PrP gene variant with the occurrence of natural
scrapie. Archives of Virology 137, 171-177.
Ligios C., Bona M.C., Vodret B., Ruiu A., Ardu M., Depalmas S., Ru G. (2003) Epidemiologia descrittiva della scrapie in Sardegna.
ODV 24(1), 11-16.
Palson, P A.(1979) Rida (scrapie) in Iceland and its epidemiology. In slow transmissible diseases of nervous system. Vol I (S.B.
Prusiner & W.J. Hadlow, eds). Academic Press, New York, 257-366.
Young G. B., Scamp J., Renwick C. C., Dickinson A. G., (1966) Field observation of scrapie incidence. In Report of scrapie seminar,
Washington D.C.,27-30 January 1964. Agricultural Research Service (ARS) United States Department of Agriculture (USDA), 199-
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
29
GENETIC DISEASES OF THE BROWN CALVES
Gentile A., Testoni S. (*), Castagnaro M (**)
Veterinary Clinical Department - Bologna - Italy
(*) Department of Veterinary Clinical Science – Padua - Italy
(**) Department of Public Health, Comparative Pathology and Veterinary Hygiene – Padua - Italy
The Authors describe the clinical findings and the pathological features of the most important genetic diseases typical in
Brown calves, and namely: Spinal Muscular Atrophy, Spinal Dysmyelination, Congenital Myopathy and Arachnomelia.
In the context of a research project on calf neurodegenerative diseases carried out by the Institutions mentioned in the title
in collaboration with ANARB (Italian Brown Cattle Breeders’ Association) and financed by the University of Bologna, the
authors are carring out a surveillance plan for the genetic diseases in Brown cattle, mainly but not exclusively affecting the
nervous system.
The purpose of this presentation is to awaken the veterinarians to the importance of inviting the Brown farmers to report
any abnormal birth or unusual disease in young calves that occurs in their herds.
At present the availability of genetic tests for detecting the carriers is restricted to Spinal Muscular Atrophy and partially
to Spinal Dysmyelination; for the other diseases only the report of affected animals, and therefore the emerging of clinical
cases, can allow a retrospective identification of carrier animals.
LE MALATTIE GENETICHE DEL VITELLO DI RAZZA BRUNA
Gli Autori descrivono le caratteristiche cliniche e morfologiche delle più importanti malattie genetiche del vitello di
razza Bruna, e precisamente dell’Atrofia Muscolo Spinale, della Dismielogenesi Spinale, della Miopatia Congenita e
dell’Aracnomelia.
L’interesse degli Autori nei confronti di queste malattie è inserito in un progetto di ricerca sulle malattie neurodegenerative
del vitello svolto in collaborazione con l’Associazione Nazionale Allevatori Razza Bruna (ANARB).
Con la nota s’intende sottolineare l’opportunità, da parte dei veterinari operanti sul campo, di sollecitare gli allevatori di
razza Bruna a riferire qualsiasi caso di vitello malformato o di patologie neonatali inusuali. Poiché prove di tipo genetico
sono disponibili esclusivamente per l’Atrofia Muscolo Spinale, solo la pronta segnalazione di tali evenienze patologiche può
consentire, in maniera retrospettiva, l’individuazione dei potenziali portatori.
Gentile Arcangelo
Dipartimento Clinico Veterinario, Via Tolara di Sopra 50, 40064 Ozzano Emilia – Bologna (Italia).
Tel: 0039 051 792803; fax: 0039 051 792793; email: [email protected]
Aknowledgements
Investigation supported by University of Bologna (funds for selected research topics)
Introduction
Brown cattle (Brown Swiss, Braunvieh, Italian Brown) have experienced the occurrence of undesirable genetic defects in
the last decades.
The first and possibly the most known is the Progressive Degenerative Myeloencephalopathy (“Weaver Syndrome”). We
shall not deal with this disease for two reasons: firstly because clinical signs usually begin at about 6-8 months of age and
secondly because a marker-assisted selection has reduced the occurrence of the disease noticeably in the last years.
The objects of this work are the genetic diseases of young calves, such as Spinal Muscular Atrophy, Spinal Dysmielination,
Congenital Myopathy and Arachnomelia. These have become a matter of considerable concern for the Brown breeders’
associations all over the world. A brief review of the location of lesions and their relationship to clinical signs is provided in
order to improve the skills of bovine practitioners in recognizing and differentiating them from non-inherited conditions.
Spinal Muscular Atrophy
Spinal Muscular Atrophy (SMA) is a progressive lethal disease affecting humans and a variety of mammalian species,
among them cattle. Bovine-SMA has been reported mainly in advanced backcrosses between American Brown-Swiss and
European Brown cattle breeds (El-Hamidi and coll., 1989; Nielsen and coll., 1990; Dirksen and coll., 1992; Stocker and
coll., 1992; Troyer and coll., 1993; Winter and coll., 1999; Testoni and coll., 2002), but was described also in Brown
related cross-calves (Agerholm and Basse, 1994) and in Holstein-Friesian calves (Pumarola and coll., 1997).
The condition is characterized by severe muscular neurogenic atrophy, progressive quadriparesis, and sternal recumbency.
In 2002 we described the first case of Bovine-SMA in Italy which occurred in a Brown calf brought to our attention because
of respiratory distress and recumbency (Testoni and coll., 2002); another 5 cases have been reported to us more recently.
SMA at present represents the most worrisome concern for the Brown breeders’ associations.
The initial signs, symmetric weakness of the rear legs, locomotion difficulties and slight dyspnoea, appear at 3-4 weeks of
age. The course of the disease is progressive and calves become increasingly weaker and progress to paraparesis and finally
tetraparesis. Animals usually look alert and show good appetite and normal suckle reflex. Urination and defecation are in
the physiological range. Death occurs after 2-4 weeks, usually as a consequence of respiratory failure due to atrophy of the
respiratory muscle. Bronchopneumonia is a frequent complicating disease, and contributes to the spontaneous death of
the affected animals.
30
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Histo-pathologically, the condition is mainly characterized by muscle fibre atrophy, axonal degeneration of the spinal cord
as well as neuronophagia and degeneration and loss of motor neuron in the grey matter of the ventral horns (especially
brachial and lumbo-sacral regions); additionally, severe vacuolar degeneration in the midbrain and motor central cortex can
be observed (Troyer and coll., 1992; Lassak, 1996; Sisó and coll., 2003).
There is clear evidence that bovine-SMA is inherited as an autosomal recessive disorder. The extensive usage of American
Brown Swiss carriers to upgrade European Brown cattle breeds has to be considered the cause of the spread of the defective
alleles. Most of the reported cases could be traced back to an American Brown Swiss bull named “Meadow View Destiny”
(Medugorac and coll., 2003).
Medugorac and coll. (2003) managed to map the gene causing bovine-SMA to Chromosome 24. The same authors suppose
that the apoptosis-inhibiting protein BCL2 might be the most promising positional candidate gene causing bovine-SMA.
A marker-assisted test based on four microsatellite markers has recently become available in order to detect carriers of this
undesirable nature (Gene Control GmbH, Grub, Germany; Berchtold, 2001 and 2002; Medugorak and coll., 2003).
Spinal Dysmielination
Spinal Dysmielination (SD) is another congenital and genetic neurological disorder affecting Brown or cross-bred calves
upgraded with American Brown Swiss (Hafner and coll., 1993; Agerholm and coll., 1994; Stocker and coll., 1996).
Affected animals have congenital recumbency (on the contrary to SMA) and mostly lie in a lateral position with a slight
to moderate opisthotonos. Rear limbs are held in extension and on pressuring the interdigital skin they react by stretching
or kicking. The hind limb remain typically extended also if calves are able to maintain the sternal position. Although the
animals do not try to rise they are attentive to their surroundings. Main reflexes are normal, as are appetite and faeces and
urine delivery.
Histo-pathologically the disorder is mainly characterized by bilateral symmetrical dysmielination in the white matter of the
spinal cord (gracile funiculus, dorsolateral spinocerebellar tract, sulcomarginal tract), especially at the level of the cervical
intumescences (Hafner and coll., 1993; Agerholm and Andersen, 1995; Pfluger, 1999). Typically, the submeningeal areas
have a more pronounced dysmielination than the deeper parts (Agerholm and coll., 1994). Moreover the number of axons
within the affected tracts is reduced. Myelination of dorsal and ventral nerve roots appears normal.
Slight muscular atrophy can appear as a consequence of inadequate innervation.
Similarly to the bovine-SMA, SD is an autosomal recessively inherited defect (Agerholm and Andersen, 1995).
There is evidence that SD might be traced back to an American Brown Swiss bull named White Cloud Jasons Elegant born
in 1966 (Agerholm and Andersen, 1995; Stocker and coll., 1996).
Nissen and coll. (2001) mapped SD to bovine chromosome 11, and hypothesized that a mutation in the EGR4 (early
growth response) gene could be responsible for the defect. Subsequently they questioned what they had hypothesized
regarding the EGR4 gene, and failed to provide evidence of its role in SD (Nissen and coll., 2003).
A marker-assisted test based on five markers has been recently developed in order to detect carriers of this undesirable
character (Gene Control GmbH, Grub, Germany; announcement in the Rinderzucht Braunvieh, 9(2):36, 2003). It is
however limited to some genetic lines.
Arachnomelia
Arachnomelia (“spider-legs”) is a congenital abnormality of the skeletal system giving the animal a spidery look. Although
the first reports of this condition date back to the seventies/eighties (Rieck and Shade, 1975; Brem and coll., 1984; König
and coll., 1987) the disease has been insufficiently analyzed and, except for those descriptions, we failed to find other
experimental research in the veterinary literature.In 1989 Leipold and Steffen drew the attention of Brown-cattle breeders
and veterinarians to the disease, but only in recent years has the disease again begun to worry the breeders’ associations all
over the world.
We have recently described the first cases of Arachnomelia in Italy (Testoni and coll., 2003); all calves (three) traced back
to the same sire (Tommy). After these reports many Brown-cattle italian breeders have reported the occurrence of other
cases of Arachnomelia; all cases were offspring of Tommy or Amaranto. As both these two bulls have been widely used
for artificial insemination in Italy, ANARB (Associazione Nazionale Allevatori di Razza Bruna) expects many other cases
of Arachnomelia in the future.Brown calves affected with Arachnomelia have major lesions in the skeletal and muscular
system. Most affected calves are born dead and only a few live for a few hours.
The most important pathologic findings are: facial deformities (i.e. brachygnatia inferior and concave rounding of the
dorsal profile of the maxilla); bone dolichostenomelia; angular deformities in the distal part of the hind legs; muscular
atrophy; cardiac malformations.
Bones of the legs appear to be more fragile than normal and spontaneous fracture during calving may injure the dam.
Although we failed to find precise information in the literature, the pathogenesis of the disease seems to overlap that of
the Marfan Syndrome in human medicine (Arachnodactylia): in this context a defect in the metabolism of the connective
tissue is involved.
However the clinical findings recorded in calves affected by Arachnomelia usually differ from the typical picture of the
human “Marfan patients” (dolichostenomelia with high fragility of long bones, defects of the heart and main arteries,
ectopia lins), and for this reason we think that the clinical identification between the bovine Arachnomelia and the human
Marfan Syndrome is inopportune. Moreover, contrary to the almost undisturbed vitality of human patients, bovine
Arachnomelia has a rapidly lethal course. It should be kept in mind that a true Bovine Marfan Syndrome more closely
resembling human Marfan syndrome has also been described in cattle (Potter and coll., 1993; Potter and Besser, 1994).
Regarding the aetiology, although it has not been possible to find candidate genes until now, the condition is attributed to
a simple autosomal recessive inheritability. The origin of this defect was postulated to be an American Brown Swiss bull or
a cow of the same breed (König and coll., 1987).
At the moment there is neither a chromosomal nor biochemical test to detect the carriers of this defect.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
31
Congenital Myopathy
A further congenital skeletal muscle disorder suspected to have a hereditary aetiology was described by Hafner and coll.
(1996) and named Congenital Myopathy (CM). Similarly to SMA and SD, affected calves (6) were upgraded with
American Brown Swiss bulls. The animals show rapidly progressing muscular weakness and become recumbent within 2
weeks of birth. If assisted animals can maintain the quadrupedal stance for short time, showing muscular trembling and
pendent head (Dirksen G., 2002).
Clinically the disease is very similar to bovine-SMA and only the pathological changes allow its definitive diagnosis. Calves
afflicted with CM show characteristic signs of primary muscular disorders (rhabdomyopathy), such as marked variation
in muscle fibre size, internally located nuclei, fibre splitting and broadened extracellular spaces (Hafner and coll., 1996;
Lassak, 1996).
References
Agerholm J.S. and Andersen O. (1995) “Inheritance of Spinal Dysmielination in calves” J. Vet. Med A, 42:9-12.
Agerholm J.S. and Basse A. (1994) “Spinal muscular atrophy in calves of the Red Danish dairy breed” Vet. Rec., 134:232-235.
Agerholm J.S., Hafner A., Olsen S., Dahme E. (1994) “Spinal dysmyelination in cross-bred Brown Swiss calves” J. Vet. Med. A, 41:180188.
Berchtold J. (2001) “SMA-Gentest kommt auf den Markt“ Rinderzucht Braunvieh, 7(2):18.
Berchtold J. (2002) “Fast alle Prüfstiere SMA-frei geprüft““ Rinderzucht Braunvieh, 8(2):64-65.
Brem G., Wanke R., Hondele J. and Dahme E. (1984) “Zum Auftreten des Arachnomelie-Syndroms in der Brown-Swiss x Braunvieh
Population Bayerns“ Berl. Münch. Tierärztl. Wschr., 97:393-397.
Dirksen G. (2002) “Primäre konnatale Myopathie“ in: Innere Medizin und Chirurgie des Rindes, Dirksen G., Gründer H.D. e Stöber
M., Berlin, Parey Buchverlag, 2002, pag. 889.
Dirksen G., Doll K., Hafner A., Hermanns W. and Dahme E. (1992) “Spinale Muskelatrophie (SMA) bei Kälbern aus Brown Swiss x
Braunvieh-Kreuzungen” Dtsch. Tierärztl. Wschr., 99:168-175.
El-Hamidi M., Leipold H. W., Vestweber J. G. E. and Saperstein G. (1989) “Spinal Muscular Atrophy in Brown Swiss calves” J. Vet. Med.
A, 36:731-738.
Hafner A., Dahme E., Obermaier G., Schmidt P. and Dirksen G. (1993) “Spinal Dysmyelination in new-born Brown Swiss x Braunvieh
calves” J. Vet. Med. B, 40:413-422.
Hafner A., Dahme E., Obermaier G., Schmidt P., Doll K. and Schmahl W. (1996) “Congenital myopathy in Braunvieh x Brown Swiss
calves“ J. Comp. Path., 115:23-34.
König H., Gaillard C., Chavaz J., Hunziker F. and Tontis A. (1987) “Prüfung von Schweizer Braunvieh-bullen auf das vererbte Syndrom der
Arachnomelie und Arthrogrypose (SAA) durch Untersuchung der Nachkommen im Fetalstadium“ Tierärztl. Umschau, 42:692-697.
Lassak T. (1996) “Vergleichende myopathologische Studien an Braunvieh x Brown Swiss Kälbern mit Spinaler Dysmielogenese (SDM), Spinaler
Muskelatrophie (SMA) und Kongenitaler Myopathie (CM)“ Vet. Med. Diss., München.
Leipold H.W. e Steffen D. (1989) “Sindrome of Arachnomelia and Arthrogryposis (SAA) in Brown Swiss Calves” Brown Swiss Bull.,
september 1989, pagg.86-87.
Medugorac I., Kempter J., Russ I., Pietrowsky D., Nüske S., Reichenbach H-D., Schmahl W. and Förster M. (2003) “Mapping of the
bovine spinal muscular atrophy locus to Chromosome 24” Mamm. Genome, 14:383-391.
Nielsen J.S., Andresen E., Basse A., Christensen L.G., Lykke T. and Nielsen U.S. (1990) “Inheritance of Bovine Spinal Muscular Atrophy”
Acta Vet. Scand., 31:253-255.
Nissen P.H., Shukri N.M., Agerholm J.S., Fredholm M. and Bendixen C. (2001) “Genetic mapping of spinal dysmielination in cross-bred
American Brown Swiss cattle to bovine Chromosome 11“ Mammalian Genome, 12:180-182.
Nissen P.H., Thomsen B., Offenberg H., Thomsen P.D. and Bendixen C. (2003) “Cloning and characterization of the bovine EGR4 gene
and evaluation as candidate gene for bovine spinal dysmielination” Animal Genetics, 34: 124-131.
Pfluger K. (1999) “Spinale Dysmielisierung neugeborener Kälber der Rasse Deutsches Braunvieh. Eine morphometrische Studie“ Vet. Med.
Diss., München.
Potter K.A. and Besser T.E. (1994) “Cardiovascular lesions in bovine Marfan syndrome” Vet. Pathol., 31:501-509.
Potter K.A., Hoffman Y., Sakai L.Y., Byers P.H., Besser T.E., and Milewicz D.M. (1993) “Abnormal fibrillin metabolism in bovine Marfan
syndrome” Am. J. Pathol., 142:803-810.
Pumarola M., Anor S., Majo N., Borras D. and Ferrer I. (1997) “Spinal muscular atrophy in Holstein-Friesian calves” Acta Neuropathol.
(Berl.), 93:178-183.
Rieck G.W. and Shade W. (1975) “Die Arachnomelie (Spinnegliedrigkeit), ein neues erbliches letales Mißbildungssyndrom des Rindes“ Dtsch.
Tierärztl. Wschr., 82:342-347.
Sisó S., Pumarola M. and Ferrer I. (2003) “Cell death and decreased synaptic protein expression in the ventral horn of Holstein-Friesian calves
with Spinal Muscular Atrophy” J. Comp. Path., 128:132-139.
Stocker H., Ossent P., Heckmann R. and Örtle C. (1992) “Spinale Muskelatrophie bei Braunvieh-Kälbern” Schweiz. Arch. Tierheilk.,
134:97-104.
Stocker H., Pusterla J.B., Lutz H. and Ossent P. (1996) “Eine neue Erbkrankheit beim Braunvieh in der Schweiz: Spinale Dysmielinisierung
(SDM) bei festliegenden Kälbern“ Schweiz. Arch. Tierheilk., 138:295-300.
Testoni S., Cavicchioli L., Ferro S. and Gentile A. (2003) “Tre casi di aracnomelia in vitelli di razza Bruna” Atti Soc. It. Buiatria, 35:113121.
Testoni S., Gentile A., Castagnaro M. and Lugli M. (2002) “Atrofia Muscolo Spinale del bovino. Su di un caso in un vitello di razza Bruna”
Ob. Doc. Vet., 23:25-29.
Troyer D., Cash W.C., Vestweber J., Hiraga T. and Leipold H.W. (1993) “Review of spinal muscular atrophy (SMA) in Brown Swiss cattle”
J. Vet. Diagn. Invest., 5:303-306.
Troyer D., Leipold H. W., Cash W. and Vestweber J. (1992) “Upper motor neurone and descending tract pathology in bovine Spinal
Muscular Atrophy” J. Comp. Path., 107: 305-317.
Winter P., Bago Z., Podstatzky L. and Speckbacher G. (1999) “Spinale Muskelatrophie bei einem Brown-Swiss Kalb - Fallbericht” Wien.
Tierärztl. Mschr., 86:83-87.
32
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
RILIEVI CLINICI ED ISTOPATOLOGICI SU TRE CASI
DI ATASSIA PROGRESSIVA DELLO CHAROLAIS.
*Viglietti A., *Carta P., *Usai G., °Montisci A., *Ruiu A., *Capitta P., *Ligios C.
*Istituto Zooprofilattico Sperimentale della Sardegna,
°Azienda Sanitaria Locale n° 5 – Oristano
Riassunto
L’Atassia Progressiva dello Charolais è una rara neuropatologia osservata sia nei soggetti di razza pura Charolais che nei
meticci discendenti.
In questo lavoro vengono descritti gli aspetti clinici ed anatomo-istopatologici osservati presso una azienda della Sardegna
in 2 bovine adulte ed 1 vitello di razza Brunoalpina x Charolais affetti da una patologia neurologica caratterizzata da
debolezza ed atassia a carico degli arti posteriori.
Microscopicamente, nel sistema nervoso centrale sono state osservate placche eosinofiliche perlopiù isolate e raramente
raggruppate a livello del corpus medullare del cervelletto, fascio spinotalamico e rubrospinale, peduncoli cerebellari e
lemnisco mediale. Le placche eosinofiliche erano in qualche caso circondate da rari oligodendrociti ipertrofici. Le colorazioni
specifiche hanno rilevato che il materiale che costituisce tali placche ha le stesse affinità tintoriali della mielina. Il quadro
lesivo riscontrato è stato ritenuto tipico dell’Atassia Progressiva dello Charolais. Il presente lavoro rappresenta la prima
segnalazione di questa rara e singolare neuropatologia dei bovini Charolais allevati in Italia, ed offre ulteriori elementi di
tipo epidemiologico che ribadiscono ancora una volta la sua probabile origine genetica.
Summary
Progressive ataxia in Charolais cattle is a rare neurological disease which is observed both in purebred and in at least three
quarters purebred Charolais.
Clinical and anatomo-histopathological examinations on 2 cows and 1 calf of Brown Swiss x Charolais showing neurological
signs are described in this work. The animals had typical neurological signs which included weakness of the hind-legs that
slowly progressed to ataxia. This was accompanied by jerking movements. The lesions observed were microscopic and
restricted to the white matter of the central nervous system and consisted of multiple eosinophilic plaques. They were
most evident in the corpus medullare of the cerebellum, the spinotalamic and rubrospinal tracts, the cerebellar peduncles
and the lemniscus medialis. The plaques showed tinctorial affinity similar to that of myelin and were rarely surrounded by
hypertrophic oligodendrocytes. These are the first reported cases of this rare and unique disease in Italy. Epidemiological
data in these cases suggest once more that the disease could be genetic in origin.
Introduzione
L’atassia progressiva dello Charolais è una rara neuropatologia su base genetica, osservata sia nei bovini di razza pura
Charolais che negli incroci 75% (Blakemore et al, 1974; Cordy, 1986). Colpisce soggetti di età compresa tra i 6 mesi ed
i 3 anni, con maggiore incidenza tra i 12 ed i 24 mesi. Il decorso della malattia è progressivo e si manifesta clinicamente
con incoordinazione motoria, debolezza del treno posteriore fino, nella maggioranza dei casi, al decubito permanente
(Blakemore et al, 1974). Lo stato del sensorio rimane inalterato (Summers, Cummings & de Lahunta, 1989), anche se sono
segnalati comportamenti aggressivi (Jubb, Kennedy & Palmer, 1993). Infine, come sintomo caratteristico, sono riportati
disturbi della minzione (Blakemore et al, 1974; Zicker et al, 1988).
Descritta la prima volta da Palmer et al nel 1972 in Gran Bretagna su bovini provenienti dalla Francia, venne in seguito
osservata in Canada (Tryphonas, 1974), Regno Unito (Blakemore et al, 1974), Nuova Zelanda (Palmer & Blakemore,
1975), Francia (Palmer, 1976), Australia (Daniel & Kelly, 1982) e negli USA (Patton, 1977; Cordy, 1986; Zicker et al,
1988).
Per la sua capacità di adattamento alle varie condizioni climatiche la razza Charolais è allevata in tutto il mondo. In
Sardegna questa razza è stata introdotta intorno agli anni 1963-1965 (Casu, 1971) attualmente i capi iscritti al Libro
Genealogico sono 1148 che rappresentano il 14% di quelli presenti in tutta l’Italia.
Considerata l’importanza dell’allevamento dello Charolais in Sardegna abbiamo ritenuto utile segnalare questa rara e
singolare neuropatologia che, dalla letteratura da noi consultata non risulta sinora descritta in Italia.
Materiali e metodi
Le nostre osservazioni sono state effettuate in Sardegna presso un allevamento bovino da carne costituito da 50 vacche
F1 Bruna-Alpina x Charolais che venivano incrociate con un toro di razza pura Charolais per la produzione di vitelli da
destinare alla macellazione. Nell’arco di 3 mesi 2 vacche 50% Charolais rispettivamente di 7 e 3 anni ed un vitello 75%
Charolais di 9 mesi, figlio della bovina di 7 anni, hanno iniziato a manifestare un quadro clinico neurologico ad andamento
cronico ed insensibile a vari trattamenti terapeutici.
Tutti i capi dopo essere stati esaminati clinicamente per 2 volte a distanza di 1 mese e, considerata la prognosi infausta, sono
stati destinati alla macellazione.
Durante la macellazione sono stati prelevati l’encefalo ed il midollo spinale in toto nonché campioni dal rene e dal fegato
che venivano, per l’allestimento di preparati istologici, immersi in formalina tamponata al 10 %.
Dopo 20 giorni, l’encefalo ed il midollo spinale sono stati sezionati trasversalmente a livello rispettivamente dei lobi
frontali, nuclei basali, talamo, mesencefalo, cervelletto, midollo allungato rostrale, obex ed emergenza dei nervi spinali da
C1 sino ad L7. Le sezioni encefaliche e midollari così ottenute assieme ai campioni di fegato e rene, dopo essere state incluse
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
33
in paraffina e tagliate ad uno spessore di 5 µm sono state colorate secondo metodiche routinarie con Ematossilina-Eosina
e Luxol fast blue.
Risultati
All’esame clinico i bovini mostravano alterazioni locomotorie progressive con atassia caratterizzata da movimenti lenti
ed incerti particolarmente evidenti a carico degli arti posteriori. Tutti i capi evidenziavano alterazioni della postura con
oscillazione costante del treno posteriore e frequente abduzione di un arto.
Questi sintomi, a distanza di un mese, si erano sensibilmente aggravati e venivano accompagnati da un caratteristico
atteggiamento “sotto di sé” con estensione del collo e costante correzione della posizione in stazione eretta. Era inoltre
osservata depressione del sensorio ma non la caratteristica alterazione della minzione descritta da altri autori.
In sede necroscopica non sono state osservate lesioni degne di rilievo, a parte uno stato di deperimento organico.
Microscopicamente a livello del sistema nervoso centrale sono state riscontrate nella sostanza bianca placche eosinofiliche
di 20-50µm, le quali apparivano granulari, amorfe, prive di residui nucleari, spesso a disposizione perivasale e talvolta
circondate da oligodendrociti ipertrofici (Fig. 1 e 2).
Nella tabella 1 è riassunta la distribuzione neuro-anatomica di tali lesioni. Al contrario, non si sono osservate lesioni
istologiche nel rene e nel fegato.
Aree neuroanatomiche
Vitello 9mesi
Bovina 3 anni
Bovina 7 anni
Corpus medullare (cervelletto)
Peduncoli cerebellari
Lemnisco mediale
Corteccia
Midollo spinale cervicale
Midollo spinale toracico
Midollo spinale lombare
Midollo allungato (tratto rubro-spinale)
Midollo allungato (tratto spino-talamico)
Fascicolo cuneato
++++
+++
+
++
+++
+
++
+++
-
+++
++
+
+
+++
+
+
++++
+
+
-
TAB. 1: distribuzione delle placche nell’encefalo e nel midollo allungato di 3 soggetti.
Discussione
Sulla base del quadro clinico e delle lesioni microscopiche osservate riteniamo che la neuropatologia da noi osservata sia
ascrivibile all’atassia progressiva degli Charolais descritta da Palmer, Blakemore et al (1972) in Inghilterra. Dal punto di vista
clinico l’abduzione degli arti ed il continuo oscillamento ci sono sembrati degli atteggiamenti posturali particolarmente
utili per la diagnosi differenziale con altre patologie. Tuttavia uno dei sintomi più caratteristici, alterazioni della minzione
così come segnalato da Cordy (1986), Daniel et al (1982), Zicker et al (1988) e Blakemore et al (1974) non è stato da noi
osservato. Da quanto sinora riportato in Bibliografia si può dedurre che, dal punto di vista morfologico, questa patologia
sia una leucodistrofia particolarmente singolare che non ha equivalenti con altre neuropatologie degli animali e dell’uomo
(Blakemore et al, 1974). All’esame ultrastrutturale, le placche eosinofiliche sono descritte in corrispondenza dei nodi di
Ranvier a livello dei quali, gli oligodendrociti displastici mostrano processi neoformati di lunghezza indefinita nelle guaine
mieliniche (Blakemore et al, 1974). Si è supposto che la presenza di questi processi digitiformi alteri il rapporto tra assoni
e cellule gliali, causando anormalità nella conduzione dell’impulso (Blakemore et al, 1974; Cordy, 1986).
La localizzazione delle placche viene più frequentemente decritta a livello del corpus medullare del cervelletto, dei peduncoli
cerebellari e della capsula interna (Cordy, 1986; Zicker et al, 1988; Blakemore et al, 1974; Daniel et al, 1982). In minor
misura è osservata nei tratti ottici, decussazione pontina, fascicolo longitudinale mediale, funicolo laterale e ventrale del
midollo spinale (Cordy, 1986; Blakemore et al, 1974).
Nei nostri casi si conferma la tendenza delle lesioni a localizzarsi nel cervelletto e peduncoli cerebellari, così come nei
cordoni latero-ventrali del midollo spinale ed, in numero modesto, anche a livello del lemnisco mediale. Al contrario nei
bovini da noi esaminati non sono state riscontrate lesioni nei tratti ottici, nel corpus callosum e nel fascicolo longitudinale
34
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
mediale.
La gravità del quadro lesivo a livello del midollo spinale è risultata variabile dimostrandosi di grado inversamente
proporzionale all’età dei 3 soggetti (vedi tab 1).
Nei bovini da noi esaminati le lesioni localizzate nei fasci spino-cerebellari, rubrospinali e gracile spiegano il deficit della
sensibilità propriocettiva che è responsabile in gran parte dei quadri clinici osservati. Questo ci permette di affermare che
nel caso dell’atassia progressiva un esame completo dell’encefalo e del midollo spinale riescono a provare l’esistenza di una
correlazione tra lesioni e sintomi osservati, contrariamente a quanto affermato da Zicker et al (1988) .
La diagnosi della malattia in un soggetto di 7 anni rappresenta un dato originale poiché l’atassia progressiva è stata sinora
descritta in bovini di età non superiore ai 3 anni (Jubb, Kennedy & Palmer, 1993). Al contrario è una conferma a quanto
finora osservato la presenza di un elevato grado di consanguineità tra i soggetti oggetto del nostro lavoro. Questo sembra
confermare che l’atassia progressiva degli Charolais sia una neuropatologia di origine genetica. Ciò potrebbe significare che
in Sardegna un’alta percentuale di allevamenti destinati alla produzione di vitelli per l’ingrasso potrebbe essere esposta a
questa patologia, in considerazione del fatto che la malattia è stata da noi osservata anche nei meticci F1 Charolais.
Conclusioni
Sulla base di quanto da noi descritto il quadro clinico-patologico dell’atassia progressiva negli Charolais allevati in
Sardegna, non differisce sostanzialmente da quanto da altri descritto in vari paesi (Cordy, 1986; Zicker et al, 1988;
Blakemore et al, 1974; Daniel et al, 1982). Riteniamo comunque che solo un esame completo di un numero significativo
di distretti encefalici-midollari permetta di arrivare ad una diagnosi di conferma in laboratorio. Questo in particolare
nei soggetti adulti a causa della presenza di uno scarso numero di placche che, peraltro, sono spesso confinate quasi
esclusivamente a livello del cervelletto.
Sono infine necessari ulteriori studi a livello ultrastrutturale ai quali si dovranno aggiungere degli studi di genetica, sia per
capire appieno i meccanismi patogenetici di questa rara neuropatologia, che per fornire conoscenze utili per una accurata
selezione genetica dei riproduttori.
Bibliografia
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Blakemore W.F., Palmer A.C., Barlow R.M. (1974). Progressive ataxia of Charolais cattle associated with disordered myelin. Acta
Neuropathologica (Berl); 29: 127-139.
Brodal P. (1998). The central nervous system. Structure and function. Oxford University Press, New York; 14, 351, 399.
Casu S. (1971). L’incrocio tra tori di razza Charolais, Piemontese, Limousine e bovine locali nella produzione della carne in Sardegna.
Estratto da “Problemi degli allevamenti ovini e bovini in Sardegna – Sassari, 1971”, Gallizzi ed., Sassari.
Cordy D.R. (1986). Progressive ataxia of Charolais cattle-An oligodendroglial dysplasia. Vet Path; 23: 78-80.
Daniel R.C.W., Kelly W.R. (1982). Progressive ataxia in Charolais cattle. Australian Vet J; 58: 32.
Jubb K.V.F., Kennedy P.C., Palmer N. (1993). Pathology of domestic animals. Academic press, San Diego, IV edition, vol 1, The
nervous system, cap 3:374.
Ogden A.L., Palmer A.C., Blakemore W.F. (1974). Progressive ataxia in Charolais cattle.
Vet Rec; 94: 555.
Palmer A.C., Blakemore W.F., Barlow R.M., Fraser J.A., Ogden A.L. (1972). Progressive ataxia of Charolais cattle associated with a
myelin disorder.
Vet Rec; 91: 592-594.
Palmer A.C., Blakemore W.F. (1975). Progressive ataxia of Charolais cattle.
Bovine practice; 10: 84-85.
Palmer A.C. (1976). Personal communication. Riportato da Patton C.S. (1977). Progressive ataxia in Charolais cattle. Vet Pathol;
14: 535-537.
Patton C.S. (1977). Progressive ataxia in Charolais cattle. Vet Pathol; 14: 535-537.
Summers B.A., Cummings J.F., de Lahunta A. (1995). Veterinary Neuropathology. Mosby, Saint Louis, Degenerative disease, cap
5: 286-287.
Tryphonas, L. Personal communication. Riportato da Ogden A.L., Palmer A.C., Blakemore W.F. (1974). Progressive ataxia in
Charolais cattle. Vet Rec; 94: 555.
Zicker S.C., Kasari T.R., Scruggs D.W., Read W.K., Edwards J.F. (1988). Progressive ataxia in a Charolaise bull. JAVMA; vol. 192,
11: 1590-1592.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
35
pagina bianca lasciata intenzionalmente
ATTI
GIOVEDÌ 22 MAGGIO 2003
MANAGEMENT AND CONTROL OF THE CLAW DISEASES
IN INTENSE DAIRY PRODUCTION
B. Zemljic
APPROCCIO AL FENOMENO DI “RIPRESA” DELLA CURVA DI LATTAZIONE
NELL’ ALLEVAMENTO CAPRINO ESTENSIVO
Marongiu M. L. , Santucci P. M., Branca A., Floris B.
ELECTRONIC IDENTIFICATION IN TRANSITION GOATS
Pinna W., Sedda P., Moniello G. , Nieddu G., Solinas I.L.
VALORI LATTODINAMOGRAFICI E CONTENUTO IN CELLULE SOMATICHE
NELLA PECORA DA CARNE.
Alessi A., Aliberti A., Cirone F., Scatassa M.L., Foti M., Rinaldo D., Garofalo L., Buonavoglia D.
XI Congresso
Internazionale
della Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
37
38
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
MANAGEMENT AND CONTROL OF THE CLAW DISEASES
IN INTENSE DAIRY PRODUCTION
Dr. Borut Zemljic Dr.Vet.Med., Veterinary Polyclinic Ormoz, Ljutomerska 25, SI 2270 Ormoz, Slovenia, phone:+ 386 2 740
43 00, fax: + 386 2 740 43 01
e-mail: [email protected]
Abstract
High producing dairy cows with the healthy claws are very rare today. In the modern dairy production we know
numerous negative influences, causing claw health problems. The greatest problem of all is, that we are not able to change
those parameters. Because of the high production we must feed those animals with more high digestible proteins and
carbohydrates, what causes changes in metabolism and have impact on claw health. The floor and equipment in modern
stables are friendlier to the owners and workers than to animals. The upper level of organism response is in the high dairy
production on the limit, what we mostly observe on the claws. In the modern dairy production we must follow two basic
principles: MORE AND BETTER. In such production the owner and veterinarian specially must made decision between
higher production and better health, what normally influences financial output of the production and has direct influence
on the herd management. The appearance of enlarged claw health problems in the dairy herd is of the multifactorial
provenience and unfortunately does not have only one straight solution. The approach to solving claw problems must be
complex, normally take in accountancy more possible ways.
1. Introduction
In the last two decades we are witnesses of immense changes in the aetiology and incidence of claw diseases in intense dairy
production. Process of recognition and even understanding of development of the risk factors for specific claw pathology
were slow and mostly incomplete. Risk factors are in simple correlation with farm management, genetic picture of cattle
population and certainly also of the singular animal, stable design, feeding model and feed ingredients as with behaviour
of the animal in the herd as ethological pressure to the individual cow and to the entire population in the herd. All
these pressure mechanisms additionally enlarge stress syndromes because of enlarged number of the animals in the herd,
demanding on higher production, which must be close to maximum, what is in large connected with the genetic potential
of the individual animal and entire population. Those pressures are larger in the herds where tied animals changing to the
free stall systems, what according to ethological principals must be better, but that also means less littering, less pasture and
also less possibility for movement outside of the stable. All together, new systems are mostly more suitable for less physical
engagement of the owners but less suitable for animals. Everything what was counted just before, is resulting in the higher
incidence of claw diseases and deformations in the population of high yielding dairy cows.
Therefore, acceptance of measures for diminishing of the high incidence of claw diseases in highly intense dairy production
by owners, depend on capability and professional knowledge of veterinarian, who must be able to persuade owner that
prophylactics and constant surveillance of claw health in the herd is economical interesting and profitable job.
Lameness has it origin in the pain, which is constant present in the case of pathological changes in the feet. Because of
these reasons, lameness is not only health and economic problem of the profitability of dairy production, but also welfare
problem, what rises in last decade to a bigger and bigger problem, because of the awareness of the consumers, users of
the products made by cattle owners. Fortunately welfare issues become promoter of more and more investigations and
researches on the field of lameness in cattle.
2. Epidemiological research
2.1. Multifactorial approach to the problem of dairy cows lameness
Lameness in dairy cattle count to the production diseases. Risk factors, which influences appearance of claw
diseases, mostly in multifactorial appearance and with mutual combination influences prevalence, incidence
and mostly severity of lameness outbreaks in the herd. Judgement about importance of individual risk factor in
prevalence of individual claw disease demand serious professional analysis and big amount of specific knowledge.
2.2. Recognition and definition of the problem
Epidemiological methods of lameness research enable practitioners for systemic approach to lameness analysis in the herd.
Such an analysis recognise and range risk factors in the herd according to importance in the development of the disease and
form fundament for establishing preventative programs for lameness in the herd. If veterinarian wants to approach to the
lameness problem on systemic way, it is necessary to prove some basic points such as:
a. Do we have already lameness problem?
b. Definition of the problem if it already exist,
c. Who already participate in the appearance and in the solving process of the problem?
d. How we become problem with the lameness?
e. How the risk group is stabled in?
f. Why we have to do with lameness problem?
The greatest problem in epidemiological studies are mostly so called “expertise opinions”, where veterinarian pick up only
most obvious problem, willingly or unwillingly forgetting numerous other factors. In modelling of the definition of the
problem owner has a central role, because only with tight co-operation of veterinarian with the owner we can get useful
solution. Most important in this connection is, that the owner is conscientious and that every event in the herd is noted
properly.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
39
3. Ecopathology
Expression ecopathology was formed to express determination relationship between disease and different risk
factors. On those risks factors are depending how the disease will appear. Such study try to define characteristics
of each risk factor. Importance of each risk factor we must compare with others and than in comparison establish
if activity is synergistic, antagonistic or cumulative. With practical application of ecopathology principles
we are able to understand and ranking of importance of risk factors in development of typical claw diseases.
4. Risk factors
4.1. Housing
In the years of research numerous authors proved importance of housing systems and its influence on appearance of the
claw diseases. In clinical researches we proved that housing systems have great influence on appearance of the claw diseases.
Therefor we must in management of the housing systems follow certain recommendations, as:
a. Floor must be ever clean and proper maintain.
b. Floor must be abrasive, but not slippery.
c. Rest places must be large enough and if possible covered with some warm cover.
d. It must be enough rest places for each animal and also enough feeding places to avoid unnecessary fights for
feed in the herd.
e. There must be enough possibility for movement, specially for lactating animals, if possible pasture
possibility.
f. All passages and exits must be wide enough and all curves on the walking ways must be wide and mild.
4.2. Feeding
Only to count most important risk factors, because feeding itself could be a subject of separate research, we must number
correlation between feeding concentrates and rough materials, high percentage of highly degradable proteins, high content
of some amino-acids, which contain sulphur and deficiency of zinc, which is mostly important in production of the
horn.
4.3. Management
Numerous clinical researches proved, that prevalence of claw diseases is higher on dairy farms, where knowledge of the
owners is questionable, technical equipment of the farm not adjusted to needs and necessities of the producing animals
and where we have to deal with inpatient owner, who is not able to wait and give animals enough time to accommodate
to changed circumstances. When we add also incorrect management of the herd with improper grouping of animals,
less possibility for movement and not systemic claw correction, than we certainly have to deal with higher incidence of
heavy claw diseases as normal. Specially when we talk about claw correction, it is necessary to engage proper educated
professional, who is able to understand physiology of claw and cow walk. In prevention of claw diseases also organising of
claw baths is crucial, where it is necessary to put bath basins on a places, where each animal is forced to step in and that
contain of the foot bath is according to newest knowledge.
4.4. Genetic predisposition’s
In the sire herds we must look after animals which did not carry over bad configurations of the feet and specially claws.
In the rule are sires with short and steeper claws better than others and also animals with heel joint angle smaller than
1700 are genetically better than others. Very important is also to take care about growth of the animal in the second year.
Heifers must be on time before parturition moved to a proper ratio, which will influence production and possibility to
accommodate to different life circumstances. In free stall systems it is important, that we never introduce one single animal,
specially heifer, in to the herd, however must be that done in the groups, what prevents great stress because of the status
fights in the herd.
4.5. Knowledge of the veterinarian
In the Slovenia it is a rule, that every veterinarian is able and qualified for functional correction and therapy of claw diseases
and deformations. In the reality only few veterinarians are really able to act according to needs of the individual animal and
are also able to recognise all claw statutes and diseases. Because in some cases veterinarian must approach systematically to
the animal and the herd and not only treat the cow, but also improve the farm object or feeding procedure or something
else what is directly or indirectly connected with claw diseases. When we talk about architecture of the farm object is in
most countries unfortunately so, that veterinarians are included very late into the building process. When the object is once
built, it is really difficult to make changes according to ethological standards without great economical looses for owners.
But not only lack of systemic influence on building process, also lack of elementary orthopaedic knowledge is realised
on most veterinary education establishments. In the praegraduation programs there are to little or no theoretical and
practical, “hands on” lessons for students. In the continuing education there are almost no or to little programs for
additional education of veterinarians. Therefor are owners and specially animals in numerous cases left to the experimental
interventions of veterinarians, who could provoke even more problems.
5. Discussion
Identification of the mistakes is one of most important and also difficult tasks in the management of the dairy herd. First of
all such process needs a lot of time. Secondly it is mostly necessary, that after first preliminary results we must settle dawn
enlarged program of further investigation, what made such approach extremely expensive. Despite of this , there are from
40
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
year to year greater interest for systemically approach to the problem of cow lameness. If in the solution searching we use
all newest approaches and methods, there are good prospect to the positive result.
Most important part of our program of diminishing of economical looses because of claw diseases in the intense dairy
production must be dedicated to the building of consistent curriculum for the students, with included orthopaedic lesions
and forming of CPD programs for graduated veterinarians. But not only veterinarians must be educated, also owners must
be aware of importance of the claw diseases and problems. It is always dangerous, that owner would take the leading role in
the process of prevention and therapy of the claw diseases without to have enough proper knowledge. The true is also that
only consciousness owner will be able to look after professional help and would be able to accept it. This professional help
have his financial value, which must be acceptable for both parties.
6. Literature
1.
Bergsten C, Hultgren J, Manske T Claw traits and foot lesions in Swedish gairy cows in relation to trimming interval and housing
system. In: Proceedings of 10th International Symposium on Lameness in Ruminants. Luzerne, Switzerland; 1998, 46 – 48
2. Clarkson MJ Method of data evaluation in studies on lameness. In: Proceedings of the 6th International Symposium of the Ruminant
Digit. Liverpool, England 1990; 177 – 183
3. Esselmont RJ, Spincer I The incidence and costs of diseases in dairy herds. DAISY report 2. Department of Agriculture, University
of Reading, 1993
4. Greenough PR, Weaver AD Lameness in Cattle. 3rd Edition WB Sounders Company, London, UK; 1997
5. Kerr LK Affecting the incidence of lameness by altering the housing systems. In: Proceedings of the 10th International Symposium
on Lameness in Ruminants, Luzern, Switzerland; 1998, 38 – 41
6. Mill IM, Ward WR Lameness in dairy cows and farmers’ knowledge, training and awareness. VetRec 1994; 134:162 – 4
7. Weaver AD Long-term observations on dairy herd lameness. In: Proceedings of the 6th International Symposium on disorders of
the Ruminant Digit. Liverpool; UK: 1990: 59 –61
8. Zemljic B, Sketa J Zdravje �rede in živali: Problemska analiza: šepavost. In Zbornik II. Problemske konference veterinarjev Slovenije,
Postojna 1994, 52 – 62
9. Zemljic B Causes and risk factors for occurrence of lameness in cattle. Praxis veterinaria 45(1997)1 –2, 123 – 9
10. Zemljic B Razlogi in rizi�ni faktorji za nastanek šepavost pri govedu. In: Zbornik II. Kongresa veterinarjev Slovenije. Rogaška
Slatina; 1997: 155 – 159
11. Zemljic B Šepavost pri govedu – vzroki in posledice. Vet. Novice 23, 1997; 10: 351 – 7
12. Zemljic B Lameness – Reasons and Risk Factors for it Origin in Dairy Herds. In: Proceedings of I. Middle – European Buiatrics
Congress. Siofok; Hungary: 1998: 91 - 95
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
41
APPROCCIO AL FENOMENO DI “RIPRESA” DELLA CURVA DI LATTAZIONE
NELL’ALLEVAMENTO CAPRINO ESTENSIVO
Marongiu M. L.(1) , Santucci P. M.(2), Branca A.(3), Floris B. (1)
Dipartimento di Biologia Animale, Sassari
(2)
INRA-SAD LRDE Corti
Istituto Zootecnico e Caseario per la Sardegna. Olmedo (Sassari)
(1)
(3)
Riassunto
Il fenomeno di “ripresa” della curva di lattazione, inteso come la capacità a riprendere la produzione lattea a metà del ciclo
produttivo, é una caratteristica delle razze locali nei sistemi pastorali mediterranei. In 2 allevamenti caprini estensivi, vennero
seguite la produzione quali-quantitativa del latte e la condizione corporea (BCS) nel periodo del risveglio primaverile della
vegetazione (metà aprile). Le capre (n=20 x azienda; classe di età 3/5 anni), di razza Corsa, hanno partorito al’inizio di
novembre; esse pascolavano durante il giorno e ricevevano un’integrazione alimentare (mattino e sera) in azienda fino alla
fine di aprile. Venne registrato anche il BCS intorno al parto (3 controlli). L’aumento della produzione lattea fu piuttosto
marcato in parallelo con la crescita dell’offerta foraggera del pascolo. Il livello di produzione lattea e l’andamento del BCS
al parto furono correlati con l’intensità di ripresa del latte e le risposte differenziate tra gli allevamenti furono spiegate anche
dalle modalità di gestione alimentare.
Introduzione
Attualmente, nell’allevamento caprino di tipo estensivo, l’integrazione alimentare in azienda rappresenta una sorgente
di importanti cambiamenti. Questa pratica, giustificata essenzialmente da un parto contro stagione (e quindi da
un’insufficiente offerta foraggera dei pascoli all’inizio dell’inverno) comporta svariati interrogativi, a causa dei suoi riflessi
sulla conduzione delle greggi, sul comportamento e sulle performances degli animali. In una nota precedente (Marongiu
et al., 2003) abbiamo riportato la cinetica del Body Condition Score (BCS) e di alcuni indicatori ematici del metabolismo
lipidico, glicidico e proteico (NEFA, glucosio e urea) delle capre nel periodo intorno al parto. Le osservazioni ci hanno
suggerito che in questo periodo la mobilizzazione delle riserve corporee è inevitabile, malgrado la piena disponibilità del
pascolo, i deboli livelli produttivi ed una discreta integrazione alimentare. Da qui l’importanza, per l’allevatore, di garantire
un buon livello delle riserve corporee prima del parto (BCS ideale >3). I metaboliti ematici, inoltre, sono apparsi poco
utili per caratterizzare lo stato nutrizionale delle capre (prelievi troppo distanziati nel tempo, stress degli animali etc).
L’idea alla base della presente ricerca è stata quella di considerare le pratiche di alimentazione in un momento
cruciale del ciclo di produzione (risveglio primaverile della vegetazione) e i loro effetti sullo stato nutrizionale
delle femmine, attraverso la valutazione della condizione corporea e della produzione lattea. Potrebbe meravigliare
che si consideri cruciale il risveglio primaverile della vegetazione spontanea. Eppure, negli animali al pascolo ad
esso si associa una notevole capacità di ripresa della lattazione nel bel mezzo del ciclo di produzione, che é una delle
caratteristiche tipiche delle razze indigene nei sistemi pastorali mediterranei (e quindi sicuramente una forma di
adattamento ambientale). Tale fenomeno è ben conosciuto anche in Sardegna, soprattutto nella pecora (Dattilo e
Congiu, 1973), ma anche nello stesso allevamento caprino estensivo (Congiu, 1981). Scopo principale di questa nota
è stato quello di valutare in condizioni di allevamento il comportamento quanti-qualitativo della lattazione e del BCS
in capre al pascolo nella macchia mediterranea, con parto normale (novembre) e integrazione alimentare in azienda.
Materiali e metodi
Le osservazioni vennero effettuate nel periodo marzo-maggio 2002 presso 2 allevamenti della Corsica (nn. 1 e 2), per le
cui caratteristiche si rimanda a Marongiu et al. (2003). Le modalità di conduzione e dell’integrazione alimentare erano
abbastanza simili. I territori aziendali erano vicini fra loro e composti essenzialmente da pascolo su vegetazione arbustiva;
tuttavia, l’All. 2 disponeva di una discreta superficie in erba, che le capre pascolavano per tutta la giornata. La quantità
di mais (400 g/capra/die, distribuiti alla mangiatoia tra mattina e sera) era identica per tutti gli animali. L’interruzione
dell’integrazione avvenne in modo improvviso nell’All. 2 (il 30 aprile), più graduale nell’All. 1 (200g/capra/die a partire
dal 12 aprile, ed interruzione totale il 30 aprile). Da tener presente, tuttavia, che fino alla fine di marzo ciascuna capra
dell’All. 1 ricevette anche 300 g/die di fieno di medica. In ciascun allevamento, furono scelti 20 animali in funzione della
classe di età (preferenzialmente 3/5 anni), della prolificità (1 solo capretto), e del loro stato sanitario. All’inizio del ciclo
di produzione (Novembre-Dicembre), che corrisponde al parto e all’inizio della lattazione, venne controllato solo il BCS
degli animali, mentre al risveglio della vegetazione (verso metà aprile), che corrisponde ad una diminuzione progressiva
seguita dalla soppressione dell’integrazione alimentare, vennero registrati sia il BCS che la produzione quanti-qualitativa
del latte. Per la determinazione della produzione lattea furono effettuate per ciascuna capra 3 doppie serie di controlli
intervallati di 7 giorni (ma ad aprile i controlli furono 3), al fine di caratterizzare i punti di riferimento della curva. Ciascuna
serie di controlli sulla quantità del latte venne effettuata in un periodo ben preciso dell’offerta foraggera del pascolo:
1) all’inizio di Marzo (giorni 12 e 19, in modo da corrispondere alla lattazione invernale);
2) alla metà di Aprile (giorni 12, 19, 26, che corrispondono al periodo di transizione);
3) alla fine di Maggio (giorni 21 e 28, corrispondenti alla lattazione primaverile vera e propria).
Su campioni di latte individuale opportunamente omogenati, inoltre, vennero controllati i livelli di grasso, proteine e
lattosio per lettura nel vicino I.R. tramite Milkoscan 133B (Foss Electric, Denmark). In occasione dei suddetti controlli
venne rilevato anche il BCS (12 marzo, 12 aprile e 21 maggio) secondo il metodo di Santucci e Maestrini (1985).
42
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Risultati
La Fig. n. 1 presenta, nel periodo segnato dall’interruzione dell’integrazione alimentare e dalla crescita foraggera primaverile,
la produzione lattea ed il BCS nelle 2 aziende, nonchè una rappresentazione teorica della disponibilità foraggera del
pascolo.
Fig. n. 1 – Evoluzione di produzione lattea e BCS durante la crescita foraggera primaverile
Si possono notare significative differenze tra l’All. 1 e 2, sia nella quantità di latte individuale prodotta giornalmente
all’inizio dei controlli (rispettivamente 560 ml vs 800 ml) che nella sua evoluzione (Δ 520 ml vs 350 ml). Le differenze si
stemperano nettamente negli ultimi controlli (fine maggio), periodo in cui l’offerta foraggera del pascolo è particolarmente
abbondante. La ripresa della curva di lattazione si manifestò in modo particolarmente significativo nell’All. 1. Infatti, la
produzione lattea aumentò con la disponibilità foraggera del pascolo mentre il BCS si mantenne stabile. Il che sembra
dimostrare che la disponibilità foraggera permetteva a questi animali di incrementare la produzione lattea senza intaccare
il livello delle proprie riserve energetiche. E’ plausibile ritenere, pertanto, che il loro assetto endocrino-metabolico abbia
ripartito l’energia alimentare soprattutto verso la ghiandola mammaria salvaguardando i depositi corporei. Nonostante
le apparenze, quindi, in questo allevamento l’entità della lipomobilizzazione è stata minore, forse a causa di una più
razionale gestione alimentare dal punto di vista energetico. La ripresa della produzione lattea avvenne, meno marcata,
anche nell’All. 2, ma il BCS manifestò una netta evoluzione verso il basso. Le Figg. n. 2-3-4 mostrano rispettivamente
l’evoluzione temporale del contenuto del latte in grasso, proteine e lattosio. La concentrazione del grasso ha mostrato delle
variazioni tutto sommato parallele fra i due allevamenti, sebbene nell’All. 1 il livello sia apparso superiore, forse per un
effetto di “concentrazione” tipico delle minori produzioni. Prova ne sia che il suo livello tende a scendere in coincidenza
del fenomeno di ripresa. Diverso è invece il caso delle proteine. Infatti, mentre nell’All. 2, il livello proteico del latte
si mantenne grosso modo stabile durante le osservazioni, il latte dell’All. 1 ha presentato un netto decremento del suo
contenuto proteico successivamente ai controlli di aprile. In pratica, il crollo del titolo proteico é coinciso con il fenomeno
di ripresa della curva di lattazione. E’ verosimile ritenere che il fenomeno possa essere legato al progressivo utilizzo di una
quota degli amminoacidi alimentari per scopi gluconeogenetici, in sostituzione dell’amido, per la sintesi del lattosio. E’
curioso osservare infatti, che mentre nell’All. 1 la concentrazione del lattosio, mediamente più bassa, si è mantenuta grosso
modo stabile, nell’All. 2, che pur partiva da valori più elevati, vi è stato un progressivo calo del suo livello fino a raggiungere
un valore inferiore a quello dell’All. 1. Il calo del lattosio, evidentemente, benchè non significativo, è conseguente alla
sospensione improvvisa dell’integrazione con mais (minore gluconeogenesi).
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
43
Fig. n. 2 - Andamento del contenuto medio di grasso nel latte dei due allevamenti
Fig. n. 3 – Andamento del contenuto medio di proteine nel latte dei due allevamenti
Fig. n. 4 – Andamento del contenuto medio di lattosio nel latte dei due allevamenti
44
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Discussione e conclusioni
I dati ottenuti si accordano sostanzialmente con quanto osservato da Cabiddu et al. (1999) in capre che avevano presentato
parto tardivo (febbraio). In tale occasione si era osservato che la capra Corsa, alimentata al pascolo nella macchia mediterranea,
senza ricevere alcuna integrazione alimentare in azienda, poteva produrre una soddisfacente quantità di latte, e addirittura
incrementare debolmente la condizione corporea, una volta superata la metà del periodo di lattazione.
Tuttavia, la differente risposta delle capre, osservata nei due allevamenti, pone parecchi interrogativi:
a) Quale potrebbe essere stato il ruolo del livello di produzione lattea invernale (più elevato nell’All. 2)? Nello specifico caso,
sembrerebbe di capire che le capre che hanno avuto un livello di produzione invernale vicino o conforme al loro potenziale
genetico (All. 2) non possano produrre di più neppure se messe in condizioni di eccessiva disponibilità foraggera.
b) Potrebbe essere chiamato in causa il «recente passato» fisiologico dell’animale? Lo stato nutrizionale al parto, e in
particolare la cinetica delle riserve corporee potrebbe svolgere un ruolo in questa capacità di ripresa produttiva a metà
del ciclo di lattazione. In effetti, in questi 2 allevamenti, si notano, sia all’inizio del ciclo (parto) che intorno alla sua
metà (risveglio foraggero), delle differenze nell’evoluzione del BCS, più favorevoli nell’All. 1. Le capre dell’All. 2 ebbero,
immediatamente dopo il parto, una più intensa fase di mobilizzazione delle riserve sebbene in seguito, esse recuperarono
allo stesso livello delle capre dell’All. 1. Purtroppo, gli indicatori ematici (NEFA, glucosio e urea) non sono risultati utili
per chiarire questo interrogativo (Marongiu et al., 2003).
c) La messa in conto di un «passato fisiologico» più lontano (soprattutto l’intervallo di parto) potrebbe apportare degli
elementi di conoscenza, ma lo stato attuale di elaborazione dei dati non ci permette di poter dare una risposta.
d) Effetti di conduzione nel pilotare l’interruzione dell’integrazione in concomitanza all’instaurazione di un regime
alimentare di pascolo esclusivo potrebbero essere decisivi sul comportamento alimentare degli animali, e quindi sulla flora
microbica del rumine. Si notano in effetti, delle differenze tra i 2 allevatori nel portare a termine i 2 tipi di alimentazione
(interruzione improvvisa dell’apporto in azienda nell’All. 2, graduale soppressione nell’All. 1).
e) Infine, una certa variabilità individuale delle femmine non si può escludere. Si può pensare, sulla base dei criteri di
selezione empirici degli allevatori, che alcuni animali abbiano manifestato, meglio di altri, delle attitudini ai contrasti
alimentari. L’allevatore, ad esempio, riferisce di capre che “tengono il latte in inverno, sebbene ad un livello basso, ma che
reagiscono bene alla spinta produttiva che viene loro dalla vegetazione primaverile”.
In conclusione, il fenomeno della ripresa primaverile della curva di lattazione è quantificabile e il metodo utilizzato, 3
controlli del livello della produzione lattea in riferimento al ciclo vegetale con 3 serie di controlli distanziati di 7 giorni
e situate in 3 momenti della curva di lattazione (latte invernale/ latte di transizione/ latte primaverile), ci è sembrato
rispondente allo scopo. Le risposte medie osservate in seno ai 2 allevamenti indicano un aumento dal 15% al raddoppio
della produzione lattea nello spazio di un mese (metà aprile/metà maggio). I risultati non permettono ancora di discernere
la predominanza dei fattori di prossimità, come il livello della produzione lattea o lo stato istantaneo delle riserve corporee,
o di fattori più lontani, come il BCS al parto o lo stato produttivo dell’animale durante il ciclo produttivo della stagione
precedente. Tuttavia, l’effetto “animale”, chiaramente identificato nelle pratiche empiriche di selezione dall’allevatore, è
sicuramente da approfondire e ci porta a discutere come utilizzare questa attitudine in termini di selezione.
Bibliografia
1)
2)
3)
4)
5)
Cabiddu A., Branca A., Decandia M., Pes A., Santucci PM., Masoero F., Calamari L. (1999): Relationship between body condition
score, metabolic profile, milk yield and milk composition in goats browsing a Mediterranean shrubland. Livest. Prod. Sci., 61,
267-273
Congiu F. (1981): Utilizzazione della macchia mediterranea in Sardegna con l’allevamento caprino. Riv. Zoot. e Vet., 9, 30-35
Dattilo M., Congiu F. (1973): Effetti della somministrazione di concentrati sulla produttività degli ovini da latte. Studi Sassaresi,
Sez. III, XXI, 1-23
Marongiu M. L., Santucci P. M., Branca A., Bomboi G., Floris B. (2003): Pratiche di alimentazione nell’allevamento caprino
estensivo mediterraneo. Atti Fe.Me.S.P.Rum. 11, in print
Santucci P.M., Maestrini O. (1985): Body condition in extensive systems of production: method of estimation. Ann. de Zoot., 34,
473-474 (Abstr.)
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
45
ELECTRONIC IDENTIFICATION IN TRANSITION GOATS
Pinna W.1, Sedda P.1, Moniello G. 1, Nieddu G. 1, Solinas I.L.2
Sezione di Produzioni Animali, Dipartimento di Biologia Animale, Università di Sassari,
Via Vienna, 2 - 07100 Sassari – Italy, E-mail: [email protected];
2
Joint Research Center(CE) – Institute for the Protection and the Security of the Citizen- NonProliferation and Nuclear Safeguards Unit, Via Enrico Fermi,1 – 21020 - Ispra (VA) – Italy
1
Abstract
During 8 weeks in the phase of transition the effects of the administration of the bolus on well-being of the animals, the
permanence of the bolus and the readability of the transponder were evaluated in Sardinian goats. The study has been
carried out with two objects: 1) to estimate the effect of the administration of the ceramic bolus contained a transponder
employed for the identification electronic in goats during the last period of pregnancy; 2) to estimate the permanence
of the bolus during the delivery and during the period of breast-rearing of kids. The experiment was performed in the 4
weeks before the delivery and 4 successive during breast-rearing of kids. Altogether 435 boluses, respective to 275 adult
and 160 to primiparous goats, were administrated. The localization of the bolus in the reticulum has been confirmed,
immediately after the insertion, using a portable reader. 1, 7, 14 and 28 days after the delivery, the presence of the bolus
and the readability of the transponder, has been controlled, using a corridor of reading and a fixed reader. The delivery’s day
the presence of the bolus and the readability of the transponder have been assessed, in every goat, using a portable reader.
The well-being of the animals not were influenced by the operations of insertion of the bolus during the last phase of the
pregnancy and the presence of the bolus by the successive phase of natural rearing of the kids. During the considered period
an adult goat loosed the bolus in the day of the delivery: 0.23% of boluses administerated. The delivery represents therefore
one, even though minimal, cause of loss of the bolus in goats.
Keyword(s): electronic identification; ruminal bolus; transition goat, delivery, natural rearing
IDENTIFICAZIONE ELETTRONICA NELLE CAPRE DURANTE LA FASE DI TRANSIZIONE
Riassunto
Sono stati valutati, in un allevamento di capre di razza sarda, durante il periodo di transizione, compreso tra le 4 settimane
precedenti e le 4 settimane successive al parto, gli effetti della somministrazione del bolo sul benessere degli animali, la
permanenza del bolo e il regolare funzionamento del transponder utilizzati per l’identificazione elettronica degli animali.
La sperimentazione è stata effettuata con i seguenti obiettivi: 1) valutare eventuali controindicazioni alla somministrazione
del bolo ceramico durante l’ultimo periodo di gravidanza nelle capre; 2) verificare la permanenza del bolo dopo il parto;
3) valutare gli effetti durante l’allattamento naturale dei capretti. A diverse distanze dal parto, sono stati somministrati
in totale 435 boli: 275 a capre adulte e 160 a capre primipare. La localizzazione del bolo nel reticolo immediatamente
dopo la somministrazione è stata rilevata utilizzando un lettore portatile. 1, 7, 14 e 28 giorni dopo la somministrazione
del bolo e dopo il parto, la presenza del bolo e il funzionamento del transponder, sono stati verificati con un sistema di
lettura dinamico, utilizzando un corridoio di lettura e un lettore fisso munito di antenna. Per ogni capra, lo stesso giorno
del parto, la presenza del bolo e il funzionamento del transponder è stata accertata utilizzando un lettore portatile. Lo stato
di benessere degli animali, durante la fase finale della gravidanza e nella successiva fase di allattamento naturale dei capretti,
non ha risentito delle operazioni di somministrazione del bolo e delle successive letture di controllo. Durante l’intero
periodo preso in esame, di complessivi 56 giorni e che pertanto abbraccia l’intera fase di transizione, si è registrato un solo
caso di perdita del bolo pari a 0,23 % del totale dei boli somministrati. Il bolo è stato perso da una capra adulta nel giorno
del parto. Il parto rappresenta pertanto una seppur minima, causa di perdita del bolo ceramico nelle capre.
Parole chiave: identificazione elettronica; bolo ruminale; capre; fase di transizione; allattamento
Introduzione
Nella specie caprina, per cause ancora non ben definite, la perdita del bolo ceramico che funge da supporto protettivo
del transponder utilizzato per l’identificazione elettronica dei ruminanti, risulta essere maggiore rispetto a quella che si
registra nei bovini e negli ovini (5, 6, 7). In una precedente sperimentazione Pinna et al. 2002 (4) avevano evidenziato
l’eliminazione del bolo durante le fasi del parto in una capra pluripara.
La presente prova sperimentale è stata effettuata al fine di valutare:
a) le eventuali controindicazioni conseguenti alla somministrazione del bolo ad animali gravidi a diverse distanze dal
parto;
b) l’effetto del parto sulla permanenza del bolo ceramico nel reticolo;
c) eventuali effetti legati alla presenza del bolo nelle capre durante l’allattamento dei capretti.
Materiali e metodi
La ricerca ha interessato un totale di 490 capi allevati in 3 aziende caprine condotte con sistema di allevamento estensivo:
1 in provincia di Cagliari e 2 nella provincia di Nuoro. Tutti i soggetti erano iscritti al libro genealogico delle capre di
razza sarda presso l’Associazione Provinciale degli Allevatori di Cagliari e Nuoro. Complessivamente sono stati identificati
elettronicamente 435 soggetti (88,77% del totale), di cui 275 (63,22%) capre pluripare e 160 (36,78%) primipare. I
restanti 55 capi (11,23%) sono stati utilizzati come gruppo di controllo. È stato usato un bolo ruminale (RUMITAG bolus®)
costituito da un involucro esterno di ceramica atossico ad alto peso specifico (>3,3 g/cm³) contenente un transponder passivo
con tecnologia HDX (Tiris 32 mm) con funzione di identificatore elettronico. La forma cilindrica e il polo arrotondato
del bolo agevolano la sua progressione nel tratto oro-esofageo mentre le dimensioni e il peso specifico consentono la sua
localizzazione permanente nel reticolo degli animali. Sono stati utilizzati due tipi di lettore di transponder: un modello
46
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
portatile (Gesreader 2 S ISO®) per le letture statiche, usato direttamente dall’operatore al momento della marcatura degli
animali; un lettore statico (Gesimpex transportable F 210 reader) per le letture dinamiche dotato di antenna (Tiris GO3C),
collegata ad un personal computer portatile. Per questo tipo di lettura l’antenna veniva posizionata sul lato sinistro di un
corridoio mobile, allestito immediatamente prima della lettura, dove gli animali venivano fatti transitare, uno alla volta,
nello spazio utile di lettura dell’antenna, di circa 80 cm. Al momento del passaggio dell’animale il codice di identificazione
di ciascun soggetto veniva visualizzato sullo schermo e memorizzato su personal computer portatile dotato di apposito
software (Manga v 5.3).
Per tutti i soggetti muniti di identificatore elettronico le letture di controllo per verificare la presenza del bolo e il
funzionamento del transponder sono state effettuate a diverse distanze dal parto, con il sistema dinamico. Successivamente,
in base alla data del parto, gli animali sono stati raggruppati ascrivendoli a: - 28, -14, - 7 e -1 giorni precedenti il parto.
Dopo il parto le letture si sono succedute a scadenza settimanale. Si è dunque considerato un periodo complessivo di 56
giorni, definito comunemente negli animali da latte fase di transizione in quanto include la fine della gravidanza e l’inizio
della lattazione, e che in questo caso ha interessato 28 giorni antecedenti e successivi al parto. Per ciascun animale una volta
conclusosi il parto, lo stesso giorno, venivano accertati mediante lettore manuale, la presenza del bolo e il funzionamento
del transponder.
Risultati
La tabella 1 riporta la distanza dal parto al momento della somministrazione del bolo ceramico e i risultati delle letture
di controllo nel periodo pre-partum. Per quanto concerne eventuali ripercussioni negative imputabili alle manipolazioni
per l’apposizione del bolo agli animali, alle diverse distanze dal parto considerate, si può mettere in risalto che non si è
verificata complicazione alcuna, neanche in quelle capre che hanno ricevuto il bolo a conclusione della gravidanza e che
hanno partorito il giorno successivo.
La tabella 2 riporta i risultati delle letture di controllo e delle perdite registrate nel periodo post-partum. Si è verificato
un caso, unico, di perdita del bolo. Una capra di circa 2 anni di età, che aveva partorito un solo capretto, ha rigurgitato il
bolo lo stesso giorno del parto. Il bolo era stato somministrato 28 giorni prima del parto.
La tabella 3 riporta un quadro complessivo dei risultati ottenuti nell’intero periodo sperimentale. Sono stati presi in
considerazione: incidenti di somministrazione, animali morti, aborti, incidenti durante il parto, letture di controllo
eseguite con successo, perdite del bolo da parte degli animali. Nelle 4 settimane precedenti al parto non si è registrato alcun
incidente di somministrazione, morte di animali, aborto. In quelle successive nessun inconveniente durante l’allattamento
dei capretti. Nel complesso si può affermare che lo stato di benessere degli animali durante la fase finale della gravidanza
non ha risentito delle operazioni di somministrazione del bolo, della sua presenza nel comparto gastrico anteriore delle
letture di controllo. Analogamente, nella successiva fase di allattamento dei capretti, non si sono registrati disturbi dovuti
alla presenza del bolo o in occasione delle letture di controllo. I risultati ottenuti ci inducono a ritenere: che le manualità
di somministrazione del bolo durante la gravidanza, anche se queste avvengono nell’immediata prossimità del parto, non
presentano, se correttamente eseguite, controindicazioni di tipo generale sul benessere degli animali; la presenza del bolo
non comporta disturbi durante l’allattamento dei capretti.
L’unico episodio di perdita del bolo riscontrato in questa nota, che conferma anche quanto descritto nella precedente
ricerca (4) si ritiene dovuto al seguente meccanismo d’azione. Le forti e ripetute contrazioni della muscolatura addominale
e diaframmatica che si verificano durante il parto inducono, nei soggetti che perdono il bolo, un brusco stimolo sul reticolo
provocando, in un primo momento il ritorno del bolo dal reticolo nel rumine. Dal rumine, successivamente, mediante
il rigurgito, il bolo ripercorre, a ritroso, la via d’ingresso: passa dal rumine all’esofago e quindi alla bocca da dove viene
eliminato all’esterno. Si determina in tal modo la perdita da parte dell’animale.
Conclusioni
Anche in questa prova sperimentale, nella razza Sarda si confermano, complessivamente, percentuali di perdita del bolo
inferiori a quelle riportate da altri AA per altri tipi genetici di capre. Il caso di perdita del bolo ceramico registrato in questa
sperimentazione, unitamente a quello precedentemen
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
47
te descritto, ci inducono a ritenere il parto un’effettiva, seppur minima, causa di perdita del bolo nelle capre. Non risultano,
al momento, evidenze statistiche di effetti imputabili all’ordine di parto, cioè di una maggiore o minore probabilità di
perdita del bolo delle capre pluripare rispetto a quelle primipare anche se, in entrambi i casi descritti, i soggetti che
hanno perso il bolo, nel giorno del parto, erano capre pluripare. Nei due casi riportati la perdita del bolo è direttamente
imputabile a fattori legati al parto. Tale interpretazione viene ulteriormente avvalorata dal fatto che la somministrazione del
bolo era avvenuta un tempo sufficientemente lungo prima del parto, rispettivamente 28 e 242 giorni.
Bibliografia
1. CAJA G., CONILL C., NEHERING R., and RIBÓ O. (1999). Development of a ceramics bolus for the permanent electronic
dentification of sheep, goat and cattle. Comput. Elect. Agric. 24 pp45-63.
2. FERRI N., DI FRANCESCO C., MONACO F., EGIZI F. (2001). Identificazione elettronica negli ovini: sperimentazione di un
prototipo di supporto ceramico elettronico a localizzazione endoruminale. Large Animals Review, Anno 7, n 2, 37 - 40.
3. KIMBERLING C.V., (1993). Identification of sheep and its associated cost. In: Proceedings ofthe 1993 symposium on the health
and disease of small ruminats. June 12-13, 1993. AASRP. Jackson Hole, Wyoming, pp. 48-51.
4. PINNA W., MONIELLO G. , SOLINAS I.L. , SEDDA P., BITTI P.L. (2002). Electronic identification of goats bred in extensive
system in Sardinia (Italy). Atti X Congresso Fe Me.S.Rum., Tunis (Tunisie) 22-24 sett 2002.
5. RIBÒ I ARBOLEDAS J.O. (1996). Identificación electrónica en ganado ovino i caprino: factores que afectan a la implantación
de transponders y eficacia de lectura en condiciones de campo. Tesis doctoral Facultat de Veterinaria, Universitat Autonoma de
Barcellona.
6. RIBÓ O, CROPPER M., KORN C., POUCET A., MELONI U., CUYPERS M. & DE WINNE P. (2000). Preliminary results
on electronic identification in sheep and goat in the IDEA project (Identification electronique des animaux). Book of abstracts of 51st
Annual Meeting of the European Association for Animal Production (EAAP), 21-24 August, The Hague Book of abstracts No.6.
Wageningen Pers, The Netherlands, 318 pp.
7. RIBÓ O., CAJA G., NEHRING R., (1994). A note on electronic identification using transponders placed in permanent ruminal
bo1us in sheep and goats. In: Electronic identification of farm animals using implantable transponders. UE DG VI-FEOGA, Research
Project, Final Report, VoI. l, December, 1994.
Tabella 1 - Distanza dal parto al momento della somministrazione del bolo ceramico e risultati delle letture di
controllo nel periodo pre-partum
Giorni
Capre pluripare
dal parto N= (275)
%=100
- 28
155
(56,3%)
123
(76,88%)
278
(63,91%)
-14
79
(28,7%)
30
(18,75%)
109
(25,05%)
-7
30
(11%)
7
(4,37%)
37
(8,51%)
(4%)
0
(0%)
11
(2,53%)
-1
48
Perdite
Capre primipare
Perdite
Totale capre
pluripare N= (160)
%=100 primipare N= 435
%=100
11
Totale
perdite
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Tabella 2- Risultati delle letture di controllo e delle perdite registrate nel periodo post-partum
Giorni
dopo il
parto
Capre pluripare
letture con successo
N= (275)
%=100
0
274
(99,63)
+1
274
+7
Capre primipare
Perdite
letture
pluripare N= (160)con successo
%=100
1
160
( 100)
(99,63)
160
274
(99,63)
+ 14
274
+ 28
274
Totale capre
Perdite
letture
primipare N= 435 con successo
%=100
0
434
(99,77)
( 100)
434
(99,77)
160
( 100)
434
(99,77)
(99,63)
160
( 100)
434
(99,77)
(99,63)
160
( 100)
434
(99,77)
Totale
perdite
1
Tabella 3 – Quadro complessivo delle evidenze sperimentali rilevate nell’intero
periodo considerato di 56 giorni di fase di transizione
N°
%
Animali
Capre pluripare
Capre primipare
Totale capre
160
435 (100%)
275
(63,22%)
(36,78%)
Incidenti di somministrazione
0
(0%)
0
(0%)
0
(0%)
Animali morti
0
(0%)
0
(0%)
0
(0%)
Aborti dovuti alla
somministrazione
0
(0%)
0
(0%)
0
(0%)
Incidenti durante il parto
0
(0%)
0
(0%)
0
(0%)
Letture di controllo regolari
274
(99,64%)
160
(100%)
434
(99,77%)
Perdite del bolo
1
(0,36%)
0
(0%)
1
(0,23%)
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
49
VALORI LATTODINAMOGRAFICI E CONTENUTO IN CELLULE SOMATICHE
NELLA PECORA DA CARNE.
TIME-COURSE VALUES OF THE MILK COMPONENTS AND SOMATIC CELLS CONTENT
IN THE MEAT SHEEP.
Alessi A.1, Aliberti A.1, Cirone F.4, Scatassa M.L.2, Foti M.1, Rinaldo D.1, Garofalo L.3, Buonavoglia D.1
1)
2)
3)
4)
Dip. di Sanità Pubblica Veterinaria, sez. Malattie Infettive, Facoltà di Medicina Veterinaria - Messina
Istituto Zooprofilattico Sperimentale “A. Mirri” – Palermo
Libero professionista
Dipartimento di Sanità e Benessere Animale, Facoltà di Medicina Veterinaria – Valenzano (Bari)
Riassunto
Gli Autori riportano i risultati di una ricerca condotta su 72 pecore di razza Bergamasca, al fine di determinare l’andamento
del contenuto di cellule somatiche (CCS) ed i valori lattodinamografici nella pecora da carne.
In totale sono stati esaminati circa 3500 campioni di latte, prelevati ogni 3 giorni dalle singole emimammelle, per tutto il
periodo della lattazione (90 giorni).
Su ogni campione di latte è stato effettuato l’esame batteriologico, il California Mastitis Test (CMT), la conta delle cellule
somatiche e la determinazione di grasso, proteine e lattosio.
Mediante l’analisi della distribuzione di frequenza, si è potuto valutare che all’inizio della lattazione il CCS si attesta su
valori compresi tra 100.000 e 125.000, mentre da metà lattazione in poi, fino alla messa in asciutta, il numero di cellule
somatiche aumenta progressivamente.
Il valore medio fisiologico del CCS durante l’intera lattazione è risultato pari a 120.000 cell/ml-1.
Per quanto riguarda i valori lattodinamografici, il contenuto di grasso ha avuto un andamento sovrapponibile a quello
delle cellule somatiche; il valore proteico è aumentato fino alla 4a settimana e si è poi mantenuto stabile fino alla messa
in asciutta, mentre il lattosio, dopo aver raggiunto il suo valore massimo verso la 5a settimana, ha fatto registrare un calo
progressivo per tutto il resto della lattazione.
Summary
The Authors report the results of a research performed on 72 sheep of Bergamasca breed, to determine the variation of
the somatic cells content (SCC) and the time-course of the values of the milk components in the meat sheep. A total of
3.500 milk samples, collected with a 3-day-interval from each udder over the all lactation period (90 days), have been
examined.
Each samples was tested by bacteriological examinations, by the California Mastitis test (CMT), by evaluation of the SSC
and by quantification of fats, proteins and lactose.
By analysis of the frequency distribution it was possible to observe that at the beginning of lactation the SCC ranges
between 100.000 and 125.000, whereas, by the second half to the end of lactation, the SCC progressively rises. The mean
physiologic value of the SCC during lactation was as high as 120.000 cells/ ml-1.
As regards the time-course of the values of the milk components, the content of fats followed the same time-course as the
SCC; the protein content increased up to the 4th week and thereafter was stable until the end of lactation; the lactose value,
after reaching a peak at the 5th week, progressively decreased until the end of lactation.
Introduzione
L’allevamento della pecora da latte, negli ultimi vent’anni è stato oggetto di studi da parte dei ricercatori riguardo alla
produzione e alla qualità del latte (Sevi A. et al., 2000; Gonzalo C. et al., 1994; Fuertes J. A. et al., 1998), finalizzato al
miglioramento della resa alla caseificazione.
Nell’ambito dell’allevamento ovino, la pecora da carne, pur non rientrando nella filiera della produzione di latte ai fini della
trasformazione, riveste un ruolo importante in quanto le caratteristiche del latte prodotto sono alla base dell’accrescimento
ponderale dell’agnello .(Ahmad G. et al., 1992; Fthenakis G. et al., 1990; Keisler D.H. et al., 1992).
Come per la pecora da latte, anche in quella da carne, i parametri presi in considerazione ai fini della valutazione qualitativa
del latte prodotto sono le cellule somatiche (CCS), il contenuto di proteine, grasso e lattosio.
Nella presente ricerca è stato condotto uno studio, in pecore di razza Bergamasca, sulle caratteristiche cito-chimiche del
latte prodotto e sull’andamento fisiologico del CCS ed i valori lattodinamografici durante tutto il periodo di allattamento
dell’agnello, al fine di ricavarne un modello base sulle cui variazioni poter valutare lo stato sanitario della mammella.
Materiale e metodi
Animali - La ricerca è stata condotta su 72 pecore di razza Bergamasca, appartenenti a due allevamenti della Sicilia Orientale.
Gli animali del gruppo sperimentale erano esenti da mastite e la scelta è stata effettuata mediante esame clinico generale
e particolare della mammella, nonché mediante esame batteriologico del latte per la ricerca di patogeni responsabili di
mastite.
Protocollo sperimentale
Campioni – In totale sono stati esaminati 3.456 campioni di latte, prelevati sterilmente, previa disinfezione dei capezzoli
50
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
con salviettine imbevute di clorexidina.
I prelievi sono stati effettuati due volte a settimana, da ogni emimammella, a partire dal 3° giorno post-partum e per tutto
il periodo dell’allattamento dell’agnello (12 settimane).
California Mastitis Test (CMT) – Prima della determinazione del CCS e dei parametri lattodinamografici, su ogni campione
di latte è stato effettuato il test CMT secondo Schalm et al. (1971).
Esame batteriologico – I campioni di latte risultati positivi al test CMT sono stati sottoposti ad esame batteriologico per
la ricerca di microrganismi responsabili di mastite, al fine di escludere dal gruppo sperimentale gli animali infetti. Solo i
campioni batteriologicamente negativi sono stati sottoposti al conteggio delle cellule somatiche e alla determinazione dei
parametri lattodinamografici.
Cellule Somatiche (CCS), grasso, proteine e lattosio - La conta delle cellule somatiche è stata effettuata con Fossomatic
(metodo fluoro-opto-elettronico) su 50 ml di latte addizionato con 100µl di Azidiol, mentre la determinazione del grasso,
proteine e lattosio è stata effettuata con Milko-scan (spettrofotometria ad infrarossi).
Analisi statistica - I risultati ottenuti sono stati analizzati con software Microsoft Excel 2000, con P< 0.05, previa verifica
della aleatorietà del campionamento (test di Cox e Stuart) e della normalità della popolazione(X2).
Risultati
Nessun animale del gruppo sperimentale ha contratto infezione nel periodo della ricerca.
Cellule somatiche – La variabilità del CCS (C.V. = 89%), compresa tra i valori di 12.000 e 886.000 cell/ml-1, è risultata
discreta; la media del CCS nel periodo preso in considerazione è stata di 120.443 cell/ml-1. Per le prime 3 settimane di
lattazione, il valore medio di cellule è stato di 125.000/ml-1; tra la 4° e la 7° settimana, il valore è rimasto stabile su 54.000/
ml-1 mentre, nelle ultime cinque settimane, è stato osservato un aumento progressivo, fino alla fine della lattazione (12a
settimana), raggiungendo il valore di 207.000 cell/ml-1. (Tabella 1)
Tab. 1 – Valori contenuto cellule somatiche
Settimana
CCS/ml
1
2
3
4
5
125234
105875
115541
54250
60541
6
7
8
9
10
11
12
86083
102750
125250
133541
159666
169041
207541
E.S.
22410
18430 16668.7
8161
12627
13392
17458
35599
24218
17918
21624
22772
D.S.
109788
90290 81659.9
39980
61863
65608
85530
174402
118645
87781
105937
111561
Val. min
16000
27000
45000
15000
15000
29000
13000
12000
34000
37000
29000
45000
Val max
426000
419000
420000
206000
320000
242000
381000
886000
577000
364000
379000
380000
L.F. (95%)
46359
38126
34481
16882
26122
27703
36116
73643
50099
37066
44733
47107
Grasso - La media del contenuto di grasso è risultata pari al 3,4% e la variabilità, compresa tra i valori di 1,1 e 9,1
%, è risultata molto bassa (CV<15%). All’inizio della lattazione il contenuto di grasso riscontrato è stato del 4,6%.
Successivamente si è registrata una graduale riduzione fino alla quarta settimana, dove il valore si è mantenuto stabile tra
2,2 e 2,5% fino all’ottava settimana; da questo momento in poi, fino alla fine della lattazione, il grasso ha fatto registrare
un graduale aumento, fissando il suo valore al 4,39%.
Tab. 2 – Valori contenuto di grasso
Settimana
1
2
3
4
5
6
7
8
9
10
11
12
Grasso %
4.639
3.980
3.322
2.218
2.573
3.446
2.996
2.546
3.792
3.115
3.751
4.388
E.S.
0.298
0.225
0.358
0.167
0.146
0.355
0.167
0.139
0.164
0.214
0.236
0.297
D.S.
1.458
1.100
1.755
0.817
0.718
1.740
0.819
0.679
0.801
1.050
1.154
1.455
Val. min
2.372
1.923
1.147
1.100
1.483
1.425
1.767
1.274
2.370
1.211
1.465
1.718
Val max
7.331
6.025
9.001
4.334
4.334
7.661
4.930
4.205
5.267
4.723
5.807
6.890
L.F. 95%
0.616
0.465
0.741
0.345
0.303
0.735
0.346
0.287
0.338
0.443
0.487
0.614
Proteine - Il contenuto medio di proteina grezza è stato pari al 5,5%. La variabilità, compresa tra il 3,3 ed il 7,7% è stata
ritenuta poco significativa (CV< 15%).
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
51
Tab. 3. – Valori contenuto proteine
Settimana
1
2
3
4
5
6
7
8
9
10
11
12
Proteine %
5.009
5.083
5.271
5.459
5.575
5.425
5.627
5.830
5.907
5.508
5.690
5.872
E.S.
0.133
0.108
0.101
0.111
0.108
0.105
0.111
0.123
0.161
0.111
0.117
0.137
D.S.
0.652
0.527
0.495
0.544
0.530
0.514
0.542
0.605
0.791
0.545
0.575
0.670
val. min
3.259
4.030
4.315
4.600
4.697
4.271
4.533
4.795
4.688
4.456
4.741
4.970
val max
5.834
5.873
6.292
6.960
6.899
6.596
6.934
7.271
7.739
6.773
7.058
7.343
L.F. 95%
0.275
0.222
0.209
0.230
0.224
0.217
0.229
0.255
0.334
0.230
0.243
0.283
Lattosio – Il contenuto medio del lattosio è stato pari al 4.9%, con coefficiente di variabilità molto basso (CV<15%)
calcolato entro i valori di 2,9 e 5,3%. Il valore è aumentato progressivamente fino alla 5° settimana, per poi decrescere
gradualmente, stabilizzandosi ai livelli iniziali, verso la fine della lattazione.
Tab. 4 – Valori contenuto lattosio
Settimana
1
2
3
4
5
6
7
8
9
10
11
12
Latt %
4.843
4.888
5.011
5.032
5.052
5.011
4.981
4.952
4.805
4.919
4.872
4.825
E.S.
0.095
0.063
0.027
0.026
0.028
0.030
0.058
0.091
0.030
0.035
0.037
0.043
D.S.
0.464
0.308
0.132
0.128
0.136
0.145
0.285
0.445
0.148
0.170
0.181
0.210
Val. min
3.392
4.034
4.780
4.856
4.856
4.518
3.727
2.936
4.505
4.548
4.579
4.406
Val max
5200
5279
5270
5306.5
5343
5273
5203
5256
5153
5270
5226.5
5183
L.F. 95%
0.196
0.130
0.056
0.054
0.057
0.061
0.120
0.188
0.063
0.072
0.076
0.089
Conclusioni
Dai risultati ottenuti è emerso una variabilità molto significativa per quanto riguarda il CCS, evidente verso fine
lattazione, probabilmente per l’effetto concentrazione che ne deriva (CV= 89%), mentre una variabilità poco significativa
è stata riscontrata a carico dei valori lattodinamografici (grasso, proteine, lattosio).
Non bisogna escludere, in questo caso, che la variabilità del CCS potrebbe essere associata a fattori fisiologici quali l’età,
stadio della lattazione e approssimarsi dell’asciutta.
Durante il periodo della lattazione, sia l’andamento delle proteine che del grasso sono positivamente correlati con il CCS (r
= 0.22; P<0.05) (r = 0.32; P<0.0001); contemporaneamente è stata osservata una dipendenza lineare inversa lattosio/CCS
(r = -0.27; P<0.005) e lattosio/grasso (r = -0.24; P<0.02).
Infine si è potuto valutare l’andamento fisiologico del CCS e dei valori lattodinamografici, nonché le caratteristiche citochimiche del latte in una razza di pecora da carne, durante una lattazione completa, in animali sani che non avevano mai
subito l’infezione da parte di microrganismi responsabili di mastite. In base ai risultati ottenuti è emerso che, l’andamento dei
valori lattodinamografici e del CCS nella pecora da carne è sovrapponibile a quello gia osservato nella pecora da latte; inoltre è
stato possibile ricavare un modello base dei suddetti valori sulle cui variazioni, eventualmente indotte da patogeni responsabili
di mastite, poter valutare, in ogni momento della lattazione (Albenzio M. et al., 2002), lo stato sanitario della mammella.
Bibliografia
Ahmad G., Timms L.L., Morrical D.G., Brackelberg P.O – Dynamic and significance of ovine subclinical intramammary
infections and their effects on lamb performance. – Sheep Res. J. 1992; 8:25-29
Albenzio A., Taibi L., Muscio A., Sevi A. – Prevalence and etiology of subclinical mastitis in intensively managed flocks
and related changes in the yield and quality of ewe milk. – Small Rumin. Res. 2002. 43:219-226
Fthenakis G., Jones J. E. T. – The effect experimentally induced subclinical mastitis on milk yeld of ewes and on the growth
of lambs. – British Vet. J. 1990; 146:43-49
Fuertes JA, Gonzalo C, Carriedo JA, San Primitivo F. - Parameters of test day milk yield and milk components for dairy
ewes. J Dairy Sci 1998; 81(5):1300-7
Gonzalo C., Carriedo J. A., Baro J.A., San-Primitivo F. – Factors influencing variation of test day milk yield, somatic cell
count, fat and protein in dairy sheep. – J Dairy Sci. 1994. 8:1537-1542
Keisler D.H., Andrews M.L., Moffatt R.J. – Subclinical Mastitis in ewes and its effect on lamb performance. – J. Anim.
Sci. 1992; 70:1677-1681
Schalm O.W., Carroll E.J., Jain N.C. – Bovine mastitis . – Lea and Febinger, Philadelphia 1971
-Sevi A., Taibi L., Albenzio M., Muscio A., Annicchiarico G. – Effect of parity on milk yield, composition, somatic cell
count, renneting parameters and bacteria counts of Comisana ewes. – Small Rumin. Res. 2000; 37:99-107
52
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ATTI
VENERDÌ 23 MAGGIO 2003
SEROPREVALENCIA DE OESTROSIS EN OVINOS SARDOS MEDIANTE
ELISA-INDIRECTO
Díez-Baños, P., Morrondo, P., Chighine, C., Paz-Silva, A., Suárez, J.L., Sardo, D., Sánchez-Andrade, R., Scala, A.,
IPODERMOSI BOVINA: PROGRAMMA DI MASSIMA PER LA MESSA A PUNTO
DI UN PIANO DI CONTROLLO IN SARDEGNA.
Sardo D., Piazza C., Polinas L., Scala A.
LA DIAGNOSI DELLA DICROCOELIOSI OVINA:
METODICHE COPROMICROSCOPICHE A CONFRONTO.
Chighine C., Marchi B., Cancedda M.G., Piazza C., Scala A.
LA CENUROSI IN SARDEGNA:
RILIEVI EPIDEMIOLOGICI, PARASSITOLOGICI E ISTOPATOLOGICI.
Cancedda M.G.; Chighine C.; Varcasia A.; Ligios C.; Scala A.
EPISODIO DI CENUROSI IN PECORE ADULTE IN PROVINCIA DI VITERBO (ITALIA)
OUTBREAK OF COENUROSIS IN ADULT SHEEP IN VITERBO’S DISTRICT (ITALY)
Tarantino C., Taccini E. , Corazza M. , De Santis B. , Braca G.
AGGIORNAMENTI SULL’EPIDEMIOLOGIA DI ECHINOCOCCUS GRANULOSUS
IN SARDEGNA: DATI PRELIMINARI
Piazza C., Sardo D., Garippa G., Scala A., Varcasia A.
OSSERVAZIONI ANATOMO-ISTOPATOLOGICHE DI UN FOCOLAIO DI
CISTICERCOSI IN BOVINI IMPORTATI
Preziuso S., Taccini E., Pardini S., Braca G.
EFFECT OF ENVIRONMENTAL TEMPERATURE ON SOME BLOOD PARAMETERS
Morgante M., Stelletta C., Tacchio G.
XI Congresso
Internazionale
della Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
53
54
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
SEROPREVALENCIA DE OESTROSIS EN OVINOS SARDOS MEDIANTE ELISA-INDIRECTO
Sánchez-Andrade, R., Díez-Baños, P., Morrondo, P., Chigine, C.1, Paz-Silva, A., Suárez, J.L., Sardo, D.1, Scala, A.1
Parasitología y Enfermedades Parasitarias, Facultad de Veterinaria, Universidad de Santiago de Compostela, 27002-Lugo
(SPAIN). 1Sezione di Parassitologia, Dipartimento di Biologia Animale, Facoltà di Medicina Veterinaria,
Università degli Studi di Sassari (Sardegna, Italia).
Resumen
La oestrosis es una miasis obligatoria que afecta al ganado ovino, y que se da con mayor frecuencia en zonas de clima seco y
cálido, como el que se encuentra en la isla de Cerdeña (Italia). Entre los meses de mayo y septiembre de 2001, se recogieron
muestras de sangre de 697 ovejas de 52 explotaciones de Cerdeña, con un manejo semi-extensivo. Los sueros se procesaron
mediante un ELISA-indirecto con antígeno de excreción/secreción de larvas 2 de Oestrus ovis. En función de la altitud a la
que estaban situadas las explotaciones, se establecieron 2 grupos, G-1 (0-500 m) y G-2 (>500 m).
Con el ELISA-indirecto se comprobó que el 82’2% de las ovejas eran positivas a oestrosis, oscilando las densidades ópticas
entre 0’05 y 4’36, con un valor medio de = 1’39 ± 0’75. El porcentaje de ovejas positivas fue del 79’5% en el G-1 y
86’2% en el G-2, obteniéndose diferencias estadísticamente significativas con ANOVA (F= 9’968, p= 0’001). Se obtuvo
correlación significativa de signo negativo entre la altitud y los valores de IgG (r2= -0’1, p= 0’001). Todos los rebaños
estudiados tenían al menos una oveja con valores positivos de anticuerpos frente a O. ovis. Teniendo en cuenta que la
oestrosis es además una zoonosis, nuestros resultados indican la necesidad de establecer un programa de control adecuado
para limitar la distribución de esta parasitosis.
Abstract
The oestrosis is an obligatory miasis affecting to the ovine livestock in dry and temperate areas, like in the Island of Sardinia
(Italy). From May to September 2001, blood samples where recovered from 697 sheep belonging to 52 farms in Sardinia,
maintained under field conditions. Sera were analyzed by an indirect-ELISA and Oestrus ovis excretory/secretory antigens.
According to the altitude where the farms were located, two groups were considered, G-1 (0-500 m) and G-2 (>500 m).
We observed the 82.2% of the sheep were positive to oestrosis, and the absorbances ranged between 0.05 and 4.36 with
an average of = 1.39 ± 0.75. The percentage of sheep with positive antibody values to the O. ovis excretory/secretory
antigens was 79.5% in G-1 and 86.2% in G-2. Significant differences were obtained in the prevalence in relation to the
altitude (F= 9.968, p= 0.001). We proved a negative significant correlation between the altitude and IgG absorbances (r2=
-0.1, p= 0.001). All the evaluated flocks had one sheep positive to oestrosis at least. By considering these results, and that
oestrosis is a zoonosis, it seems very urgent to establish an appropriate control program to limit this parasitosis.
Introducción
La oestrosis es una miasis parasitaria que afecta al ganado ovino. Las larvas de Oestrus ovis son depositadas en las proximidades
de la cavidad nasal de las ovejas, emigran hacia los senos nasales, y una vez que maduran salen de nuevo al exterior para
pupar en la tierra. La infestación cursa con rinitis crónica y sinusitis (Goddard et al., 1999). Además también se observa
con frecuencia pérdida de apetito, emaciación y conjuntivitis. Marchenko et al. (1991) comprobaron que la infestación de
ovinos por O. ovis estimulaba la formación de anticuerpos que se podían detectar en el suero de los animales mediante un
ELISA-indirecto.
Se ha demostrado que la oestrosis es endémica en zonas de clima seco y cálido, como el que se encuentra en algunas regiones
de Italia (Scala et al., 2000; Caracappa et al., 2000), Francia (Yilma y Dorchies, 1991) o en algunos países de África (Horak
et al., 2001). Se trata además de una zoonosis, de modo que es muy importante conocer el alcance de esta parasitosis
(Pampiglione .et al., 1997).
El número de ovejas en Cerdeña (Italia) es de aproximadamente 3’5 millones. En el presente estudio se ha analizado la
seroprevalencia de oestrosis en ovinos de esta región mediante un ELISA-indirecto y antígeno de excreción/secreción de
larvas 2 de O. ovis.
Material Y Métodos
Entre los meses de Mayo y Septiembre de 2001, se recogieron muestras de sangre de 697 ovejas de aptitud lechera, de 52
explotaciones de Cerdeña. Los sueros se procesaron mediante un ELISA-indirecto con antígeno de excreción/secreción de
larvas 2 de O. ovis (Ouattara y Dorchies, 1991).
Las ovejas se explotan en régimen semi-extensivo, y sólo se mantienen en estabulación durante la noche y para el
ordeño. En función de la altitud a la que estaban situadas las explotaciones, se establecieron 2 grupos, G-1 (0-500
m) y G-2 (>500 m).
ELISA-indirecto
La determinación de la tasa de anticuerpos específicos frente a O. ovis se hizo mediante un ELISA-indirecto con antígeno
obtenido de productos de excreción/secreción (ES). Para la obtención del antígeno, se recogieron cabezas de ovejas en un
matadero de Sassari, y se extrajeron las larvas del parásito de los senos nasales.
En el laboratorio, las larvas 2 del parásito se lavaron varias veces en PBS, y a continuación mantuvieron a temperatura
ambiente durante 6 horas, en una solución de medio de cultivo RPMI, al que se añadió Ampicilina (25 µg ml-1) y
Cloramfenicol (30 µg ml-1) para evitar la contaminación microbiana, y un inhibidor de proteasas (PMSF) 2 mM para
disminuir el riesgo de proteolisis, lo cual haría que el antígeno quedase inservible. El líquido obtenido se centrifugó en un
rotor JA-20 a 4ºC y 40.000 x g durante un tiempo de 50 minutos, y a continuación se filtró el sobrenadante que resultó
del proceso anterior, y se conservó liofilizado hasta su empleo.
Con el fin de hallar la concentración óptima de cada antígeno que se utilizaría en las pruebas de inmunodiagnóstico,
y empleando el kit de valoración proteica BCA® (PIERCE), se estimó la cantidad de proteína del antígeno. Una vez
conocida la concentración, se probaron diluciones seriadas y se llevó a cabo un ELISA-indirecto empleando sueros testigo
positivos y negativos. Finalmente, se optó por la dilución de los antígenos con la que se obtuvieron las mayores diferencias
entre los valores de absorbancia de los sueros testigo positivos y negativos (Cuadro 1).
Cuadro 1.- Protocolo de la técnica ELISA-indirecto para detección de anticuerpos IgG frente a O. ovis.
1. Sensibilización placas.
Antígeno ES 3 µg ml-1
10-12 horas / 4ºC
2. Bloqueo puntos unión inespecífica.
PBS + Tween + leche desnatada
1 hora / 37ºC
3. Muestras problema.
Sueros 1/50
1 hora / 37ºC
4. Segundo anticuerpo.
Proteína G 1/1500
1 hora / 37ºC
5. Substrato.
OPD + citrato + H2O2
10 min. (oscuridad)
Resultados
Con el ELISA-indirecto se comprobó que el 82’2% de las ovejas eran positivas a la infestación, oscilando las densidades
ópticas entre 0’05 y 4’36, con un valor medio de = 1’39 ± 0’75. El porcentaje de ovejas positivas fue del 79’5% en el G-1
y 86’2% en el G-2, obteniéndose diferencias estadísticamente significativas con análisis de varianza (F= 9’968, p= 0’001).
Mediante el análisis de correlación de Pearson se comprobó que existía correlación significativa de signo negativo entre
la altitud y los valores de IgG (r2= -0’1, p= 0’001). Todos los rebaños estudiados tenían al menos una oveja con valores
positivos de anticuerpos frente a O. ovis.
Discusión
La existencia de valores positivos de anticuerpos frente a O. ovis pone en evidencia el contacto entre el parásito y el
hospedador (Scala et al., 2002). En el presente trabajo se ha evidenciado que el 82’2% de las ovejas analizadas tenían valores
positivos de anticuerpos frente a O. ovis, lo que coincide con los resultados de Ouattara y Dorchies (1996) en Burkina-Faso,
Murguía et al. (2000) en México y Alcaide et al. (2002) en Cáceres (España). Bauer et al. (2002) en Alemania obtuvieron una
prevalencia sensiblemente inferior, aunque es importante destacar que las condiciones climáticas de Cerdeña (temperaturas
cálidas y precipitaciones escasas) son más favorecedoras para el desarrollo de O. ovis que las que se presentan en el suroeste
de Alemania. En un estudio previo llevado a cabo en Sassari (Cerdeña, Italia), Scala et al. (2002) comprobaron mediante el
examen de cabezas de ovinos sacrificados en diferentes mataderos que el 73’8% tenían oestros.
En todos los rebaños estudiados se observó al menos una oveja positiva serológicamente frente al antígeno de O. ovis. Bauer
et al. (2002), en una encuesta epidemiológica llevada a cabo en Alemania, comprobaron que el 72’6% de los rebaños eran
positivos a oestrosis. En algunos estudios se ha comprobado que la presencia de anticuerpos no es un buen indicador de la
existencia de parasitación, revelando la exposición previa al parásito, y no el padecimiento de la enfermedad en el momento
de la toma de muestras (Sánchez-Andrade et al., 2000).
Fig. 1.- Prevalencia de oestrosis ovina mediante ELISA-indirecto en Cerdeña (Italia).
56
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Conclusiones
La seroprevalencia de oestrosis es muy elevada en los ovinos de la región de Cerdeña (Italia). Teniendo en cuenta su incidencia
sanitaria y económica, y que se trata además una zoonosis, y que los ganaderos pueden resultar infestados, estos resultados indican
la necesidad de establecer un programa de control adecuado para limitar la distribución de esta parasitosis.
Bibliografía
®
®
®
®
®
®
®
®
®
®
®
Alcaide, M., Reina, D., Sánchez-López, J., Romero, G., Sierra, M.A., Navarrete, I. Situación seroepidemiológica de la oestrosis
ovina en la provincia de Cáceres, España. Producción Animal 174, 5-13.
Bauer, C., Steng, G., Prevot, F., Dorchies, P. (2002). Seroprevalence of Oestrus ovis infection in sheep in southwestern Germany.
Veterinary Parasitology 110: 137-43.
Caracappa, S., Rilli, S., Zanghi, P., Di Marco, V., Dorchies, P. (2000). Epidemiology of ovine oestrosis (Oestrus ovis Linne
1761, Diptera: Oestridae) in Sicily. Veterinary Parasitology 92: 233-237.
Goddard, P., Bates, P., Webster, K.A. (1999). Evaluation of a direct ELISA for the serodiagnosis of Oestrus ovis infections in
sheep. Veterinary Record 144: 497-501.
Horak, I.G., Macivor, K.M., Greeff, C.J. (2001). Parasites of domestic and wild animals in South Africa. XXXIX. Helminth
and arthropod parasites of Angora goats in the southern Karoo. Onderstepoort Journal of Veterinary Research 68: 27-35.
Murguía, M., Rodríguez, J.C., Torres, F.J., Segura, J.C. (2000). Detection of Oestrus ovis and associated risk factors in sheep
from the central region of Yucatán, México. Veterinary Parasitology 88: 73-78.
Ouattara L, Dorchies P. (1996). Serological prevalence of Oestrus ovis infestation in Burkina Faso: evaluation using the ELISA
technique. Rev Elev Med Vet Pays Trop 1996;49(3):219-21.
Pampiglione, S., Gianetto, S., Virga, A. (1997). Persistence of human myasis by Oestrus ovis L. (Diptera: Oestridae) among
shepherds of the Etnean area (Sicily) for over 150 years. Parassitologia 39: 415-418.
Sánchez-Andrade, R., Paz-Silva, A., Suárez, J., Panadero, R., Díez-Baños, P., Morrondo, P. (2000). Use of a sandwichenzyme-linked immunosorbent assay (SEA) for the diagnosis of natural Fasciola hepatica infection in cattle from Galicia
(NW Spain). Veterinary Parasitology 93: 39-46.
Scala, A., Solinas, G., Barbieri, A. (2000). Estrosi degli ovini da Oestrus ovis in Sardegna: aggiornamenti epidemiologici. XIV
Congresso SIPAOC.
Scala, A., Paz-Silva, A., Suárez, J.L., López, C., Díaz, P., Díez-Baños, P., Sánchez-Andrade Fernández, R. (2002). Chronobiology
of Oestrus ovis (Diptera: Oestridae) in Sardinia, Italy: guidelines to chemoprophylaxis. Journal of Medical Entomology 39:
652-657.
Este trabajo ha sido financiado, en parte con una Beca de Investigación de la Xunta de Galicia (Xunta de Galicia, Spain, 2001) a
R. Sánchez-Andrade Fernández (PhD) y por el Proyecto de Investigación PGIDT00PX126102PR (Xunta de Galicia, Spain).
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
57
IPODERMOSI BOVINA: PROGRAMMA DI MASSIMA PER LA MESSA A PUNTO
DI UN PIANO DI CONTROLLO IN SARDEGNA.
BOVINE IPODERMOSIS: A BROAD PROGRAMME TO SET UP
A CONTROL PLAN IN SARDINIA.
Sardo D., Piazza C., Polinas L., Scala A.
Dipartimento di Biologia Animale, sezione di Parassitologia, Università degli Studi di Sassari.
Summary
Hypoderma spp. larvae exert an high parasitic pressure on cattle reared in Sardinia. Ipodermosis fly causes subcutaneous
miasis in beef cattle (35%), and in dairy farms (90%). These results require to set up a restoration plan, and its following
application is necessary to avoid economical damages to the whole cattle breeding. First point of the restoration plan is
to investigate current epidemiological parameters about this parasitosis in Sardinia. Aim of this research is to outline a
control plan about bovine Ipodermosis in Sardinia, trough a careful cost-and-benefit analysis, and a technical research of
its carrying out.
Introduzione
L’Ipodermosi bovina è una miasi obbligatoria sostenuta da larve di ditteri del genere Hypoderma appartenenti alla famiglia
Oestridae.
Le specie coinvolte sono H. bovis e H. lineatum. Gli insetti adulti vivono circa una settimana, durante la quale depongono
le uova nelle ore più calde della giornata, in un periodo da giugno ad agosto (Zumpt F., 1965). H. bovis infastidisce
notevolmente gli animali, che fuggono all’impazzata nei pascoli, perciò riescono a deporre solitamente un unico uovo per
pelo; H. lineatum arrivando dal suolo, invece limita la sua azione di disturbo, riuscendo così a deporre in un unico pelo
circa 5-15 uova in linea (Zumpt F., 1965). I bovini per difendersi da questi attacchi talvolta sostano con le zampe in raccolte
d’acqua o si rifugiano in zone ombrose, solitamente non frequentate dagli insetti adulti.
Dopo circa 4-7 gg dall’uovo si libera una larva L1 che, perforata la cute, inizia un lungo periodo di migrazione nell’organismo,
grazie alla sua conformazione anatomica e all’azione di collagenasi da essa prodotte (ipodermine) (Boulard C., 1989). Le
larve di H. bovis raggiungono il grasso peridurale del canale rachidiano in cui permangono per circa quattro mesi, mentre
quelle di H. lineatum raggiungono la sottomucosa esofagea. Dopo un lungo periodo di permanenza in questi distretti,
in cui si accrescono fino ad arrivare ad una lunghezza anche di 16-17 mm, raggiungono entrambe le specie il sottocute
della regione dorso lombare, in cui causano la comparsa di caratteristici noduli. In questo distretto maturano a larve L2
munite di placche respiratorie che segnano il passaggio ad un metabolismo di tipo aerobio. In questo stadio, infatti, le larve
determinano la comparsa di un foro all’apice del nodulo sottocutaneo attraverso il quale possono respirare. Il passaggio da
larva L2 a L3 è segnato da un evidente accrescimento volumetrico. Una volta diventata più scura, abbandona l’ospite per
impuparsi nel terreno e liberare, dopo circa 40 gg, l’insetto adulto.
EPIDEMIOLOGIA
L’Ipodermosi è presente in tutti i paesi europei con prevalenze d’infestione differenti. A prescindere dal patrimonio bovino
presente, quasi tutti i paesi europei hanno attuato un piano di controllo e/o eradicazione della malattia, anche se con criteri
e risultati diversi (Tarry D.W., 1986).
In Italia questa miasi è ampiamente diffusa e coinvolge una percentuale di allevamenti variabile dal 12,1% al 100% a
seconda della regioni (Puccini et al., 1996). Esistono tuttavia alcuni distretti nazionali come il Trentino, in cui la patologia
sembrerebbe in pratica scomparsa.
In Sardegna le indagini condotte dal 1983 al 2002 hanno evidenziato una situazione realmente preoccupante con tassi di
prevalenza variabili dal 30% al 60% (Arru et al., 1983; Scala et al., 1997; Sardo et al., 2002; Scala et al., 2002)
L’Ipodermosi riveste un interesse zoonosico poiché le larve di Hypoderma spp. determina in alcuni casi delle miasi nell’uomo:
forme cutanee (Preiser et al., 1979); oculari o addirittura intracerebrali (Pouillard et al., 1980).
In Francia, in cui nell’uomo sono segnalati circa 40-45 casi di Ipodermosi l’anno, è stata condotta un’indagine sierologia
nella popolazione umana che ha rivelato la presenza di anticorpi nei confronti soprattutto di H. bovis (Doby et al., 1982).
In Italia non si hanno segnalazioni ufficiali sulla diffusione della miasi nell’uomo, in cui tuttavia, sono stati riportati casi
isolati (Deiana, 1990, comunicazione personale),
EFFETTI PATOGENI E DANNI ECONOMICI
I danni economici derivanti dall’infestione da Hypoderma spp. dipendono da un gran numero di fattori.
Una conseguenza evidente è il “gadding” (vagare), che avviene quando il bovino corre senza meta in preda al panico
infastidito dagli ultrasuoni emessi dagli adulti di H. bovis in volo. In questo modo l’animale, viene “distratto” durante il
pascolo e si può provocare degli autotramatismi sbattendo contro recinti, fili spinati o cadendo in fossati.
Storicamente il danno maggiore è identificato nel deprezzamento del pellame, che solitamente viene però visto come
danno intrinseco delle operazioni di macellazione. Sempre in sede di visita post-macellazione si rileva una svalutazione
della carcassa dovuta alla presenza dei tragitti di migrazione delle larve che ne implicano la toelettatura, il cui danno è stato
stimato pari all’equivalente di 1,8 kg di carne (Vet. Record, Members Information Supplement N.ro 90).
Il decremento della produzione di latte è un problema frequente molto importante: negli Stati Uniti è stata calcolata una
perdita alla mungitura variabile dal 15% al 25% (Krull, 1969; Beesley, 1974).
In diverse esperienze sono state comparate le performances produttive in animali trattati farmacologicamente e non, in cui
sono stati rilevati i danni legate alle riduzioni dell’incremento ponderale. In uno studio francese, i bovini con 11-15 noduli
58
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
manifestavano un incremento ponderale di 84 ± 18 kg, mentre quelli con meno di 10 noduli manifestavano un incremento
di peso di 102 ± 15 kg (Tapernoux et al., 1961). In America i bovini trattati manifestavano un aumento di peso di 1,03
kg/die rispetto a quello di 0,89 kg/die riscontrato negli animali non trattati (Ludwig e Bucek, 1966).
Ulteriori indagini indicano perdite di produzione di latte dal 10% al 15% e di incrementi medi giornalieri variabili da 50
a 190 grammi/capo (Scholl et al., 1988).
Bisogna ancora aggiungere l’azione patogena esercitata dalle ipodermine, collagenasi elaborate dalle larve in migrazione,
che potrebbero indurre, soprattutto nei casi di infestioni massive, un’immunodepressione generalizzata che favorisce
l’insorgenza di altre malattie batteriche, virali e parassitarie (Boulard C., 1989; Chabaudie e Boulard C., 1992; NicolasGaulard I., 1995).
Un ulteriore aspetto da non sottovalutare è quello relativo al benessere animale, poiché le lesioni causate dalle larve di
Hypoderma spp. sul dorso dei soggetti parassitati causano prurito e quindi uno stato di sofferenza.
Nei paesi in cui l’allevamento dei bovini costituisce una parte fondamentale dell’economia il costo di queste perdite, pur
difficilmente quantizzabile, può essere un serio problema.
CONTROLLO DELL’IPODERMOSI
Nel mondo, per cercare di arginare i danni causati dall’Ipodermosi, sono stati proposti e attuati vari piani di controllo della
parassitosi; l’Introduzione di insetticidi organofosforici sistemici verso la fine degli anni ‘50, ha incentivato la realizzazione
di un gran numero di programmi mirati all’eradicazione o al controllo di questa malattia.
I primi successi dei piani di eradicazione, condotti mediante l’impiego di rotenone, si sono registrati nell’Isola di Man (Beesley,
1974) e di Cipro (Crowther et al., 1976), cioè in due isole come la Sardegna.
Anche in Danimarca i primi successi della lotta contro l’Ipodermosi, basata sempre sull’uso di prodotti topici quale il
rotenone, si è rivelata subito pienamente efficace.
In Olanda dopo alcuni anni di trattamenti facoltativi, nel 1953 è stata varata una legge che impose l’obbligatorietà del trattamento
topico: l’eradicazione si è ottenuta nel 1980 con l’impiego di trattamenti sistemici.
Piani di eradicazione regionali ebbero successo in alcune regioni della Germania, Francia e piani nazionali in Gran Bretagna,
Danimarca, Olanda e Irlanda; in molti casi questi hanno condotto alla completa eradicazione della malattia (Tarry D.W.,
1986).
Più di recente sono state utilizzate formulazioni spot-on o pour-on, che si sono mostrate molto efficaci e più convenienti
per l’allevatore, fattore fondamentale per il successo di un piano di eradicazione.
Il problema da gestire, per i paesi in cui è stato attuato un programma di controllo contro l’Ipodermosi, è l’eventuale
reintroduzione del parassita con la movimentazione degli animali.
Attualmente, le misure di controllo dell’Ipodermosi all’interno dell’Unione Europea variano da un paese all’altro in relazione
soprattutto al tipo di trattamento obbligatorio o volontario dei bovini infestati.
Alla luce di quanto riportato, in questa sede saranno quindi analizzate alcune linee guida che potrebbero essere applicate in
Sardegna per un piano di controllo della parassitosi.
PUNTI CARDINE DA APPLICARE PER UN PIANO DI CONTROLLO DELL’IPODERMOSI BOVINA IN
SARDEGNA
Il piano di controllo per l’Ipodermosi bovina si potrebbe basare in Sardegna sull’attuazione sui seguenti punti:
1.
mappa epidemiologica dell’infestione nell’isola;
2.
educazione sanitaria;
3.
piano terapeutico;
4.
operazioni da adottare nel periodo post-trattamento.
1. Tale fase in Sardegna può considerarsi già ad un livello avanzato. Il rilievo dei dati inerenti i vari parametri epidemiologici
assunti sull’Ipodermosi nell’isola sono stati, infatti, già delineati di recente grazie ad alcune indagini condotte sul
territorio.
La prevalenza dell’infestione è risultata del 35% nei bovini che hanno la possibilità di vivere una o più fasi della loro vita
all’aperto (Sardo et al., 2002), ma risulta presente anche nella maggior parte degli allevamenti da latte, soprattutto in
quelli della provincia di Sassari e Nuoro, in cui sono state riscontrate positive rispettivamente il 94% e 95.5% delle
aziende monitorate (Scala et al., 2002). E’ evidente quindi che l’infestione sia presente in Sardegna a livelli tali da
essere definita da alcuni autori “catastrofica” (Lonneux et al., 1991), e in ogni caso con parametri epidemiologici tali da
giustificare ampiamente l’attuazione di un programma di controllo nei suoi confronti.
2. Un altro punto cruciale è rappresentato sicuramente dall’informazione sanitaria, che deve essere capillare e soprattutto
tendente a consapevolizzare gli allevatori. La mancanza di collaborazione con questa categoria renderebbe vano
qualsiasi piano di controllo. Un ulteriore piano di informazione, teso soprattutto a chiarire le modalità di interventi
chemioprofilattici, andrebbe messo a punto per tutti i veterinari e il personale tecnico impegnati nell’attuazione del
programma.
3. Questa fase prevede il trattamento di tutti i bovini di età superiore a un anno, presenti sul territorio regionale, da
effettuarsi tramite l’uso di lattoni macrociclici soprattutto di quelli somministrabili pour-on lungo la linea del dorso.
Le modalità di somministrazione, non prevedendo in questi casi particolari contenzioni dell’animale, ridurrebbero i
periodi di intervento e sarebbero meno pericolose per gli operatori e gli animali stessi. Questa formulazione, secondo le
norme sui residui dei farmaci in Italia, non prevede tempi di sospensione né per il latte, né per la carne. In alternativa,
positive esperienze son state condotte in Francia tramite l’utilizzo di microdosi di lattoni macrociclici (Lia et al., 2003).
L’individuazione del personale sanitario impegnato nell’attuazione del piano prevederebbe sicuramente un’azione
sinergica tra Istituto Zooprofilattico Sperimentale della Sardegna, Azienda Sanitaria Locale, Università ed Associazione
Regionale Allevatori.
4. Succesivamente al periodo di trattamento degli animali (presumibilmente 3 o 4 anni), si procederà a un monitoraggio
immunologico (ELISA) delle aziende, attraverso il controllo del latte massale o del siero di animali da carne prelevati da
allevamenti scelti con criterio casuale. Contemporaneamente, per lo stesso scopo, verranno effettuate visite aziendali nel
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
59
periodo in cui in Sardegna le larve di Hypoderma spp. sono presenti nel sottocute (gennaio-giugno) (Scala et al. 2002).
Tutti i progressi ottenuti verranno pubblicizzati tra gli allevatori e gli addetti ai lavori, in modo tale da “rafforzare” anche
le successive misure di controllo della parassitosi.
STIMA DEL RAPPORTO COSTI-BENEFICI
Una stima esatta delle perdite economiche legate alla presenza dell’Ipodermosi è estremamente difficile essendo legata ai molteplici
fattori prima elencati. Dati regionali indicano in circa 310.000 il numero dei bovini allevati in attualmente Sardegna, mentre quelli
resi disponibili dall’ASSOCARNI ottenuti su elaborazioni ISTAT (www.assocarni.it) evidenziano come in Sardegna nel 2000 sono
stati macellati 146.940 capi bovini (4.900 vitelli; 120.859 vitelloni e manzi; 4.437 buoi e tori; 16.731 vacche), pari ad un peso vivo
complessivo di 681.983 quintali.
In particolare sempre nel 2000 nell’isola sono stati macellati circa 120.000 capi appartenenti alle categorie maggiormente sensibili alla
parassitosi quindi vitelloni e manzi. l trattamento nei confronti dell’Ipodermosi determina in base ai dati forniti da Ludwig e Bucek
(1966), un maggiore incremento ponderale rispetto ai soggetti controllo di 0,14 Kg/capo al giorno. E’ evidente quindi che, valutando
il prezzo di 1 Kg di carne circa 4 €, il guadagno complessivo derivante dal trattamento, esclusivamente per questa categoria di soggetti
macellati, possa da solo coprire ampiamente il costo del farmaco che ammonterebbe a circa 1,80 € per il farmaco spot on e con costi
veramente contenuti nel caso del piano attuato con le microdosi.
Al ridotto incremento ponderale va aggiunta anche la perdita legata alla toelettatura della carcassa durante le fasi di macellazione dei
capi infestati, che ammonta, come precedentemente ricordato, a circa 1,8 Kg di carne.
D’altra parte il trattamento contro l’Ipodermosi attuato con farmaci spot on determinerebbe un maggiore incremento ponderale dei
soggetti trattati, in quanto tali molecole agiscono anche nei confronti dei nematodi gastro-intestinali spesso presenti nella maggior
parte degli allevamenti (Scala et al. 1997). Quest’ultimo aspetto, ben noto agli allevatori, potrebbe “alimentare” la loro disponibilità
nei confronti dell’attuazione del piano.
Il coinvolgimento anche delle aziende da latte è sicuramente necessario, soprattutto nelle aziende della provincia di Sassari e Nuoro,
in cui l’Ipodermosi risulta presente rispettivamente nel 94% e 95,5% (Scala et al., 2002). In questi casi il trattamento, e quindi il
risanamento dall’infestione, determinerebbe un significativo incremento anche della produzione lattea negli allevamenti coinvolti
ed importanti ripercussioni positive anche nel settore industriale del cuoio, che usufruirebbe di un prodotto di quantitativamente e
qualitativamente superiore.
Conclusioni
Considerando l’elevata pressione parassitaria e i conseguenti danni economici che l’Ipodermosi determina in Sardegna nel settore
bovino, già ampiamente penalizzato dalle restrizioni imposte dalla recente epidemia di blue tongue, un piano di controllo di questa
parassitosi si impone!
Inoltre la Sardegna presenta dei confini geografici naturali che renderebbero più rapido ed efficiente l’attuazione del piano. I tempi di
realizzazione del piano (relativamente brevi), permetterebbero alle due categorie coinvolte cioè, gli allevatori e la Regione Sardegna che
si prenderebbe l’onere di sostenere il progetto, di beneficiare immediatamente dei risultati.
Bibliografia
Beesley W. N. - Economics and progress of warble fly eradication in Britain. 1974. Veterinary Medical Review, 4, 334-347.
Boulard C. – Evolution des anticorps circulants chez les bovins traitès contre l’hypodermose. Ann Rech. Vet., 1975. b, 6, 143.
Boulard C. – Hypodermose bovine : description et incidence économique. Le Point Vétérinaire, 1988, 111, 17-24.
Boulard C. – Avantages de l’immunodiagnostic de l’hypodermose bovine établi par hémagglutination passive et par Elisa, à partir du
sérum et du lactosérum, sur la numeration des varons. 1985. Ann. Rech. Vet., , 16, (4), 335-343.
Boulard C. - Degradation of bovine C3 by serine proteases from parasites Hypoderma lineatum (diptera, oestridae). 1989. Veterinary
Immunology Immunopathology, 20, 387-398.
Chabaudie N., Boulard C. - Effect of hypodermin A, an enzyme secreted by Hypoderma lineatum (Insect Oestridae), on the bovine
immune system. 1992. Veterinary Immunology and Immunopathology, 31, 167-177.
Crowther R.W., Gambles R.M., Polydorou K. - The history of the ox warble fly in Cyprus. 1976. Tropical Animal Health Production,
8, 127-130.
Deiana S., Arru E. – Hypoderma bovis e Hypoderma lineatum. Localizzazione stagionale delle larve. 1960. Parassitologia, 2, 133-136.
Krull W.H. - Notes in Veterinary Parasitology, 1969 Univ. of Kansas, USA.
Lonneux J. F., Losson B., Pouplard L. – Données récentes sur l’hypodermose bovine. 1991. Ann. Med. Vet., , 135, 7-14.
Ludwig P.D., Bucek O.C. – Cattle grub control of economic importance. 1966. Practising Veterinarian., 38, 32.
Nicolas-Gaulard I. - Activité immunomodulatrice d’une protéine parasitaire, l’hypodermine A, sur les cellules mononuclées des bovins.
1995. Thèse de l’Université Paris XII,.- 166 p.
Papalia S., Giangaspero A. - Ipodermosi bovina. Possibilità di attuare un programma di eradicazione in Italia. Selezione Veterinaria,
1987, 28, 1369-1373.
Puccini V., Arru E., Lanfranchi P., Pietrobelli M., Restani R., Scaramozzino P. - Hypodermosis in Italy: current situation. Cost Action
811, 1996, Eur 17533 En, Bruxelles, 53-54.
Sardo D., Chighine C., Varcasia A., Garippa G., Giannetto S., Scala A. – Rilievi epidemiologici sull’Ipodermosi in Sardegna., 2002. Atti
della Società Italiana di Buiatria. Vol.XXXIV Marina di Ravenna (RA).
Scala A., Ligios C., Satta G., Gaetani W., Sini T. – Parassitosi bovine: rilievi epidemiologici in Sardegna. 1997. Praxis Veterinaria, 18
(3), 10-13.
Scala A., Sardo D., Chighine C., Cancedda G., Piazza C., Varcasia A., Caria A., Garippa G., Giannetto S. – Bovine hypodermosis in
Sardinia: immunodiagnosis on samples of farm milk. 2002. Atti della Società Italiana di Parassitologia..
Scholl P.J., Hironaka R., Weintraub J. - Impact of cattle grub (Hypoderma spp.) (Diptera: Oestridae) infestations on beef performance.
1988. Journal of Economic Entomology, 81, 246-250.
Tapernoux A., Magat A., Faure N. – Influence de l’hypodermosis sur la croissance des bovins. 1961, Cahiers méd. Vet., 30(6), 200207
Tarry D.W.- Progress in warble fly eradication. 1986. Parassitol. Today. 2; 111-116.
Zumpt F. – Myasis in man and animals in the old World. 1965. Butterworths, London 225
60
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
LA DIAGNOSI DELLA DICROCOELIOSI OVINA:
METODICHE COPROMICROSCOPICHE A CONFRONTO
Chighine C., Marchi B., Cancedda M.G., Sanchez - Andrade R*., Scala A.
Dipartimento di Biologia Animale, Sezione di Parassitologia e Malattie Parassitarie, Facoltà di Medicina Veterinaria,
Università degli Studi Sassari (Italy).*Dipartimento di Patologia Animale, Facoltà di Veterinaria, Università di Santiago de
Compostela, 27002 - Lugo (Spain). (Con la collaborazione tecnica del Sig. Nieddu M. S.).
Summary: - The diagnosis of Dicrocoeliosis in sheep: a comparison of copromicroscopic methods.
This paper reports the results of research conducted to compare ten different copromicroscopic diagnostic methods
for the identification of Dicrocoelium dendriticum. Three of these involved flotation in a McMaster chamber with
specific weight solutions equal to 1450, composed of: Hg iodide + K iodide (F.1) (which in this case rapresented the
“Gold Standard”); K iodide + Zn sulphate (F.2); tiosulfate Na nitrate (F.3). Five others flotation solutions with specific
weight between 1300 and 1420 were used. (F.4 - F.8) The two remaining methods exclusively involved one or more
phases of sedimentation (S.1 and S.2). In the first fase 104 samples of sheep faeces from a flock that had tested positive
for Dicrocoelium dendriticum were analysed. Successively, livers bearing the trematoda parasite were collected upon the
butchering of 26 sheep, from which faecal samples were also taken from the rectal tract. The results have unfortunately
confirmed the limitations of the methods that do not use solutions containing mercury (a substance considered to be
highly toxic, corrosive and polluting), as in both phases of the project, the prevalence values obtained with these methods
never exceeded 50% and in no case did the quantitative data (eggs for gram of faeces - e.p.g.) correlate well with the
trematoda levels present in the liver (r=0.381).
Introduzione
La Dicroceliosi è una malattia parassitaria cosmopolita, che colpisce principalmente gli ovini e bovini ed è causata dal
trematode digeneo Dicrocoelium dendriticum.
La presenza della parassitosi in certe aree italiane (Toscana, Umbria, Marche e Abruzzo) con valori tra il 66% e il
99% (Ambrosi, 1995), è causa di importanti ripercussioni sulle produzioni; ciò comporta la messa a punto di tecniche
diagnostiche per l’allestimento di adeguati interventi terapeutici e di procedure idonee per valutarne l’efficacia e
l’affidabilità. L’epidemiologia della Dicroceliosi, così come di altre parassitosi, dipende dalla presenza degli ospiti definitivi
recettivi, dal tipo di allevamento, dalla gestione degli animali, dalla presenza, biologia ed etologia dei molluschi e delle
formiche che fungono da ospiti intermedi, dal tipo di suolo, dalle specie botaniche presenti e da vari fattori metereologici
(Chartier e Reche, 1992).
La diagnosi si basa sull’utilizzo di metodiche copro-microscopiche che prevedono tecniche di sedimentazione e/o
flottazione in soluzioni ad alto peso specifico (Euzeby, 1981). Tuttavia esse presentano l’inconveniente di non mettere in
evidenza il parassita finchè questo non raggiunge lo stato di maturità e inizia ad eliminare le uova; anche in questo caso i
risultati non sempre sono attendibili e ciò può essere dovuto al tipo di infestione (esempio di tipo pauciparassitaria) e/o
alle ridotte quantità del campione di feci analizzato (Ambrosi,1991).
Le metodiche attualmente in uso nei vari laboratori di parassitologia si basano sulla flottazione in soluzione di
jodomercurato di potassio, ritenuta ottima come “performances,” ma anche fortemente inquinante, corrosiva, altamente
tossica e molto costosa (Ambrosi, 1991).
Al fine di migliorare l’attendibilità della diagnosi di questa parassitosi sono state messe a punto metodiche indirette come
il test al lattice o l’ELISA con antigeni somatici (Piergili-Fioretti, 1980; Jithendran e Bath, 1996) o più recentemente di
tipo escretore/secretore (Sanchez - Andrade, et al., 2001).
Scopo del nostro lavoro è stato quello di comparare in ovini naturalmente infestati, varie metodiche diagnostiche dirette a
rilevare la presenza di uova di questo trematode e individuare tra esse quelle ritenute più idonee.
Materiali e metodi
L’indagine è stata condotta in tre fasi:
PRIMA FASE - Nell’arco del 2002 sono stati esaminati 104 campioni di feci provenienti da ovini adulti di razza sarda. Sulle
feci sono state effettuate, in parallelo per ogni campione, esami copro-microscopici quali-quantitativi, con metodiche che
comportavano l’uso di soluzioni, modalità e strumenti differenti.
Tre di esse prevedevano l’utilizzo di soluzioni ad uguale peso specifico (1450) ma a composizione differente (F.1, F.2 ed
F.3) ed altre a peso specifico variabile da 1300 a 1420 di seguito elencate con le relative sigle (F.4, F.5, F.6, F.7 ed F.8). Le
diverse soluzioni erano così composteF.1: Hg ioduro (250 gr), K ioduro (250 gr. ) e acqua distillata (665 ml), p.s. 1450; F.2:
Zn solfato (600 gr) e acqua distillata (600 ml); Hg ioduro (100 gr), K ioduro (78 gr) e acqua distillata (63 ml), p.s.1450;
F.3: Nitrato di Na (300 gr), Tiosolfato di Na (620 gr) e acqua distillata (530 ml), p.s.1450; F.4: Zucchero comune (360
gr) e Nitrato di Na (540 gr), in un litro di H2O, p.s. 1340; F.5: Glucosio (350 gr) e Nitrato di Na (530 gr), p.s. 1420; F.6:
Cloruro di Zn (220 gr), Cloruro di Na (210 gr), in 800ml di H2O, p.s. 1300; F.7: Soluzione satura di solfato di Mg, p.s.
1300; F.8: Nitrato di Na (25 gr) e Tiosolfato di Na (30 gr), in 75ml di H2O, p.s. 1340. Le metodiche indicate con la sigla
F comportavano l’uso delle camere di McMaster secondo le modalità suggerite da Raynaud (1970).
Inoltre sugli stessi campioni sono stati eseguiti esami copromicroscopici per sedimentazione, in particolare: Sedimentazione
semplice (S.1); Sedimentazione denominata 3x3 (S.2), poiché la modalità di esecuzione richiede tre sedimentazioni
successive di tre minuti ciascuna. Tutti i 104 campioni sono stati analizzati in doppio con le diverse soluzioni flottanti e con
la metodica di sedimentazione S.1, per la S.2 si procedeva ad una lettura singola, per un totale di 1976 esami coprologici.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
61
Il numero delle uova rilevato nei diversi esami copromicroscopici è stato, a seconda delle diluizioni praticate, moltiplicato o
diviso per un dato fattore di seguito riportato:da F. 1 fino ad F. 8, moltiplicato per 15; S. 1 moltiplicato per 25; S. 2 diviso
per 25;
SECONDA FASE - Da ovini regolarmente macellati sono stati asportati i fegati che risultavano positivi per D. dendriticum
e contemporaneamente dall’ampolla rettale degli stessi animali venivano prelevate le feci. I fegati sono stati esaminati
come segue: sminuzzamento del parenchima in fette da 0,5 cm, immersione delle fette in coni contenenti acqua tiepida,
“strizzatura”, allontanamento del parenchima, conta degli elminti. Le analisi coprologiche sono state eseguite secondo le
metodiche riportate nella Fase 1.
TERZA FASE - Da maggio a settembre 2001 sono stati prelevati campioni di feci e siero da 738 ovini di razza sarda, di età
compresa tra i 6 mesi e i 10 anni. Per l’esecuzione dell’esame coprologico è stata utilizzata la metodica S.1. Per l’ELISA è
stato utilizzato un antigene escretorio/secretorio, ottenuto da esemplari adulti di D. dendriticum prelevati da fegati di ovini
naturalmente infestati e regolarmente macellati in Sardegna.
Per l’estrazione dell’antigene si procedeva come segue: per ogni parassita sono stati aggiunti 4 ml di terreno di coltura
ottenuto con RPMI 1640 addizionando ampicillina (25µg/ml), cloramfenicolo (30 µg/ml) e un inibitore di proteasi
(PMSF, Sigma) a una concentrazione di 2 mM incubazione a 37° C per 3 h, centrifugazione a 4° C in un rotore JA-20 a
40.000 giri per 50 min, filtrazione del surnatante ottenuto con un filtro Millipore da 10 µm e quindi in un altro da 0,45
µm e ancora in uno da 0,22 µm, dializzazione in acqua MilliQ per 12-14 h utilizzando una membrana di cellulosa (Sigma)
con capacità di ritenzione del 90-99% di una soluzione di citocromo C (12,4 kDa) per 10 h. Una volta ottenuto l’Ag si
determinava la concentrazione proteica con la tecnica BCA di Pierce (Modalità indicate da Sanchez-Andrade et al., 2001).
L’antigene veniva diluito in PBS (ph 7,4) alla concentrazione di 4 µg/ml-1. Il siero era diluito 1:20 in PBS contenente, con
diluizione 1:1000, 0,05% di Tween 20,1% di latte in polvere e Proteina G marcata con perossidasi. Sono stati utilizzati
come controlli positivi e negativi, rispettivamente 5 ovini infestati e 5 non infestati. I primi erano rappresentati da ovini
riscontrati parassitati alla macellazione, mentre i secondi erano agnelli non infestati allevati al “chiuso” dalla nascita.
Il cut-off era pari alla media della densità ottica (OD) di un siero negativo (0,3372) sommato a tre deviazioni standard
(0,1205 X 3): nel nostro caso il valore di OD che indicava un siero positivo era di 0,6987.
Risultati
PRIMA FASE - 17 campioni sono risultati negativi a tutte le metodiche applicate. Le soluzioni da F.4 ad F.8 hanno fornito
dei risultati costantemente negativi.
I tassi di prevalenza relativi a ciascuna metodica sono riportati nel Grafico n°1.
I tempi medi di attuazione delle differenti metodiche saggiate sono stati i seguenti: flottazione in camera McMaster (da
F.1 a F.8.) - 10 minuti; sedimentazione S.1 - 40 minuti; sedimentazione S.2 - 58 minuti. I preparati sono risultati di facile
lettura con l’uso delle soluzioni flottanti in particolare con la F.1, mentre apparivano particolarmente “sporchi” quelli
ottenuti con le metodiche di sedimentazione.
SECONDA FASE - Il numero medio di esemplari di D. dendriticum riscontrati nei fegati controllati era pari a 770,9
(D. S.=1777,8). I tassi di prevalenza (=sensibilità) ottenuti su 26 campioni di feci di ovini parassitati da D. dendriticum
sono riportati nel Grafico n°2, mentre ulteriori parametri sono riportati nella Tabella n°1. Il test di Wilcoxon ha messo in
evidenza che i risultati delle varie metodiche differiscono significativamente tra loro (P<0,001). La regressione lineare tra
il numero dei parassiti riscontrati in ciascun fegato e le u.p.g. corrispondenti ha rilevato i valori riportati nella Tabella n°2.
L’esame di detta tabella evidenzia come la tecnica di flottazione con la soluzione F.1 si confermi quella maggiormente in
grado di rispecchiare le cariche parassitarie effettivamente presenti a livello epatico. A sorpresa, si è anche messo in evidenza
che la S.2 rileva meglio in proporzione il quadro parassitologico nel fegato, rispetto alle soluzioni flottanti F.2, F.3 e alla
sedimentazione S.1.
TERZA FASE - Nel 6,6% dei campioni fecali esaminati coprologicamente sono state reperite uova di D. dendriticum
(n°49), mentre valori di OD superiori al cut-off sono stati evidenziati nell’86,2% dei sieri testati in ELISA (n°636) (χ2=
938,63; P< 0,0001). I valori di u.p.g. variavano da 41 a 208 (media=66,63± D. S. 42,14), quelli di OD da 0,16 a
5,68 (media=1,417± D. S. 0,728). Solo il 6,6% degli ovini esaminati (n°49) è risultato contemporaneamente positivo
alle due metodiche saggiate; nessun campione risultato negativo al test immunoenzimatico è risultato positivo all’esame
coprologico.
Considerazioni
Per ciò che concerne la manualità nell’esecuzione delle varie metodiche, abbiamo potuto rilevare come i tempi di attuazione
siano sicuramente più contenuti per le tecniche di flottazione con conta su vetrino McMaster rispetto alle altre, così come
migliore è risultata la nitidezza del campo di lettura.
I dati ottenuti sia nella prima che nella seconda fase dell’indagine, sono risultati sovrapponibili ed hanno evidenziato
in termini di sensibilità una maggiore attendibilità della metodica che prevede l’uso della soluzione F.1, che purtroppo
comprende tra i suoi componenti anche i sali di mercurio altamente tossici, corrosivi inquinanti nonché costosi. La
soluzione F.3, in considerazione delle sue caratteristiche componenti (economiche e praticamente atossiche), godeva di
particolari aspettative, anche perché il suo peso specifico è sempre 1450. Purtroppo non ha fornito risultati accettabili,
nè in termini di rivelazione dell’infestione, nè di correlazione tra i livelli di u.p.g. e la carica parassitaria effettivamente
presente. Inoltre le diverse “performances” ottenute con le soluzioni flottanti F.1, F.2 ed F.3, hanno evidenziato che per
ottenere una flottazione ottimale il parametro da considerare non è legato esclusivamente al peso specifico, uguale in
tutte tre le soluzioni utilizzate, ma anche ad altri fattori chimico-fisici, che interagendo con le uova del parassita possono
portare ad un risultato differente. I risultati ottenuti con la terza fase dell’indagine confermano ulteriormente i limiti
dell’esame coprologico eseguito con la metodica S.1, soprattutto nei casi di infestioni pauciparassitarie, che nella nostra
campionatura sono risultati essere prevalenti. L’elevata sieroprevalenza rilevata per D. dendriticum, in contrasto con i
62
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
risultati ottenuti con l’indagine copromicroscopica, può trovare alcune spiegazioni: l’ELISA risulta in grado di evidenziare
anticorpi nei confronti del trematode già in fase prepatente, a partire da 30 giorni dopo l’infestione (Gonzales-Lanza et
al., 2000); gli anticorpi raggiungono nella Dicroceliosi i livelli massimi intorno ai 60 giorni dall’infestione e rimangono
elevati fino al 6° mese successivo all’allontanamento naturale o farmacologico del parassita. Tutto questo comporta che le
sieropositività, pur essendo direttamente correlabili ai valori di u.p.g., indicano con sicurezza, esclusivamente il contatto
con il trematode e non la certezza di rilevare un’infestione in atto.
Conclusioni
Per questa parassitosi, il metodo coprologico rispetto all’ELISA costituisce, nonostante i suoi limiti, tuttora un importante
presidio diagnostico in grado di identificare con sicurezza gli ovini positivi, anche se le metodiche risultate più efficaci
necessitano per la loro esecuzione di soluzioni che contengono sali di mercurio. Alla luce dei dati acquisiti, ci sentiamo
comunque di proporre, tra quelle testate, la metodica che prevede l’uso della soluzione F.2, la quale è caratterizzata da
“performances” accettabili e contiene meno mercurio rispetto alla F.1. Nel caso l’uso delle soluzioni a base di mercurio
fosse bandito, l’alternativa è data dalla soluzione denominata F.3, che però ha fornito risutati scarsamente attendibili,
consentendo il riscontro della parassitosi negli animali in vita solo nel 50 % dei casi circa. In questo contesto l’ELISA da noi
messa a punto rappresenta, in considerazione dell’elevato grado di sensibilità evidenziato, uno strumento più affidabile di
verifica epidemiologica dell’infestione su un determinato territorio e/o gregge, ma non in grado di rilevare singoli soggetti
sicuramente parassitati.
Bibliografia
Ambrosi M. (1991) - La diagnostica coprologica nelle elmintiasi di allevamento: caso delle distomatosi dei ruminanti. Praxis Vet. 12: 17–21.
Chartier C., Reche B. (1992) - Gastrointestinal helminths and lungworms of french dairy goats: prevalence and geographical distribution in
poitou-charentes. Vet. Res. Commun. 16: 327–335. Gonzalez-Lanza C., et al. (2000) - IgG antibody response to ES or somatic antigens of
Dicrocoelium dendriticum (Trematoda) in experimentally infected sheep. Parasitol Res., 86 (6), 472-479. Piergili Fioretti D., et al. (1980) – Il
metodo ELISA per la ricerca di anticorpi in ovini parassitati da Dicrocoelium dendriticum. Riv. di Parassitologia. XLI (3), 289-292. Sanchez
- Andrade R, Paz - Silva A., et al. (2001) – Effect of fasciolicides on the antigenemia in Fasciola hepatica-naturally infected sheep. Parasitol.
Res. 87, 609-614.
Lavoro effettuato con finanziamento PRIN 2001 (ex 40%).
TASSI DI PREVALENZA COPROMICROSCOPICI OTTENUTI SU 104 CAMPIONI DI FECI OVINE
80%
73,1%
62,5%
70%
60%
F.1
46,2%
50%
37,5%
35,6%
F.2
F.3
40%
S.1
30%
S.2
20%
10%
0%
F.1
F.2
F.3
S.1
S.2
(χ2= 44,25 con 4 gradi di libertà; P<0,0001) (GRAFICO N°1)
TASSI DI PREVALENZA COPROMICROSCOPICI OTTENUTI SU 26 OVINI SICURAMENTE PARASSITATI DA D. DENDRITICUM
(χ2= 44,22 con 4 gradi di libertà; P=0,016) (GRAFICO N°2)
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
63
TABELLA N°1 - STATISTICA DESCRITTIVA: ANALISI DEI VALORI DI U.P.G.
METODICHE
NUMERO
CAMPIONI
DEVIAZIONE
STANDARD
F.1
26
235,0769
386,773
0
1777,5
F.2
26
76,1154
144,71567
0
705
F.3
26
22,4615
32,67596
0
150
S.1
26
54,8077
121,9158
0
562,5
S.2
26
0,0231
0,05081
0
0,2
MEDIA
MINIMO
MASSIMO
TABELLA N°2 - RISULTATI DELLA REGRESSIONE LINEARE TRA IL NUMERO DI
ESEMPLARI DI D. DENDRITICUM RILEVATI NEL FEGATO E I VALORI DI U.P.G.
64
VARIABILI
DIPENDENTI
VALORE DI r
F.1
0,734
0,000
F.2
0,370
0,063
F.3
0,249
0,22
S.1
0,030
0,886
S.2
0,381
0,055
VALORE DI P
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
LA CENUROSI OVINA DA COENURUS CEREBRALIS IN SARDEGNA: RILIEVI
EPIDEMIOLOGICI, PARASSITOLOGICI E ISTOPATOLOGICI.
Cancedda M.G.; Chighine C.; Varcasia A.; 1Ligios C.; Scala A.
Dipartimento di Biologia Animale, Sezione di Parassitologia, Facoltà di Medicina Veterinaria, Università degli Studi di
Sassari; 1Istituto Zooprofilattico Sperimentale della Sardegna “G. Pegreffi”- Sassari.
Con la collaborazione tecnica del sig. Mario Salvatore Nieddu.
Summary: The ovine Coenurosis by Coenurus cerebralis in Sardinia: epidemiological, parassitological and histopathological findings.
An investigation was carried out on cases of ovine Coenurosis in Sardinia, between April 2001 and March 2003. A total
of 107 sheep were examined, the age of the affected sheep ranging from 4 and 36 months. Each animal underwent detailed
clinical examination. Observations on the general behaviour of sheep were made and behavioural changes were recorded.
Sheep were examined postmortem, the brain was removed and when clinical signs suggested, also the spinal cord. After 10%
formaline fixation of these organs, cyst locations were recorded using transversal cut thalamus, basal ganglia and cortex. Besides
parasitological findings (morphometry, in different positions such as obex, rostral medulla oblongata, mesencephalon, number
and cyst locations), lesions caused by the parasite, their location in various brain regions and size were recorded. Histopathological
investigations were also performed. Data were analysed by statistics procedures, positive correlations were found between sheep
age and the average size of lesions and negative correlations between age and cyst number. Finally, the seasonal prevalence of the
parasitosis was reported. The highest number of cases occurred during spring and autumn.
Introduzione
Determinare l’esatta diffusione della Cenurosi cerebro-spinale negli ovini non costituisce un compito facile a causa
della relativa difficoltà al reperimento dei casi clinici, soprattutto di quelle forme più classiche che vengono riconosciute
direttamente dall’allevatore e dunque non giungono all’osservatorio. Pertanto tale parassitosi risulta oggi sottostimata e
viene sottovalutato anche il ruolo che questa assume come zoonosi minore. La difficoltà nel controllo della Cenurosi è legata
al persistere nelle aree interessate di macellazioni non controllate praticate dallo stesso allevatore in azienda, che spesso non
applica le più banali norme igienico-sanitarie e abbandona le carcasse nei pascoli e nelle discariche abusive. E’ evidente
quindi che in questi casi gli organi parassitati siano facilmente accessibili ai cani randagi e da pastore, ancora ampiamente
impiegati in Sardegna per la guida e la protezione del gregge. Pertanto la possibilità di trasmissione di tale parassitosi dal
cane ai ruminanti e quindi all’uomo risulta ancora oggi elevata. In considerazione di quanto sopra affermato, abbiamo
voluto condurre la presente indagine per apportare un contributo alla conoscenza di alcuni parametri epidemiologici e
parassitologici della metacestodosi negli ovini della Sardegna. Nel contempo sono stati anche valutati la tipologia e la
distribuzione nel SNC delle lesioni causate dai cenuri durante le varie fasi della malattia.
Materiali e metodi
L’indagine è stata condotta tra Aprile 2001 e Marzo 2003. Sono stati esaminati 107 ovini di razza sarda colpiti da Cenurosi
da C. cerebralis provenienti da tutte le zone della Sardegna, di età compresa tra 4 e 36 mesi. Tutti i soggetti prima del decesso
venivano sottoposti ad esame clinico con osservazione del comportamento generale, di qualsiasi anomalia di postura e
deambulazione. Successivamente veniva effettuato l’esame necroscopico con asportazione dell’encefalo e/o del midollo
spinale sulla base dei dati clinici. L’encefalo prelevato secondo le tecniche di routine, fissato in formalina al 10%, veniva
sezionato trasversalmente a livello di corteccia frontale, nuclei basali, talamo, mesencefalo, obex e cervelletto. Tutte le lesioni
riscontrate macroscopicamente venivano registrate su apposita scheda, nella quale si riportavano l’esatta localizzazione delle
stesse, le dimensioni e il tipo. Sono stati quindi allestiti preparati istologici colorati con Ematossilina-Eosina per valutare il
tipo e la dinamica delle lesioni. Per l’elaborazione dei dati gli ovini esaminati sono stati suddivisi in classi d’età: < 6 mesi;
6-12; 12-18; >18.
Risultati e considerazioni
I dati ottenuti evidenziavano come la Cenurosi colpisca preferibilmente i soggetti di età inferiore ai 12 mesi, 55,1% (grafico n°1). Il
trend stagionale rilevato per la Cenurosi cerebrale è riportato nel grafico n°2. I picchi più alti di prevalenza si registrano durante il periodo
primaverile ed autunnale. In primavera prevalgono le forme acute negli agnelli, mentre in autunno quelle croniche nelle saccaie così
come riportato da Scala et al. (1992). Un andamento stagionale di questo tipo si può spiegare con il fatto che i cani in autunno hanno
maggiore disponibilità di cisti mature di Coenurus cerebralis, perciò dopo un periodo di prepatenza di circa due mesi, il cane è in grado
di eliminare con le feci un certo numero di uova infestanti, determinando così un inquinamento ambientale proprio nel periodo in
cui gli agnelli vanno al pascolo. I massimi livelli d’infestazione si raggiungono quindi in primavera, stagione in cui si registrano anche le
condizioni di umidità e di temperatura ideali per la sopravvivenza delle uova nel terreno e gli agnelli risultano più sensibili all’infestione a
causa del loro non completo sviluppo del sistema immunitario; le prevalenze dell’infestione descritte durante i mesi invernali, potrebbero
essere attribuite, invece, all’incidenza degli stress climatici e nutrizionali propri di questa stagione che favorirebbero lo sviluppo delle uova
eventualmente ingerite in questo periodo (Herbert et al., 1984). Il numero di cisti di C. cerebralis nelle diverse classi d’età è risultato
correlato negativamente con l’età (Achenef et al., 1999), che invece risulta correlata positivamente con le dimensioni delle stesse. Il
numero medio dei cenuri diminuisce con l’aumentare dell’età r=-0,85. Nei soggetti appartenenti alla classe di 6-12 mesi il numero
medio di cenuri è risultato pari a 2,9 cenuri con un numero massimo di 10 cisti. Invece nei soggetti con più di 18 mesi si rileva un
numero medio di 1,2 cenuri con valori massimi che si attestano sui due cenuri. Anche le dimensioni delle cisti sono correlabili con
l’età: i soggetti giovani avranno cisti multiple di dimensioni medie comprese tra 0,8 e 2 cm2, mentre gli adulti avranno al massimo due
cisti di circa 6 cm2 (grafico n° 3). E’ evidente quindi che la correlazione positiva tra età e dimensioni delle cisti indica che queste ultime
tendono ad aumentare ovviamente col progredire della patologia nel tempo. Laddove invece non si rilevavano formazioni cavitarie, cioè
non erano evidenti cisti di C. cerebralis si potevano riscontrare altri tipi di lesioni (grafico n°4). Il tipo di lesioni è strettamente correlato
con l’età dei soggetti, fondalmentalmente sono state riscontrate tre tipi differenti: lesioni necrotico-purulente che comprendono tragitti
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
65
necrotico-purulenti superficiali; tragitti e focolai necrotici profondi; formazioni cavitarie con cisti e lesioni secondarie quali idrocefalo
ed assottigliamento del tavolato osseo. I tragitti necrotico-purulenti superficiali e profondi, scavati dalle larve durante la loro migrazione
sulla superficie e/o nello spessore delle corteccia cerebrale appaiono di colore giallastro e tortuosi e possono coivolgere vari tratti del SNC.
Come focolai sono stati considerate le lesioni che coinvolgono aree ben delimitate del tessuto nervoso interessate dalla necrosi, mentre
per formazioni cavitarie s’intendeva lo spazio occupato dalla cisti del Coenurus cerebralis, che sviluppandosi determinavano atrofia da
compressione dei tessuti circostanti. Le lesioni secondarie sono causate da cisti parassitarie in grado di determinare un ostacolo al deflusso
del liquido cerebro-spinale che, ristagnando nei ventricoli laterali, tende a creare lesioni collaterali, cranialmente o caudalmente alla cisti
di C. cerebralis quali dilatazioni dei ventricoli laterali (idrocefalo ventricolare meccanico). Inoltre sono state rilevate lesioni del tavolato
osseo, quali lievi assottigliamenti e/o delle vere e proprie erosioni dello stesso, causate da cisti di grosse dimensioni. Istologicamente le
formazioni cavitarie si presentano come aree otticamente vuote che talvolta contengono la membrana parassitaria qualora rimasta in situ,
costituita da uno strato cuticolare e da uno reticolare (Di Marco et al., 1998). Queste cavità possono essere delimitate da una reazione
granulomatosa con macrofagi e cellule giganti e da un infiltrato infiammatorio; le lesioni necrotiche sono costituite da un’area necrotica
centrale delimitata da cellule macrofagiche disposte a palizzata, di tipo epitelioide e da un modesto infiltrato mononucleare nel quale si
rilevano spesso cellule polinucleate; sono di frequente riscontro i manicotti mononucleari perivascolari con rari eosinofili (Doherty et
al., 1989). Le lesioni cavitarie costituiscono quelle più comuni ( 73,6% sul totale di quelle riscontrate), ma non sono correlabili con l’età
(r=0,54), mentre lo risultano gli altri due tipi di lesioni: quelle necrotico-purulente, correlate negativamente (r=-0,96) e quelle secondarie
positivamente (r= 0,96), (grafico n°5). L’elaborazione statistica di dati relativi alle prevalenze di differenti tipi di lesione effettuate tramite
�2 test, evidenzia delle differenze significative esclusivamente analizzando singolarmente i diversi tipi, così come deducibile dall’esame
della tabella n°6. Il parassita non ha un particolare tropismo per le aree subcorticali e ciò deve essere attribuito alla sua dinamica che lo
porta più facilmente a localizzarsi nelle regioni superficiali del cervello piuttosto che in quelle profonde, che costituiscono infatti il 10% di
quelle totali. Esiste però una correlazione negativa tra età e presenza del parassita nelle zone subcorticali, soprattutto nelle classe di soggetti
tra i 6 e 12 mesi (grafico n°7). Il 37,4% dei nostri soggetti presentava contemporaneamente più tipi di lesioni (grafico n°8); perciò alle
formazioni cavitarie con cisti possono essere associate lesioni necrotico-purulente o lesioni secondarie; in qualche soggetto possono essere
presenti contemporaneamente i tre tipi di lesione (tabella n°9).
La Cenurosi assume un trend differente nelle diverse classi d’età: i giovani agnelli presenteranno cisti multiple che possono
arrivare fino a 10 in uno stesso individuo, responsabili delle fase acuta. La presenza di più cisti dipende presumibilmente da due
fattori: il numero di uova ingerite che risultano numerose nei pascoli durante la stagione primaverile e il sistema immunitario
dell’ospite non ancora maturo. Perciò l’ingestione di un gran numero di uova da parte di giovani agnelli il cui stato immunitario
non ha ancora completato il suo sviluppo e quindi non ancora in grado di contrastare in maniera efficiente lo sviluppo del
parassita, favorisce l’evoluzione delle larve ingerite in cisti di C. cerebralis. Quindi la gravità della forma acuta non dipende
dall’azione meccanica delle cisti, ma dall’infiammazione causata dal parassita in migrazione responsabile delle formazione di
lesioni necrotico-purulente particolarmente frequenti in questa classe d’età. Pertanto la forma acuta, associata alla migrazione del
parassita, ai primi stadi di sviluppo può rendersi responsabile di sintomi clinici non specifici che nè rendono difficile la diagnosi
(Doherty et al., 1989). Gli adulti invece presentano la fase cronica della malattia causata da cisti mature di dimensioni maggiori
rispetto a quelle riscontrabili nei soggetti più giovani che esercitano un’azione compressiva sia sul tessuto nervoso, determinando
fenomeni di atrofia più o meno marcati, che sulla teca ossea dove si possono presentare evidenti fenomeni di erosione quando
l’azione meccanica della cisti sia protratta nel tempo. Questi soggetti presentano un numero massimo di cisti che oscilla tra 1 e 2.
La correlazione negativa tra numero e dimensioni indica che le cisti raggiungono dimensioni maggiori quando il loro numero è
basso, in genere quando è presente una sola cisti (Achenef et al., 1999).
Conclusioni
I risultati di quest’indagine hanno evidenziato che la Cenurosi cerebrale negli ovini al pari di altre metacestodosi, quali
l’Idatidosi da Echinococcus granulosus (Scala et al. 2000) e la Cisticercosi da Cysticercus tenuicollis (Scala et al. 2002),
costituiscono per la Sardegna un problema sanitario ed economico di primaria importanza per il settore ovino e possono
mettere a repentaglio anche la salute dell’uomo. I risultati ottenuti hanno consentito di meglio definire il trend e gli
aspetti anatomo-istopatologici assunti dalla patologia nell’isola. In particolare i quadri lesivi riscontrati hanno messo in
evidenza la possibilità che in uno stesso soggetto coesistano tipi differenti di lesioni in diverse localizzazioni; per questo
motivo potrebbe risultare particolarmente difficile effettuare una esatta diagnosi di sede in questa tipologia di soggetti che
costituiscono il 37,4% dei casi da noi esaminati. Infatti non sempre è possibile associare la sospetta localizzazione della cisti
diagnosticata sulla base dei dati clinici, con la effettiva posizione del parassita rilevabile successivamente all’esame anatomopatologico. Dunque una maggiore conoscenza di questa neuropatologia s’impone per la necessità di differenziarla rispetto
ad altre patologie nervose clinicamente confondibili con la Cenurosi (Cancedda et al., 2002).
Bibliografia
Abo-Shehada Mahmoud N., Jebreen Eyad, Arab Baker, Mukbel Rami, Torgerson Paul (2002) – Prevalence of Taenia multiceps in sheep in
northern Jordan. Preventive Veterinary Medicine, 55, 201-202. Achenef M., Markos T., Feseha G., Hibret A., Tembely S. (1999) - Coenurus
cerebralis infection in Ethiopian Highland sheep: incidence and observation on pathogenesis and clinical signs. Tropical Animal Health and
Production, 31, 15-24. Cancedda M.G., Scala A., Chighine C., Piazza C., Sardo D., Varcasia A., Ligios C. (2002) – Quadri clinici della
Cenurosi ovina e diagnosi differenziale con altre neuropatologie. Atti S.I.P.A.O.C., XV, 16. Di Marco V., Riili S., Zanghì P., Capucchio M.T.,
Giraldo A., Guarda F. (1998) - Dati epidemiologici e reperti patologici della Cenurosi negli allevamenti ovi-caprini siciliani. Large Animals
Review, 3, 79-86. Doherty M.L., Bassett H.F., Breathnach R., Monaghan M.L., McErlean B.A. (1989) – Outbreak of acute Coenuriasis in
adult sheep in Ireland. Veterinary Record, 125, 185. Edwards G.T., Herbert V. (1982)- Observation on the course of Taenia multiceps infections
in sheep: clinical signs and post-mortem findings. British vet. Journal, 138, 489-500. Herbert V., Edwards G.T. (1984) - Some host which
influence the epidemiology of Taenia multiceps in sheep. Annals of Tropical Medicine and Parassitology, 78 (3), 243-248. Lia R., Puccini A. Lia
R., Puccini A. (1998) - La Cenurosi nell’allevamento ovino. O&DV, 7-8, 43-48. Scala A., Ligios C., Leoni A., Nieddu A.M. (1992) - Cenurosi
degli ovini in Sardegna: rilievi epidemiologici, parassitologici ed anatomoistopatologici. Atti S.I.S.Vet XLVI, 1435-1439. Scala A., Pintori A.,
Uras P., Delogu M.L.(2000) - Hepatic and pulmonary hydatidosis of sheep in the province of Sassari: data from a recent survey. Parassitologia
42 (Suppl.1), 223. Scala A., Urrai G., Ruiu A., Leoni A., Marrosu R., Garippa G. (2002) – Una metacestodosi sottovalutata negli ovini: la
Cisticercosi da Cysticercus tenuicollis .Atti S.I.P.A.O.C., XV, 92.
Lavoro eseguito con fondi ex 60%.
66
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Grafico n° 1: Distribuzione casi per età
����������
Grafico n° 2: Stagionalità
����
Grafico n° 3: Dimensioni delle cisti per età (sezione)
��������
�������� ������
��������
Grafico n° 4: Media numero cenuri per età e valori massimi e minimi
Grafico n° 5: Tipo di lesioni in %
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
67
Tabella n° 6: χ2trend: confronto dei tipi di lesione
Grafico n° 7:Lesioni subcorticali in relazione all’età
Grafico n° 8: Soggetti con una o più tipi di lesioni �2= 13,63; P= 0,0002
����
����
����
����
����
����
����
���
� ����
��� ����
Tabella n° 9: Distribuzione dei differenti tipi di lesione
������������
����������������
�����������������������
����������������������������������
�������������������������
���������������������������������������������
��������������
������
��������
68
��
�
��
�
��
�
�
���
����
���
����
���
���
�����
��
����
��
����
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
OUTBREAK OF COENUROSIS IN ADULT SHEEP IN VITERBO’S DISTRICT (ITALY)
Tarantino C.1, Taccini E. 1, Corazza M. 2, De Santis B. 3, Braca G. 1
Department of Animal Pathology, V.le delle Piagge 2, 56124 Pisa.
Tel 050570737; Fax 050540644; e.mail: [email protected]
2
Department of Veterinary Clinic, V.le delle Piagge 2, 56124 Pisa.
3
Veterinary Practionier
1
Abstract
The pathology produced in nervous tissue by migration and localization of larvae (Coenurus cerebralis) of Multiceps multiceps
(Leske, 1780) is characterized by single or multiple cysts. We report an outbreak of coenurosis in a flock in Viterbo’s district
(Italy), describing symptomatological and anatomopathological aspects and discussing the differential diagnosis.
The prevalence of symptomatology, come out on 30 animals in 2000-01, was been reduced by elimination of dogs and
control of wild animals. It was characterized by circling, staggering, neck’s rigidity, lethargy and “pedalage”.
Necropsy of 15 animals revealed gross lesions consisting in parasitic cysts, sometimes very large, situated into and on
the surface of the brain which, once open, showed a serous liquid containing a lot of protoscolices. Histologically it was
possible to observe a chronic inflammatory infiltrate containing some and very large giant cells. In the nervous tissue,
pathway of traumatic malacia foci with granulomatous lesions were present.
Bacteriological analysis for Listeria spp. and histopathological investigations for Scrapie are negative.
Introduction
Coenurosis or “gid disease” is a pathology of the nervous tissue due by migration and localization of cyst –like larval form
of the cestode M. multiceps (Leske, 1780), known as Coenurus cerebralis. The cestode belongs to the family Taeniidae.
Coenurosis is a frequent disease in sheep (reported in goat, cattle and also in horse and human beings) it is characterized
by the presence of single or multiple cysts localized in nervous tissue of the head, less frequently in medulla oblongata and
spinal cord. Dogs, foxes, wolves are the primary source of coenurosis because they are the final host of Taenia multiceps.
We report an outbreak of coenurosis in a flock in Viterbo’s district (Italy), describing symptomatological and
anatomopathological aspects and discussing the differential diagnosis. We think that it is very important to remind this
common parasitic disease of the sheep because of its clinical signs are variable and may confused with other nervous
pathologies.
In these years the neurologic syndromes of the ovine have become very important. In central Italy regions some foci of
Scrapie are been pointed out. It is been experimentally demonstrated that BSE is transmissible to the ovine specie. In the
sheep there isn’t any clinically difference between the BSE and the Scrapie. Therefore, the application of an active program
from 1° January 2002 for the control of transmissible spongiform encephalopathies in the adult sheep is performing in
Italy. On the other hand, the neurologic disease caused by Listeria monocytogenes, is important to remind because of its
high anthropo-zoonotic implication. Between the most important neuropathologies, the tetanus has an fundamental role,
because of the frequency of lesions related to the shearing and, consequently, the high risk of Clostridium tetanii’s spores
contamination. Finally, lead and other heavy metals poisoning pathology is accidentally observed in some industrialized
areas in which particular contaminants are present.
Materials and methods
Breeding management
A flock of 1000 comisana sheep has been signalized to us from authority because of the presence of less or more evident
neurologic symptoms in some animals.
The sheep are breeded in close paddocks since 6 years and feeded with unifeed whose hay comes from farm’s field. All the
sheep were vaccinated against clostridial infections, Cl. tetanii and Pasteurella multicida (Miloxan®, Merial). They were
also regularly treated against nematode (Panacur®, Hoechst Roussel vet.), and ectoparasites (Cydectin ®, Fort Dodge) and
cestode (Neomanzonil ®, Bayer). The farm was located in Viterbo’s country on a hilly a landscape where wild animals (like
foxes) and hunting dogs were allowed in the farm’s field because of the lack of fence around the farm. Until 2002 some dogs
were present in the farm but they are been eliminated.
Clinical observations
The farm owners reported some cases of lamb’s acute mortality with nervous symptoms.
Some sheep became depressed, ceased feeding on the pasture and failed to respond to surrounding conditions. The animals
became visibly thinner. The position of the head and the gait and behavioural changes were recorded.
Post mortem examinations
Fifteen animals were examined post mortem. The head was removed by ventral disarticulation of the atlanto-occipital joint
and, after removal the skin, the area just caudal to the frontal bone was cut, followed by two parallel cuts on the parietal
bone. The bone was removed using a chisel and a hammer to expose the brain. A detailed examination was made for gross
pathological lesions. Cysts’ localizations and measures were recorded.
Tissue samples were fixed with 10% buffered formalin, processed routinely and stained with H & E and PAS.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
69
Results
Clinical observations
The farmer reported that in the period between 2000-2001 some sheep became depressed, ceased feeding on the pasture
becoming visibly thinner and failed to respond to surrounding conditions. Some of these animals showed periodic fits of
giddiness, they moved in circles either to the right or left. The attacks of gid may last anywhere from few minutes at to one
hour or more. Some sheep bended their heads or got it down and manifested neck’s rigidity, lethargy and “pedalage” when
down, unable to stand up. The clinical signs usually show an accurate correlation with the localization of the cysts within
the brain (Achenef et coll., 1999; Doherty et coll.., 1989). The prevalence of symptomatology, come out on 30 animals
in 2000-01, was been reduced by elimination of dogs and control of wild animals. Bacteriological analysis for Listeria spp.
and histopathological investigations for Scrapie were negative.
Post mortem examinations
Necropsy of 15 symptomatic animals revealed gross lesions consisting in parasitic cysts (Fig. 1 and 2), sometimes very large,
situated into and on the surface of the brain. None had Oestrus ovis.
These cysts, at the opening, showed a serous transparent liquid containing a lot of protoscolices. The diameter of the cysts
ranged from 1 cm to 5 cm and they had thin transparent wall with whitish specks representing invaginated scolices.
There are not strict correlations between cysts volume and severity of the symptoms; on the contrary the most important
element that influence the symptomatology was the location of the cysts.
Histologically it was possible to observe lesions typically associated of chronic coenurosis (Jubb et coll., 1993). In particular
it was possible to observe, near the parasitic cysts, sometimes the presence of a massive flogosis, sometimes pathway of
traumatic malacia foci with granulomatous lesions (Fig. 3) or in the nervous tissue, foci of malacia surrounded by very large
giant cells (Fig.4) caused by larvae’s migration (Di Marcoe et coll., 1998)
Fig. 1 Parasitic cyst presents on the surface
Fig.4: Foci of malacia surrounded
by very large giant cells.
Fig. 2 Transversal section of a cyst in formalin fixed
brain. of the sheep brain (arrow).
Fig. 3 Pathway of traumatic malacia foci with
granulomatous lesions.
Discussion
Coenurosis is one of the most common causes of neurologic diseases in sheep. In Italy the parasitosis is everywhere diffused
but a true prevalence of coenurosis is difficult to assess because farmers and veterinarians often diagnose the disease and send
the animal for slaughter without either confirmation or reports. In addiction some affected animals die on the hills and go
undiagnosed. In fact, since sheep heads are rarely examined for Coenurus cerebralis, it is difficult to estimate the prevalence
of sub-clinical coenurosis. In Europe, after the diffusion of the Bovine Spongiform Encephalitis and the experimental
70
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
demonstration of its transmission to the ovine specie (simptomatologically indistinguishable from Scrapie) a new attention
is request for a correct evaluation and diagnosis of coenurosis and the other neurologic diseases that affect the sheep.
Coenurosis in sheep may take either an acute or chronic form; its clinical picture depends partially on the localization of
the cyst in the brain, and on the size and the nature of the pathological changes (Martin and Aitken, 1991). The acute form
of the disease occur prevalently in lambs and a differential diagnosis is required with some intoxication (i.e. pesticides and
lead poisoning) or bacterial infection (Cl. tetanii and Listeria spp.). In fact some sheep may die between the 5th and the 7th
day after infection , at the appearance of acute meningo-encephalitis. In the majority of cases the disease assume a chronic
nature during which a symptomatology, that resemble the gadfly disease or Scrapie - BSE form, is observed. In our cases the
epidemiological data and finally the anatomopathological and microbiological reports are fundamental for the diagnosis.
However, in the latter cases the symptoms are less characteristic and are distinguished by the fact that the animals reverse
directions while going around in circles. In addition, during coenurosis, purulent discharge from the nose, typical of gadfly
infestion, is not observed.
Conclusions
In conclusion, as reported in literature, coenurosis should be eliminated by the regular anthelmintic dosing of dogs
and preventing their access to sheep carcasses. This could be useful to facilitate the control programs of listeriosis and
Transmissible Spongiform Encephalopathies and because of the zoonotic potential of this parasitosis.
References
1.
2.
3.
4.
5.
Achenef M., Markos T., Feseha G., Hibret A., Tembley S. (1999). Coenurus cerebralis infection in ethiopian highland sheep:
incidence and observations on pathogenesis and clinical signs. Tropical Animal Health and production, 31, 15-24.
Di Marco V., Riili S., Zanghì P., Capucchio M.T., Giraldo A., Guarda F. (1998). Dati epidemiologici, parassitologici e reperti
patologici della cenurosi negli allevamenti ovi-caprini siciliani. Large Animals Review, n°3, Settembre, 79-86.
Doherty M.L., Bassett H.F., Breathnach R., Monaghan M.L., McErlean B.A. (1989). Outbreak of acute coenuriasis in adult sheep
in Ireland. Vet. Record, 125:8, 185.
Jubb K.V.F., Kennedy P.C., Palmer N. (1993). Pathology of domestic animals. vol.1 Academic Press Inc, California.
Martin W.B., Aitken I.D. (1991). Diseases of sheep. Blackwell Scientific Publications, London.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
71
AGGIORNAMENTI SULL’EPIDEMIOLOGIA DI Echinococcus granulosus
IN SARDEGNA
Piazza C., Sardo D., Garippa G., Scala A., Varcasia A.
Dipartimento di Biologia Animale, Sezione di Parassitologia-Malattie Parassitarie,
Università degli Studi di Sassari.
Summary: Update on the epidemiology of Echinococcus granulosus in Sardinia
The aim of this work is to supply an update on the epidemiological trend of Echinococcosis in its definitive host the dog
as well as in sheep. For this reason, since january to april 2003, liver and lungs samples have been taken of 250 sheep of the
Sardinian breed, butchered by various slaughterhouses in the Provinces of Sassari and Nuoro, and their age and provenience
has been determined. Moreover faecal samples of 149 dogs coming from the aforesaid zones have been examined. The
number, location, type and fertility of the cysts has been determined in the lab. The macro and microscopical exam was
performed on the faecal samples to respectively assess the presence of proglottids (and/or adult worms) and of Taeniid eggs
through the sedimentation and flotation technique. Each faecal sample was processed with the Allan et al. (1992) method
to the following determination of Echinococcus granulosus’ coproantigens through CA-ELISA (Ekinotest by Bommeli).
A prevalence of 67,6% has been found in the examined sheep; however the percentage of sheep with fertile hydatids was
of 8,6% and 17,5% respectively in Sassari and Nuoro Provinces (χ2 = 13,17; P = 0,0002).
In the dogs, the copromicroscopic exam has high-lighted only four positive samples for Taeniid eggs, while CA-ELISA for
coproantigens detection has determined a prevalence of infection of 8,1% (χ2 = 4,23; P = 0,039).
Premessa
L’Echinococcosi rappresenta un importante problema di sanità pubblica in numerose aree del mondo e assume fra l’altro
particolare rilevanza nel bacino del Mediterraneo, dove è considerata una delle principali parassitosi degli animali in
produzione zootecnica e riveste un notevole significato sociale per l’alta diffusione nell’uomo (Eckert et al, 2001).
In Sardegna, ad oltre dieci anni dall’ultima campagna di eradicazione dell’Echinococcosi, si registrano ancora negli
ovini delle prevalenze allarmanti, come documentato da Scala et al. (2001). Inoltre, nonostante esistano numerosi lavori
sulla diffusione di questa importante zoonosi, mancano soprattutto dei dati aggiornati che documentino la situazione
epidemiologica dell’Echinococccosi nel suo principale ospite definitivo, il cane.
Pertanto l’obiettivo del presente lavoro, tuttora in corso, è quello di fornire degli aggiornamenti sul trend parassitologico
dell’infestazione, sia negli ovini che nel cane.
Materiali e metodi
Da gennaio ad aprile 2003, sono stati esaminati 250 ovini di razza Sarda regolarmente macellati in diversi mattatoi delle
Provincie di Sassari e di Nuoro, dei quali si determinava provenienza, età e modalità di allevamento.
Su ogni capo riscontrato positivo all’infestazione sono stati quindi valutati il numero, la localizzazione e il tipo di idatidi
riscontrabili secondo la seguente classificazione: fertili, acefalocisti, caseose e calcificate.
Al fine di valutare la fertilità di tali formazioni, sono state prelevate, attraverso le tecniche di routine, le membrane
proligere e i protoscolici. Di questi ultimi è stata valutata la vitalità attraverso l’esame a fresco (conformazione, movimenti,
evidenziazione delle cellule a fiamma vibratili) ed eventuale colorazione con coloranti vitali (rosso neutro 0,5%).
Il monitoraggio epidemiologico nei confronti dell’Idatidosi ha inoltre tenuto conto, al fine di valutare il grado di pressione
parassitaria esercitata sul territorio dal cestode, di altri due importanti parametri quali, il tasso di prevalenza dell’infestazione
mista (fegato e polmone) e la percentuale di soggetti con infestazioni massive (>10 Idatidi).
Per valutare il grado di infestazione nell’ospite definitivo è stato raccolto materiale fecale da un campione statisticamente
significativo di 190 cani da pastore delle Provincie di Sassari e Nuoro (livello di confidenza 0,95).
Ciascun campione fecale, previo congelamento a –80° per 96 ore, è stato suddiviso in 3 aliquote: la prima, dopo un preliminare
esame macroscopico per la ricerca di eventuali parassiti e/o proglottidi, è stata sottoposta ad esame copromicroscopico
per sedimentazione e successiva flottazione utilizzando una soluzione di Tiosolfato di Sodio (p.s. 1.450) finalizzata
all’evidenziazione di uova di tenidi; la seconda aliquota è stata processata secondo la metodica di Allan et al. (1992) per
la determinazione, mediante ELISA (Ekinotest, Bommeli), degli antigeni di secrezione-escrezione di Echinococcus spp.
eventualmente presenti nelle feci, i cosiddetti coproantigeni (CA); infine, la terza aliquota, rappresentata da tutti i campioni
positivi al test immunoenzimatico veniva stoccata a –20°C per la successiva estrazione del DNA e validazione dell’ELISA
mediante PCR specie specifica che verrà eseguita in una seconda fase del progetto.
Risultati
L’indagine condotta sugli ovini ha consentito di rilevare una prevalenza totale all’infestazione per Echinococcosi cistica del
67,6% con una fertilità del 11,2%. L’Abbondanza (numero Idatidi/ animali esaminati) è risultata 5,4, mentre l’Intensità
Media (numero Idatidi / animali positivi) 8,0.
La Provincia di Nuoro si è confermata il distretto in cui si rileva la Prevalenza più alta all’infestazione (85,9%) e i livelli di
fertilità delle Idatidi più elevati (17,5%). In Provincia di Sassari i livelli di infestazione hanno mostrato un lieve calo rispetto
agli ultimi rilievi effettuati; infatti la prevalenza si è portata dal 75,6% nel 2001 (Scala et al, 2001) al 59,8% attuale, mentre
il tasso di fertilità è risultato pressochè costante (8,6%). La differenza fra le prevalenze e la fertilità delle due Provincie messe
a confronto è risultata in entrambi i casi statisticamente significativa al Test del χ2 (P < 0,001). Ulteriori dati su prevalenze
e fertilità delle idatidi riscontrate sono riportate nel grafico n°1.
72
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Grafico n°1:
Per quanto riguarda i cani, l’esame macroscopico dei campioni fecali non ha mai consentito il riscontro di forme parassitarie
e/o di loro forme di propagazione, mentre quello copromicroscopico ha permesso di evidenziare uova di tenidi solo in
quattro campioni (2,6%). Inoltre l’eventuale riscontro di uova di Taenia spp. non consente all’operatore una diagnosi di
specie, data la notevole somiglianza delle uova dei parassiti che appartengono a questo Taxon.
La metodica immunoenzimatica utilizzata per la ricerca dei coproantigeni di Echinococcus spp. ha consentito di determinare
una prevalenza dell’infestazione dell’8,1% (n° 8). Il confronto statistico tra le due metodiche diagnostiche utilizzate ha
evidenziato differenze significative tra loro per ciò che concerne i valori di positività evidenziati (χ2 = 4,23; P = 0,039).
Considerazioni
La presente indagine ha consentito di rilevare negli ovini una situazione epidemiologica non omogenea nei territori
considerati.
La Provincia di Nuoro si conferma un distretto in cui il Cestode esercita un’alta pressione parassitaria, riscontrandosi
prevalenze ancora molto elevate accompagnate da livelli di fertilità preoccupanti.
Differente invece il “trend” delle parassitosi negli ovini allevati in provincia di Sassari, in cui si evidenzia un decremento
dei principali parametri epidemiologici (prevalenza, fertilità, etc.), probabilmente da mettere in relazione anche ad
un’aumentata sensibilità degli allevatori che con un più attento management, una più razionale alimentazione e l’utilizzo
di trattamenti antiparassitari periodici contro i Nematodi con Benzimidazolici (Scala et al, 1999), molecole attive anche
contro le forme larvali di Echinococcus granulosus (Garippa et al., 1998), e che favoriscono, in virtù della loro attività contro
i nematodi gastrointestinali e broncopolmonari, una più efficace risposta immunitaria degli ovini contro le idatidi, rispetto
ai piccoli ruminanti allevati in provincia di Nuoro.
E’ tuttavia anche ipotizzabile il fatto che consuetudini più arcaiche legate all’allevamento ovino (uso di pascoli demaniali,
transumanza, etc.) siano maggiormente “radicate” nel Nuorese e che queste consentano soprattutto in questo territorio
l’estrinsecarsi in tutta la sua “virulenza” del problema Echinococcosi.
L’indagine sui cani ha consentito di rilevare delle prevalenze più contenute rispetto agli ultimi dati disponibili a riguardo in
Sardegna, sebbene questi ultimi siano stati ottenuti mediante riscontro diretto del parassita (Arru et al., 1991). La metodica
ELISA ha inoltre confermato i limiti, peraltro già noti, dell’esame coprologico nella diagnostica delle Cestodosi.
Il kit immunoenzimatico utilizzato per la ricerca dei coproantigeni si è dimostrato inoltre maneggevole e sicuro per
l’operatore in quanto la soluzione con i coproantigeni non contiene uova del cestode (Allan et al., 1992) e ha consentito di
processare contemporaneamente un gran numero di campioni.
Purtroppo l’utilizzo di anticorpi policlonali può determinare delle cross-reazioni con altri cestodi tenidi, come Taenia
hydatigena, che possono costituire quindi un fattore di complicazione in aree dove queste parassitosi sono endemiche.
Per questo è sicuramente interessante affiancare alla metodica immunoenzimatica una tecnica più sensibile come la PCR,
o implementare la sensibilità della metodica ELISA utilizzando anticorpi monoclonali specifici, così come suggerito
recentemente da Malgor et al. (1997).
Tuttavia il rilievo nei cani di positività per T. hydatigena, dimostra un effettivo fallimento di tutte le misure di profilassi e
controllo anche per l’Echinococcosi, in quanto è evidente in entrambi i casi come i cani abbiano avuto libero accesso ai
visceri di animali morti naturalmente e/o macellati portatori della metacestodosi (Scala et al., 2002).
Conclusioni
Purtroppo anche la presente indagine ha confermato, seppur in presenza di qualche dato confortante acquisito negli ovini
in provincia di Sassari, che l’Echinococcosi-Idatidosi costituisce per l’isola ancora oggi un importante problema sanitario in
grado di coinvolgere in modo significativo le performances del settore zootecnico più importante e di poter compromettere
in modo non sottovalutabile la salute pubblica.
Gli interessanti progressi scientifici in campo diagnostico nel cane potrebbero costituire un importante cardine su cui
basare eventuali ulteriori piani di controllo della parassitosi in Sardegna.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
73
Bibliografia
1)
Allan J.C., Craig P.S., Garcia Noval J., Mencos F., Liu D., Wang Y., Wen H., Zhou P., Stringer R., Rogan M., Zeyhle E.,
Coproantigen detection for immunodiagnosis of echinococcosis and taeniasis in dogs and humans. Parasitology, 1992,
104, pp. 347–355.
2)
Arru E., Gabriele F., Palmas C., Scarano C., Corrias P., Firinu A., Cannas A., Masala S., Ponti N., Rolesu S., Sulis F., Pira M.,
Economic damages of human and animal hydatidosis in Sardinia, Italy. XV Extraordinary Congress for the Celebration of 50 years
of A.I.H., Rome November 4-8, 1991.
3)
Craig P.S., Gasser R.B., Parada L., Cabrera P., Parietti S., Borgues C., Acuttis A., Agulla J., Snowden K., Paolillo E.,
Diagnosis of canine echinococcosis: comparison of coproantigen and serum antibody tests with arecoline purgation in
Uruguay. Veterinay Parasitology, 1995, 56, pp. 293–301.
4)
Eckert J., Deplazes P., Craig P.S., Gemmell M.A., Gottstein B., Heath D., Jenkins D.J., Kamiya M., Lightowlers M.,
Echinococcosis in animals: clinical aspects, diagnosis and treatment. In: Eckert J., Gemmell M.A., Meslin F., Pawlowski
X.Z. (Eds.), WHO/OIE Manual on Echinococcosis in Humans and Animals: A Public Health Problem of Global
Concern. World Organisation for Animal Health, Paris, 2001, pp. 72–99.
5)
Garippa G., Masala S., Biddau M., Leori G., Arru E., New data on chemoprophilaxis of ovine hydatidosis, Parassitologia,
1998, 40, (1).
6)
Malgor R., Nonaka N., Basmadjian I., Sakai H., Carambula B., Oku Y., Carmona C. and Kamiya M., Coproantigen
detection in dogs experimentally and naturally infected with Echinococcus granulosus by a monoconal antibody-based
enzyme-linked immunosorbent assay. International Journal for Parasitology, 1997, 27, pp. 1605–1612.
7)
Scala A., Bitti P.L., Fadda M., Pilia A., Varcasia A., I trattamenti antiparassitari negli allevamenti ovini della Sardegna,
VII Congress Fe.Me.S.P.Rum, 1999, pp. 267-272.
8)
Scala A., Uras P., Pintori A., Poglayen G., Giannetto S., Brianti E., Garippa G., Epidemiological updating on Hydatidosis
in sheep in insular Italy, XX International Congress of Hydatology, Turkey 2001, 34, pp. 303.
9)
Scala A., Urrai G., Ruiu A., Leoni A., Marrosu R., Garippa G., Una metacestodosi spesso sottovalutata negli ovini: la
cisticercosi da Cysticercus tenuicollis. XV Congresso Nazionale S.I.P.A.O.C., Chia, 2002, 15, pp. 92.
Realizzato con la collaborazione tecnica del sig. M.S. Nieddu - Fondi MURST - legge 488/98
74
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
PATHOLOGICAL OBSERVATIONS OF A FOCUS OF CYSTICERCOSIS IN IMPORTED CATTLE
Preziuso S.°, Taccini E.°, Pardini S.*, Braca G.°
° Dipartimento di Patologia Animale, Profilassi e Igiene degli Alimenti – Università di Pisa (Italy)
* Azienda USL 3 Pistoia (Italy)
Abstract
Bovine cysticercosis is caused by Cysticercus bovis, the larva of human Taenia saginata (Goeze, 1782). Despite this zoonosis has been
known since early times, it is still present in several areas of Europe. Besides being a risk for human health, bovine cysticercosis causes
significant economic losses in consequence of the low temperature treatments or the destruction of contamined carcasses.
In this work it is described an unusual focus of bovine cysticercosis observed in 7 out of 27 Limousin cattle imported since about two
months from the French department 19 (Correze) and slaughtered in different abattoirs of Tuscany (Italy).
The parasitic infection appeared very diffused. During post-mortem examination, several whitish cysts, about 2-4mm x 6-9mm in size,
not calcified and located in different sites were detected.
Histopathological examination of the involved tissues revealed cellular reactions of different severity.
A close morphological and histopathological examination is very important not only for a differential diagnosis, but also for the indication
of the minimum and maximum time of infection, helping the reconstruction of the infection evolution and the application of specific
preventive treatments.
Introduction
Bovine cysticercosis is caused by Cysticercus bovis, the larva of human Taenia saginata (Goeze, 1782). Despite this zoonosis has been known
since early times, it is still present in several areas of Europe. Control measures, mainly relied upon meat inspection at slaughtering, have
been recently implemented in order to reduce teniosis/cysticercosis prevalence. The number of cases has thus markedly decreased but the
residual incidence of T. saginata and C. bovis, both in humans and cattle, shows that the parasitic cycle remains active in EU Member
States. Although human T. saginata teniosis is not a significant public health issue, its current persistence in developed countries causes
debilitation in humans and can be considered as an indicator of poor hygiene and as such, its control should be investigated in a global
perspective of public hygiene.
Man is the final host: the adult worms live in the small bowel and the eggs in proglotis are excreted with the faeces. Cattle are the
intermediate host: bovine cysticercosis is the consequence of an oral infection with embrionated eggs. After ingestion, the embryos
(oncosphere) move from the intestine to striated musculature, where they develop into small vesicles (cysticerci) containing one head
(protoscolex) of the future tapeworm. The life cycle is completed when humans consume undercooked beef which contains viable
cysticerci.
Veterinary at slaughterhouse plays an important role in public health protection. The identification of C. bovis during meat inspection
is important for the prevention of this zoonosis, but also others measures should be taken. For example to find the farm where the cattle
were infected would let the application of targeted and effective prevention plans. Lastly, because the economic losses due to the low
temperature treatments or destruction of the infested carcasses, it could be necessary to identify the farm where the infestion has occurred,
mainly when cattle are recently imported.
In this work it is described an unusual focus of bovine cysticercosis observed in 7 out of 27 Limousin cattle imported since about two
months from the French department 19 (Correze) and slaughtered in different abattoirs in Tuscany (Italy). Both for the significant
economic losses and for the farmer health protection it has been necessary to investigate the times of the infestion, in order to estabilish
in which farm (French or Italian) the infestion has occurred.
Materials and methods
27 Limousin cattle, born in March 2001 in a French farm of the sanitary Department 19 of Correze, were imported in September 2001
by a Tuscan (Italy) farmer. After two months the animals were slaughtered in different abattoirs placed in Tuscany and meat inspections
were performed according to Directive 64/433/CEE and the Italian D.Lvo n. 286 18/4/1994 (application of Directives 91/479/CEE
and 91/489/CEE).
Samples of different cysticerci were collected from the infested muscles, fixed in 10% buffered formalin and embedded in paraffin. For
histopathology, 4μm sections, haematoxylin and eosin stained, were observed at light microscopy.
Fig. 1
Fig. 2
Fig. 1: bovine heart; C. bovis in myocardium. The cysts are round or elongated in shape and surrounded by a whitish tissue reaction
Fig. 2: bovine masseter muscle. C. bovis is surrounded by two distinct layers of cellular (inner) and fibrous (outer) tissue reaction. H.E., 5 X
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
75
Fig. 3
Fig. 4
Fig. 3: bovine diaphragm. Inner layer of tissue reaction surrounding C. bovis: several mononuclear cells, eosinophil granulocytes and
scattered giant cells. H.E., 20 X (inset 40 X)
Fig. 4: bovine hearth. Outer layer of tissue reaction surrounding C. bovis: compact fibrous tissue, with fibroblasts and scattered
inflammatory cells. H.E., 20 X (inset 40 X)
Discussion and Conclusions
The results described show the presence of parasitic cysts with tissue reaction of different severity, but referable to
a non recent infestion. The clean demarcation between the two cellular and fibrous layers, the presence of a compact
fibrous connective tissue, the high number of mononuclear cells and the presence of small/numerous areas of dystrophic
calcification in several cysts, suggest an inflammation since at least two months. Thus our results suggest the source of
infestion has to be investigated in the French farm where the cattle were coming from. Since there not exists a formal
notification of tapeworm carriership in humans in any EU Member State, it is quite probable the official epidemiological
data underestimate the actual human Taenia carriership. It has to be considered also that these prevalences may increase
also because many people handling animals are coming from countries with high prevalences of T. saginata infestion and
often they are not checked for the presence of intestinal parasites.
In conclusions, every time a case of bovine cysticercosis is found, it would be recommendable to investigate the source of
infestion and to apply specific therapeutic and preventive plans.
References
1.Castoldi F. (1994).Cisticercosi bovina. Una parassitologia ancora di attualità. Summa, 11(1):57-60.
2. Ceretto F., Julini M., Bertolotti P.P (1986a). Prevenzione della cisticercosi bovina. Obiettivi e Documenti Veterinari, 12:37-42.
3. Ceretto F, Julini M, Siboum M. (1986b). Una zoonosi da non sottovalutare. La teniasi-cisticercosi da Taenia saginata. Obiettivi e
Documenti Veterinari, 6(2-3):25-28.
4. Del Bono G., Macchioni G., Marconcini A., Arispici M., Rindi S., Testi F., Scaramella D., Abdulatif MA., Mohamud HM.,
Abdulhamid HM. (1982). La cisticercosi dei ruminanti. In: Jaamacadda Ummadda Soomaaliyeed Kulliyadda Xanaanada and Daawada
Xoolaha. III Bollettino Scientifico della Facoltà di Zootecnia e Veterinaria. Pacini Editore, Pisa, pp 5-76.
5. Dorny P., Vercammen F., Brandt J., Vansteenkiste W., Berkvens D., Geerts S. (2000). Sero- epidemiological study of Taenia
saginata cysticercosis in Belgian cattle. Veterinary Parasitology, 88:43-49.
6. European Commission (2000) Health & Consumer Protection directorate-general Directorate C-Scientific Opinions C3 Manegement
of Scientific committees II; scientific co-operation and netwoks Opinion of the Scientific Committee on Veterinary Measures relating to
Public Healton The control ofTeaniosis/cysticercosis in man and animals (adopted on 27-28 September 2000).
7. FAO-OIE-WHO. (1997). Animal Health Yearbook 1995. Food and Agricoltural Organisation of the United Nations, Rome
8. Farina G., Mosna A., Zanin E. (1990). Cisticercosi bovina in Valle di Sole. Obiettivi e Documenti Veterinari, 11(12):53-55.
9. Giovanni F.de., Cortesi ML., Caputo V. (1985). Presenza di cisticerchi in lingue e cuori bovini recepiti sul mercato. Il progresso
veterinario. 40(13):592.
10. Himonas C., Saravanos A., Euzeby J., Gevrey J. (1983). Bovine cysticercosis in Greece. Agriculture. Some important parasitic
infections in bovines considered from economic and social (zoonosis) point of view. Parasitological symposium, Lyons, 24-26 October,
199-203.
11. Holt K. (1985). Taenia saginata in the Scottish environment. State Veterinary Journal, 39(114):14-21.
12. Ilsoe B., Kyvsgaard NC., Nansen P., Henriksen SA. (1990). Bovine cysticercosis in Denmark. A study of possible causes of
infection in farms with heavily infected animals. Acta Veterinaria Scandinavica, 31(2):159-168.
13. Julini M., Chinazzo A., Mirengo AM. (1985). La cisticercosi bovina presso il macello di Cairo Montenotte. Obiettivi e Documenti
Veterinari, 11:49-51.
14. Kyvsgaard NC., Ilsoe B., Willeberg P., Nansen P., Henriksen SA. (1991). A case-control study of risk factors in light Taenia
saginata Cysticercosis in Danish cattle. Acta Vet Scand, 32(2):243-52.
15. Lorenz J. (1992). Epidemiology of Taenia saginata infection. Angewnde Parasitologie, 33(1):23-31.
16. Marceddu L., Mellis G. (1985). Prima segnalazione di Cysticercus bovis in Sardegna. Il Nuovo Progresso Veterinario, 40(22): 960.
17. Mariani L., Marchese GP., Mastroeni G., Lianos E., Gulisano G. (1994). Aspetti epidemiologici delle enteroparassitosi in Africani
recentemente immigrati in Catania. Medicina Tropicale nella Cooperazione allo Sviluppo, 10(1-2):17-18.
18. Mobius G. (1993). Epidemiological studies on Cysticercus bovis and Taenia saginata infections in East and West-Germany. Deutsche
Tierarztliche Wochenschrift, 100(3):110-114.
19. Poire G., Sassetti M., Magi M. (1994). Cisticercosi bovina. I riscontri della parassitosi negli impianti di macellazione del Chiavarese.
Obiettivi e Documenti Veterinari, 15(5):55-57.
20. Pozio E. (1991). Current status of food-borne parasitic zoonoses in Mediterranean and African regions. The Southeast Asian Journal
of Tropical Medicine and Public Health, 22:85-87.
21. Salvi S.; Manini C.; Voi M. (1986). Cisticercosi bovina presso il macello di Milano dal 1975 al 1984. Ing. Alim., 28-32.
76
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
EFFETTO DELLE TEMPERATURE AMBIENTALI SU ALCUNI PARAMETRI EMATICI E
SULL’ESCREZIONE FRAZIONARIA DEGLI ELETTROLITI NELL’ALPACA (LAMA PACOS)
Morgante M., Stelletta C1., Tacchio G.
Dipartimento di Scienze Cliniche Veterinarie, Università degli Studi di Padova, 35020 Legnaro (PD). Tel. +39 049
8272942 E-mail: [email protected]
1
Università degli Studi di Perugia.
Effect of environmental temperature on some blood parameters and fractional excretion of electrolytes in the alpaca (Lama
pacos) - The influence of environmental temperature variations on some blood parameters and on fractional excretion
of electrolytes was studied on six female alpacas. Blood and urine samples were collected at 2-h intervals for 24 hours in
two different periods. The first period was characterized by a low temperature (min 5°C and max 13,5°C) ; in the second
period the temperature was extremely different (min 11,5°C max 33,5°C). From the blood samples were obtained some
parameters as HCT, PPT, MCV, MCH, MCHC, BUN and Creatinine, Na, K, Ca, P, Mg concentrations. From the
urine samples were obtained urine creatinine, Na, K, Ca, P, Mg concentrations. Fractional excretions were also calculated.
Hct is not a good parameter to evaluate alpaca hydration status, because of the MCV reduction. Instead, PPT associated
to plasmatic creatinine are more reliable indices. The results of study present useful parameters to understand the South
American Camelids kidney functionality and can give an explanation of physiological response to the environmental heat
stress, providing a starting point to evaluate urine electrolytes circadian rhythm variations. Anyway we are aware that in
order to have a better understand of factors that could influence the described mechanisms a lot of elements should be
considered as physiologic and alimentary conditions and breeding management differences.
Introduzione
Anche in Italia gli alpaca risultano essere animali di interesse zootecnico. Il loro alto valore economico e la loro capacità di
adattamento a diverse condizioni ambientali ha reso possibile un aumento numerico in zone diverse da quelle di origine.
Le grandi differenze anatomiche e fisiologiche dagli altri animali li rendono particolarmente interessanti soprattutto nello
studio dei parametri diagnostici. Le conoscenze riguardanti le variazioni dei valori urinari in relazione a quelli ematici
risultano essere poco approfondite in particolare dati relativi alle influenze dei sincronizzatori esogeni (fotoperiodo,
alimentazione, assunzione di acqua) rispetto a quelli endogeni extrarenali (pressione arteriosa, frequenza cardiaca e la
concentrazione plasmatica dei soluti) ed intrarenali (emodinamica renale, processi di riassorbimento ed escrezione) sono
in numero molto ridotto. Non esistono in letteratura riferimenti per i camelidi sudamericani riguardanti le variazioni
giornaliere dell’escrezione renale degli elettroliti in rapporto ad indici della funzionalità renale. Scopo di questo lavoro è
stato quello di valutare le variazioni di alcuni parametri ematici e dell’escrezione renale degli elettroliti attraverso il calcolo
delle clearances frazionarie in alpaca a differenti temperature ambientali.
Materiali e metodi
Allo scopo sono state scelte sei femmine di alpaca, clinicamente sane, di età compresa tra 4 e 6 anni, gravide di 5 mesi,
allevate presso l’allevamento Maridiana S.r.l. di Umbertide (PG). Gli animali sono stati sottoposti a 12 controlli giornalieri
per due volte consecutive a distanza di 21 giorni l’uno dall’altro. La temperatura ambientale, espressa in minima e massima
giornaliera rilevata nei due periodi è stata di 5 - 13,5°C e 11,5 - 33,5 °C rispettivamente per il primo ed il secondo periodo.
La dieta, costituita da fieno polifita, è stata somministrata ad libitum durante entrambi i periodi. Durante il periodo della
sperimentazione gli animali hanno avuto a disposizione un recinto dove potersi muovere liberamente negli intervalli tra
i prelievi. Due ore prima dell’inizio di entrambi i periodi si è proceduto nella cateterizzazione degli animali utilizzando
cateteri permanenti tipo Foley (type Gold 2 way Sil 5cc 18 Fr - Rusch Gold Silicone Coated Latex Foley Catheter) di
40 cm di lunghezza. Durante entrambi i periodi sono stati effettuati prelievi di sangue ed urina ad intervalli di 2 ore uno
dall’altro. I prelievi di sangue sono stati eseguiti a livello della giugulare destra ed i campionamenti delle ore di buio sono
stati effettuati utilizzando una luce rossa per evitare eventuali variazioni dei parametri dovuti alla stimolazione fotica della
retina. Con i campioni di sangue sono state costituite due aliquote, la prima aggiunta ad EDTA come anticoagulante, è
stata immediatamente refrigerata a 4 °C, e destinata agli esami emocromocitometrici effettuati subito dopo la fine di ogni
periodo; la seconda aliquota aggiunta ad eparina è stata centrifugata a 3000 g/min per 10’, il plasma ottenuto è stato congelato
a -20 °C e destinato alla determinazione dei parametri ematici. I campioni di urina sono stati congelati immediatamente
e destinati agli esami di laboratorio. I valori di Na+ e K+ plasmatici ed urinari sono stati determinati utilizzando uno
fotometro a fiamma (SEAC F20), mentre le Proteine totali plasmatiche, l’azoto ureico plasmatico, la Creatinina, il Calcio,
il Fosforo ed il Magnesio plasmatici e urinari sono stati determinati utilizzando kit commerciali per un analizzatore
automatico per biochimica clinica (Hitachi 912). Gli indici eritrocitari (HCT, MCV, MCH, MCHC) sono stati ottenuti
utilizzando un contaglobuli automatico ad impedenza elettrica (SEAC Hemat 10). I dati ottenuti sono stati sottoposti ad
analisi statistica secondo un modello ANOVA per dati ripetuti utilizzando il software Sigmastat 2.03. Nell’analisi i due
fattori presi in considerazione sono stati il periodo ed il prelievo. Le differenze tra i valori medi dei parametri nei diversi
prelievi all’interno di ogni periodo nonché quelle tra i due periodi sono state determinate utilizzando il test di Tukey.
Risultati e discussione
Le medie stimate e le deviazioni standard ottenute nei singoli periodi con i dati raccolti nell’arco dell’intera giornata sono
riportate nella tabella 1. Tranne che per i valori della potassiemia e della natremia del secondo periodo, tutti i parametri
presi in considerazione rientrano nei range di riferimento riportati in letteratura (Kaneko et al., 1997). Per quanto attiene
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
77
alle variazioni dei parametri ematici non sono state messe in evidenza differenze statisticamente significative per quanto
riguarda i livelli di proteine totali, urea ed HCT, mentre risultano mediamente variati quelli di creatinina, MCH, MCHC,
Ca e Mg. Nessuna differenza significativa è stata evidenziata per quanto riguarda i valori medi delle clearance frazionarie
degli elettroliti. Per quanto riguarda le correlazioni semplici l’urea, la creatinina e la calcemia sono è correlate positivamente
con le proteine plasmatiche in entrambi i periodi (Tabella 1).
I lamoidi sono particolarmente adattati ad un ambiente freddo, ma hanno manifestato una buona adattabilità agli ambienti
più diversi. Questi animali possiedono delle ghiandole sudoripare epitrichiali soprattutto nelle aree ove la fibra è più
rada, per esempio nella regione ventrale dell’addome (Fowler, 1998). Pur essendo animali capaci di tollerare un grado di
disidratazione (ed emoconcentrazione) che sarebbe fatale per gli esseri umani o per animali adattati ai climi temperati,
Solamente uno studio è stato svolto sul bilancio idrico dei lama, nel quale questi animali sono stati comparati alle capre. Si
è evidenziato che in caso di privazione idrica i lama continuano ad alimentarsi, mentre le capre riducono anche l’ingestione
di alimento. E’ probabile che i lamoidi siano capaci di utilizzare l’acqua metabolica proveniente dall’alimento attraverso
una spiccata attività ossido-riduttiva. Entrambe le specie mostrano una buona capacità di concentrare le urine (Rübsamen
et al., 1975). In tutti i ruminanti la disidratazione risulta in un elevato HCT, Hb, conta eritrocitaria, proteine plasmatiche
totali, BUN e creatinina. I valori chimici del sangue per il sodio, il potassio, il cloruro ed il bicarbonato possono variare in
seguito a questo processo (Fowler, 1989).
Tabella 1: medie stimate dei parametri considerati nei due periodi
Parametri
1° periodo
2° periodo
P
PPT (mg/dl)
59,2±3,0
62,35±1,75
n.s.
UREA (mg/dl)
26,8±2,4
25,24±2,11
n.s.
HCT (%)
29,66±1,14
28,66±0,23
n.s.
MCV (fl)
29,45±0,34
25,07±0,25
< 0,05
MCH (pg)
12,72±0,42
10,48±0,04
< 0,001
MCHC (g/dl)
43,21±1,06
41,67±0,3
< 0,01
Crea (mg/dl)
1,30±0,07
1,47±0,07
< 0,05
Na (mmol/l)
150,95±4,27
159,41±2,4
n.s.
%CrNa (%)
0,12±0,09
0,05±0,025
n.s.
K (mg/dl)
4,53±0,28
7,91±1,32
n.s.
%CrK (%)
35,08±10,85
10,06±2,34
n.s.
Ca (mmol/l)
8,2±0,22
9,19±0,19
< 0,05
%CrCa (%)
0,2±0,03
0,42±0,25
n.s.
P (mmol/l)
3,63±0,62
4,56±0,63
n.s.
%CrP (%)
0,29±1,27
0,19±0,09
n.s.
Mg (mmol/l)
2,23±0,09
2,56±0,17
< 0,01
%CrMg (%)
1,19±1,93
1,18±1,05
n.s.
Nel nostro studio i parametri ematici presi in considerazione per valutare lo stato di idratazione degli animali
sono stati l’ematocrito (HCT), le proteine totali plasmatiche (PPT), l’urea e la creatinina plasmatica. Nello
studio in oggetto una differenza significativa tra periodi esiste per il volume corpuscolare medio (MCV). Nel
primo periodo in media esso è di 29,46 ± 0,34 fl, mentre nel secondo è di 25,07 ± 0,25 fl (Tab.3). I camelidi sono
caratterizzati da una spiccata anisocitosi eritrocitaria, normalmente l’MCV può variare dai 20 ai 29,5 fl (Smith,
1996). Queste variazioni corpuscolari potrebbero essere legate all’aumento dell’osmolalità plasmatica. Sebbene
non misurata l’osmolalità plasmatica dovrebbe risultare più elevata nel secondo periodo visti gli aumenti medi di
tutti gli elettroliti, anche se significativamente soltanto di CA e Mg. La diminuzione dell’MCV si oppone, fine ad
un certo limite all’aumento dell’HCT nel corso della disidratazione. La diminuzione del MCV condizionerebbe
anche le concentrazioni emoglobiniche medie. Solo la creatinina mostra un aumento significativo tra il primo
e il secondo periodo, questo può indicare uno stato di disidratazione oppure una diminuzione della velocità
di filtrazione glomerulare (VFG). La quota di creatinina escreta nelle 24 ore corrisponde a quella prodotta
nell’organismo nello stesso intervallo di tempo e quindi la sua concentrazione plasmatica rimane pressoché
costante (Clement, 1992). La determinazione della creatininemia, nella maggior parte dei casi, è un indice
attendibile della VFG (Clement, 1992); se la creatininemia aumenta, la VFG diminuisce, ma la creatinina
nell’ultrafiltrato totale delle 24 ore sarà uguale. Esiste una sola pubblicazione che fornisca dei dati circa le
clearance frazionarie per i camelidi sudamericani. Il lavoro di Lackey et al. (1995) fornisce degli indici urinari
78
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ottenuti da lama alimentati in maniera diversa. Lachey et al. hanno messo in risalto come in lama clinicamente
sani le %Cr degli elettroliti possono fornire una indicazione ragionevole della clearance (CL) degli stessi. Inoltre
le clearance degli elettroliti, tranne quella del fosforo, sono correlate alla CL della creatinina. Tranne che per
la %CrP i valori di escrezione frazionaria risultano simili a quelli riportati da Lackey et al. (1995) nel lama. Le
escrezioni frazionarie degli elettroliti riferiscono la percentuale di elettrolita filtrato che resta nelle urine. In realtà
non rispecchiano la quota di elettroliti escreti, ma possono essere utilizzati come indici della funzionalità renale
ed in particolare quella tubulare. In generale più la concentrazione ematica dell’elettrolita aumenta e più la sua
escrezione frazionaria diminuisce. Dai risultati ottenuti, si può affermare che anche per i camelidi sudamericani
esiste una correlazione negativa tra la clearance frazionaria e la concentrazione ematica di alcuni elettroliti
considerati (tab.1a, 1b, 2a, 2b). Durante il primo periodo si nota la suddetta correlazione per calcio, fosforo e
magnesio; nel secondo per potassio e fosforo. La %Crk è risultata essere più bassa rispetto a quella dei bovini
(Itoh, 1989; Morgante et al., 1996; Fleming et al., 1991;; Meyer et al., 1992; Morgante et al., 2000). Invece per
quanto riguarda quella del fosforo, i dati sono simili a quelli riportati per i bovini (Morgante et al., 1993; Garry
et al., 1991a; Fleming et al., 1992) mentre sono più bassi in relazione a quelli di Morgante et al. (1996; 2000).
Per il Na i valori medi di clearance frazionaria risultano più elevati. Anche la %CrCa media risulta molto simili
a quelle dei bovini (Morgante et al., 1996; Itoh, 1989; Meyer et al., 1982; Yestweber et al., 1989) ed a quella
delle pecore (Fleming et al., 1991). Per quanto riguarda la %CrMg essa si presenta essere più bassa di quella dei
bovini (Morgante et al., 1996; Morgante et al., 1993; Garry et al., 1991a; Fleming et al., 1992) e delle pecore
(Fleming et al., 1991). Se i dati ottenuti si paragonano a quelli di specie non ruminanti, si nota come i valori
della %Crk siano più elevati di quelli riportati nel cavallo (Brobst e Pary, 1987 ; Edwards et al., 1989), nel cane
(Chew e Di Bartola, 1989) e nel gatto (Adams et a., 1991).
Conclusioni
Secondo Fowler (1998), i parametri eritrocitari sfruttabili per definire lo stato di idratazione dei camelidi
sudamericani sono l’ematocrito (HCT), le proteine plasmatiche totali (PPT), l’uremia (BUN), la creatininemia
e la conta eritrocitaria (RBC), similmente ai comuni ruminanti domestici. Dai risultati del presente studio
l’HCT da solo non risulta essere un buon indice dello stato di idratazione dei camelidi sudamericani. Infatti, la
riduzione dell’MCV, ovviamente fino a determinati punti limite non ancora stabiliti, impedisce una segnalazione
attendibile di un’eventuale stato di disidratazione e della sua gravità. E’, invece, maggiormente significativa, in
questo senso, l’analisi delle proteine associate a quella della creatininemia. I risultati del presente studio possono
essere utili indicatori della funzionalità renale nei camelidi sudamericani, la risposta fisiologica allo stress termico
ambientale ed un punto di partenza per la valutazione dell’escrezione degli elettroliti. Naturalmente per avere
una chiara visione dei fattori che influenzano detti meccanismi dovrebbero essere presi in considerazione molti
altre variabili come ad esempio le diverse condizioni fisiologiche (animali non gravidi od in lattazione, di diversa
età e sesso), le diverse condizioni di alimentazione (tipo e composizione della dieta), le diverse condizioni
d’allevamento.
Bibliografia
Adams L.J.,Polzin D.J., Osborne C.A., O’Brien T.D. (1991). Comparison of fractional excretion and 24-hours urinary excretion of
sodium and potassium in clinically normal cats and cats with induced chronic renal failure. Am. J. Vet. Res. (5), 718-722.
Brobst D.F. e Parry B.W. (1987) - In: Robinson N.E., Current Therapy in Equine Medicine, 2nd. Ed., W.B. Saunders Co.,
Philadelpia.
Chew D.J. e Di Bartola S.P. (1989) - In: Ettinger S.J., Textbook of Veterinary Internal Medicine, W.B. Saunders Co., Philadelphia,
1893-1961.
Clement 1992
Edwards D.J., Brown Low M.A., Hutchins D.R. (1989) - Indices of renal function: reference values in normal horses. Aus. Vet. J., 66,
60-63.
Fleming S.A., Hunt E.L., Brownie C., Rakes A., McDaniel B. (1992) - Fractional escretion of electrolytes in lactating dairy cow. Am. J.
Vet. Res., 53, 222-224.
Fleming S.A., Hunt E.L., Riviere J.E., Anderson K.L. (1991) - Renal clearances and fractional escretion of electrolytes over four 6-hour
periods in cattle. Am. J. Vet. Res., 52, 5-8.
Fowler, M.E. 1998. Medicine and Surgery of South American Camelids. 2nd ed. Iowa State Univ. Press
Fowler, M.E.; Zinkl, J.G. 1989. Reference ranges for hematologic and serum biochemical values in llamas (Lama glama). Am. J. Vet. Res.
50, 2049-2053
Garry F., Dennis J.C., Rings D.M., Tarr M.J., Hoffsis G.F. (1990a) - Renal excretion of creatinine, electrolytes, protein, and enzymes in
healthy sheep. Am. J. Vet. Res. 51 (3), 414-419.
Itoh N.(1989) - Fractional electrolyte excretion in adult cow: Establishment of reference ranges and evaluation of seasonal variations. Vet.
Clin. Path., 18 (4), 86-87.
Lackey, M.N., Belknap, E.B., Salman, Mo D., Tinguely, L., Johnson, LaRue W., (1995), Urinary indices in llamas fed different diets
- Am J Vet Res, vol. 56, n°7, 859-865.
Kaneko
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
79
Mayer 1992
Morgante M., Ranucci S., Beghelli D., Petrocchi G. (1996) - Le clearances frazionarie degli elettroliti in bovine da latte durante periodi
produttivi diversi. Atti della Società Italiana di Buiatria, Vol. XXVIII, 403-414.
Morgante M., Ranucci S., Vitellozzi G., Fruganti G., Cristofori M. (1993) - Proteinuria, enzimuria e clearances frazionarie degli
elettroliti nel bovino. Atti III Congresso Fe.Me.S.P.Rum, Teramo, 22-23 ottobre, 39-1-39-8.
Morgante 2000
Rübsamen et al., 1975
Smith B.B. (1996) -Camelid Medecine and Surgery, Oregon State University, Version 3.60.
80
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ATTI
VENERDÌ 23 MAGGIO 2003
“SORGOLINA”, “PETTIATZA”, “ISTRINGADA”, “BERTIGADA”:
UNA ANTICA E/O NUOVA RAZZA BOVINA IN SARDEGNA IN VIA DI ESTINZIONE !?
Cancedda M. , Cancedda G.
EFFETTI DEL LIVELLO DI CARBOIDRATI ALIMENTARI NON FIBROSI
SU ALCUNI PARAMETRI ENDOCRINO-METABOLICI
NELLA PECORA SARDA IN LATTAZIONE
Bomboi G. , Parmegiani A. , Cannas A. , Sechi P. , Molle G., Floris B.
GLI ADDITIVI NELL’ALIMENTAZIONE DEGLI ANIMALI
Biagi Giulia, Luchetti Elena, Nannipieri Sandra, Signorini Giancarlo
IL BOLDENONE NEI BOVINI DA CARNE
Tassinari M.
INTOXICACIÓN AGUDA POR ÁCIDO OXÁLICO: HALLAZGOS BIOQUÍMICOS
González Montaña Jr, Álvarez Nistal R, López Méndez S, Palma Barriga A, Prieto Montaña F.
IL RUOLO DELLA FORMAZIONE AI FINI DELL’APPLICAZIONE
DEL SISTEMA HACCP NELL’INDUSTRIA ALIMENTARE
Formato G., De Angelis G., Chiaro M., Bozzano A.I.
XI Congresso
Internazionale
della Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
81
82
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
“SORGOLINA”, “PETTIATZA”, “ISTRINGADA”, “BERTIGADA”: UNA ANTICA E/O NUOVA
RAZZA BOVINA IN SARDEGNA IN VIA DI ESTINZIONE !?
Cancedda M*. E Cancedda G**.
*Dipartimento di Biologia Animale
Facoltà di Medicina Veterinaria - Università Degli Studi di Sassari
**Veterinario libero professionista - SassarI
Abstract
Fossil findings document the presence of ruminants in Sardinian Island, some of these fossils dated back to Miocenic
period about 5—6 millions years ago.
The pictures, found in the cave of Cogul (Spain) dated back to paleolitic period, with surprise look like ours Sardinian
cattles, subject of our reporting.
The iconography of cattles in Sardinia is often rappresented on the burials and on famous nuragical bronze little statues,
dated back to VIII— VII century b. C..
The possessions of Sardinian breed cattles is decreasing constantly for introduction of new breeds more productive in
zootechnics and for industrial and substituction breedings. Actually these possessions is about 25.000 cattles, in this
number of Sardinian cattles it has been individuated a breed population very small with only 300 cattles (about 1,2% of
total).
These animals was diffused in all over the island, like a real breed, denominated in different ways: “Sorgolina”, “Pettiatza”,
“Istringada”, “Bertigada”, and their morphological characteristics are in particulary the vertical striped, diffused on all the
mantle.
This breed presents zebuin characteristics with a big growth of cutaneous “plica” on the umbelicus, and a wide dewlap of
the “giogaia”, like the biggest part of rustical bovine breed.
Introduzione
La presenza dei ruminanti in Sardegna risale a circa 5-6 milioni di anni, ciò è testimoniato dal ritrovamento di un fossile,
ascrivibile alla punta di un corno osseo di un bovino nel Miocene di Nureci (Or), sul versante nord dell’Altopiano della
Giara.
In Europa specificamente esiste una documentazione iconografica di raffigurazioni paleolitiche, in Spagna nella
grotta di Cogul è rappresentato un bovino che ricorda e riproduce l’aspetto dei nostri bovini sardi oggetto di questa
comunicazione.
Nella nostra isola i bovini sono effigiati nelle preistoriche sepolture delle “domus de Janas”, come protomi taurine nel
secondo millennio a.C., ma soprattutto sono efficacemente riprodotti nell’VIII°-VII° secolo a. C. in una varietà di forme
e forse di razze bovine nei bronzetti nella civiltà nuragica.
Nei secoli successivi, l’allevamento bovino ha avuto un grande sviluppo anche per l’uso polivalente come animale domestico,
nelle sue varie attitudini produttive ed in particolare come animale motore per eccellenza nei traffici commerciali e
particolarmente nei lavori agricoli.
Per un lunghissimo periodo i bovini hanno accompagnato l’attività agricola dell’uomo in Sardegna. Aggiogati per trainare
aratri, carri da trasporto e da diporto in concorrenza con gli equini ed infine soppiantati in questo agli inizi del 1950 dalla
meccanizzazione agricola.
Alle razze bovine locali, apparentemente poco produttive, si sono aggiunte, già dalla fine del 1800, numerose altre razze
introdotte in Sardegna per “migliorare” l’aspetto morfologico, produttivo e la funzione motoria con le razze Marchigiana,
Romagnola e Modicana da incrociare con la razza sarda somaticamente meno sviluppata.
Si è imposta con successo la razza Modicana, tanto che la maggior parte dei gioghi bovini da lavoro erano rappresentati da
bovini di razza pura o da incroci effettuati nella zona del massiccio del Montiferru e del Sulcis-Iglesiente.
Successivamente è stata introdotta la “bruno svizzera” per migliorare la produttività della carne e del latte ed in parte
anche l’aspetto motorio e che ha poi costituito la razza bruno-sarda a duplice attitudine (carne e latte).
Più recentemente hanno fatto la loro comparsa la “nuova” bruna alpina e la pezzata nera olandese ad elevate produzioni
lattee.
Infine l’Introduzione delle razze Chaloraise, Limousine e Chianina, le prime due utilizzate negli incroci “industriali” con
la razza sarda per la produzione della carne.
Questi incroci, talvolta veri incroci di sostituzione stanno contribuendo ad una contrazione numerica della razza sarda in
generale.
L’utilizzazione di poche razze molto produttive a scapito delle razze più rustiche sta determinando un calo di interesse e, in
vari casi, un vero e proprio abbandono.
Lo stesso fenomeno di sostituzione ed abbandono di razze ha interessato la specie equina, ovina, caprina e suina e le specie
avicole. Questo ha dato una spinta all’esodo rurale e all’abbandono delle aree più svantaggiate della collina e della montagna
ed alla scomparsa delle razze rustiche, ad un impoverimento della variabilità biologica e/o scomparsa di processi culturali
delle popolazioni ad esse legate.
Queste motivazioni ci hanno spinto ad interessarci a queste razze e qui in particolare ad una razza bovina.
Materiale e metodi
Il nostro primo obbiettivo è stato l’individuazione dei soggetti e delle aree in cui sono ancora allevati. La semplice conoscenza
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
83
di questo patrimonio autoctono è il primo passo per la sua conservazione, per la salvaguardia della razza e dell’ambiente, al
quale è quasi sempre strettamente connessa.
Nella nostra indagine ci siamo prefissi di vedere gli animali, puntigliosamente, soggetto per soggetto segnalati e/o
appartenenti e/o non alla razza in argomento e/o soggetti “migliorati” per verificare direttamente “in situ” e conoscere la
reale consistenza numerica della razza popolazione e delle difficoltà a cui sta andando incontro.
Abbiamo individuato 3 aree principali di allevamento.
1) Intorno al Monte Arci, nota sede di provenienza della ossidiana usata dalle popolazioni preistoriche. Qui sono stati
rintracciati 24 soggetti, 4 capi alle sue pendici verso il territorio di Villaurbarna (OR), 4 capi a Morgongiori (OR)
e 18 capi inselvatichiti, disconosciuti in sede giudiziaria dai proprietari originali a seguito delle multe da pagare per
danneggiamento nei cantieri forestali e lasciati liberi, costituendo attualmente un singolare patrimonio pubblico. Dei
quattro capi di Morgongiori 2 (una femmina di oltre 15 anni ed un maschio di 3 anni) sono stati acquistati e trasferiti
in una azienda agricola di Guspini (CA- futura provincia de Medio Campidano) per incrementarne il numero attraverso
prelievi e trasferimenti embrionali.
La caratteristica peculiare di questo gruppo di animali è quella di avere una mantellazione di base rossa, con striature nere
diffuse in tutto il corpo, somaticamente abbastanza sviluppati, raggiungendo un’altezza al garrese di 125 centimetri ed un
peso di 450 kg nelle femmine, con corna brachicere e macrocere di varia conformazione e 135 centimetri e 600 kg nei
maschi, con corna brachicere robuste ad andamento semicircolare.
2) Nel Gerrei, nella zona sud-orientale dell’isola, con 20 soggetti di oltre sei 6 anni di età, suddivisi in 4 allevamenti, il
mantello di base è grigio o giallastro (fromentino) con vergature nere, le dimensioni somatiche sono più ridotte rispetto
alle precedenti raggiungendo circa 115 centimetri al garrese ed un peso di 350 kg nella femmine, 120-125 centimetri e
500 kg nei maschi, le corna come nella precedente area; l’ambiente montano in cui vivono è difficile, per un mese circa
ricevono meno di 500 grammi di mangime.
3) Nella Sardegna centro - orientale con 206 capi, 156 di questi, distribuiti in 35 allevamenti, sono presenti nel territorio
di Urzulei (NU - futura provincia dell’Ogliastra) , quasi una presenza simbolica in ogni allevamento.
Le striature nere insistono generalmente su un fondo grigio. (Vedi foto) Le corna prevalentemente brachicere.
I soggetti di quest’area hanno un ridotto sviluppo somatico: l’altezza è dell’ordine di 105-110 centimetri e di kg 250 nelle
femmine, 120 centimetri e 400-450 kg nei maschi.
Nello stesso distretto sono presenti altri 60 soggetti, con le caratteristiche di cui sopra.
Inoltre una quarantina di soggetti vengono allevati nel territorio di Buddusò (SS) acquistati una quindicina di anni addietro
in questa terza area e con le stesse caratteristiche.
Infine un gruppo di 80 soggetti, tutti in provincia di Sassari, con le caratteristiche striature, ma derivanti da incroci con altre
razze (Bruno-Sarda, Limuosine e Chaloraise), morfologicamente vicine alle razze incrocianti.
Risultati e discussione
L’elemento discriminante per l’individuazione della razza è stato l’aspetto “fenotipico”, caratterizzato da striature, distribuite
su tutta la superficie corporea compresa la testa, tanto da rappresentare un carattere distintivo razziale.
Il carattere del pelame ha un valore etnico non trascurabile, alcuni studiosi hanno basato la loro classificazione delle razze
bovine sul colore e le caratteristiche del mantello (Marchi, 1925). La mantellazione nei bovini viene considerata una
caratteristica razziale.
Questo elemento distintivo è probabilmente una espressione di mimetismo e derivante da una particolarità delle antiche
razze bovine.
Di bovini con il mantello fromentino e con striature scure, in Sardegna si hanno solo cenni: un tempo erano diffusi,
considerati a”triplice attitudine”, delle razze rustiche locali erano i “più resistenti al lavoro ed alle malattie (Farina, 1999).
“Sorgolinu o sorgolina” è il mantello striato di nero e giallastro, grigio scuro di una razza rude tipica di Baunei, Talana e
Urzulei. Probabilmente variante di sorighinu, sorichinu “del colore del topo” (sorcino) (Pittau 1999).
Nella maggior parte dell’isola, questa mantellazione viene indicata con il nome di “pertiatza o pettiatza” di derivazione da
“pertia o pettia” (bastone, pertica, verga), rassomigliando dette strisce a colpi di pertica … “si narat de boi, bacca ecc chi
portat algunas ispertiadas de pilu diversu de sa manta dominanti, … bue di pelo rosso listato di strisce nere (Porru 1866).
Così la stessa tipologia nella Gallura viene denominata “Istringada” e nel Logudoro “Bertigada”.
Le “tigrature” decorrono in senso dorso – ventrale ad una distanza variabile, si infittiscono sulle spalle, sulla regione costo
-addominale, sui fianchi, sulle natiche, diventano più rade sugli arti ed in genere assenti sulle parti mediali degli arti.
Nella popolazione esaminata si riconoscono quattro tipi fondamentali di colore di fondo: grigio chiaro, bruno, rosso e
giallastro (rosso fromentino). Presentano costantemente i bordi palpebrali rosei, le mucose apparenti rosee, gli unghioni
rosati o scuri.
Hanno fronte larga, faccia breve, profilo rettilineo, collo proporzionato, garrese poco rilevato, profilo dorso lombare
rettilineo, avvallato negli animali adulti (anche vent’anni). La coda è attaccata alta, lunga, con fiocco poco voluminoso, la
giogaia ben sviluppata, con plica cutanea ombelicale zebuina nelle femmine. La mammella ben conformata con produzioni
adeguate all’allevamento della vitellanza, alcuni allevatori usano mungere 1,5 - 2 litri di latte per la trasformazione in
formaggio per uno o due mesi nel periodo dell’allattamento.
Attualmente questi bovini sono allevati allo stato brado in aree montagnose e difficili, l’integrazione alimentare in foraggi
e concentrati sono limitatissimi ed in quantità irrilevanti. Lo sviluppo morfologico, così come le produzioni, sono legate
all’area di allevamento in generale.
Per avere un’idea concreta della presenza e della distribuzione geografica e della consistenza numerica di questa razza
abbiamo redatto una cartina anche delle varianti tipologiche e dei soggetti considerati “migliorati”, mediante incroci con
altre razze. (Vedi cartina allegata della Sardegna)
Conclusioni
Nel 1771 la consistenza del patrimonio bovino di razza sarda era di 354.160, un numero rilevante, in considerazione anche
del fatto che i sardi si dimostrarono poco propensi a dichiarare il loro numero per via delle tassazioni, e che nel 1770 le
gelate distrussero un terzo del loro numero (Azuni, 1802).
La consistenza numerica oggi è stimata in circa 300.000 capi, di questi solo 25.000 circa sono ascrivibili alla razza sarda,
e soltanto 300 soggetti appartengono alla razza oggetto della nostra segnalazione, che rappresentano l’1,2%, quindi un
numero abbastanza piccolo.
In proposito è opportuno rilevare come nel 1996 la FAO suddivideva i Tipi Genetici a Rischio in 4 classi secondo il
seguente criterio:
numero di femmine
classe di rischio genetico
in età riproduttiva
< 100
critica
100 – 1000
danneggiata
1000 – 5000
vulnerabile
5000 – 10000
rara
Questo fa presagire una imminente estinzione della razza “pettiatza” se non si prenderanno adeguati provvedimenti. E’ la
stessa razza sarda, che negli ultimi anni sta subendo una forte contrazione a causa delle difficoltà venutesi a creare, sia per
le pesanti ripercussioni economiche determinate dalla presenza della “lingua blu” negli ovini, che hanno bloccato la loro
commercializzazione, sia per il mancato sostegno da parte delle istituzioni pubbliche. Quando nel 2006 la Sardegna uscirà
dall’obiettivo “uno” dell’Unione Europea, che prevede quote di sostegno per la vacca nutrice, il numero dei bovini di razza
sarda si ridurrà notevolmente con la probabile scomparsa della razza “striata”.
E’ opportuno sottolineare come tipologie fenotipiche simili sono riscontrabili nella razza spagnola bovina di Lidia,
denominata “chorreado” e protetta dal Decreto Reale 60/2001 del Ministero dell’Interno, nella razza francese normanna
“contentine” (Marchi, 1925) e nella razza “dole” norvegese (Johansson, 1982) .
Caratteristica comune a tutte le popolazioni locali è l’armonia con l’ambiente grazie ad una selezione naturale realizzatasi
nel corso del tempo. Questa armonia si traduce in rusticità, frugalità, resistenza alle malattie, capacità di sopravvivenza,
di riprodursi e produrre con risorse alimentari modeste, là dove le razze con più elevate attitudini produttive addirittura
annullano le loro potenzialità genetiche.
Per questo motivo bisogna avere maggior rispetto e dare maggior attenzione ad un patrimonio naturale, che ha anche una
implicazione sociale e culturale.
Per la loro originalità genetica possono produrre latte e carne con caratteristiche diverse e dare un prodotto anch’esso
originale.
Occorre che vengano istituiti aiuti pubblici, da calcolarsi in funzione del differente ricavo fra il vitello puro rispetto a
quello dell’incrocio, anche se, senza una adeguata presa di coscienza degli allevatori, rischierebbero di risolversi in caduta di
interesse non appena cessato il finanziamento. Perciò è necessario sviluppare una competitività sul mercato per i prodotti
derivati da queste popolazioni sfruttando la loro tipicità e qualità. Occorre una fase iniziale di studio, concertando queste
iniziative anche con enti pubblici (Regione, Province, A.R.A., A.P.A., organizzazioni di categoria, comunità locali…).
La istituzione di un Registro Anagrafico e la costituzione dell’Associazione Allevatori della razza sono una Premessa.
Ragioni di ordine pratico ci possono suggerire che in condizioni di ambiente difficile la razza locale può risultare superiore,
per fertilità e sopravvivenza.
Alla carenza di resa in quantità di latte o di carne, si può semplicemente proporre la valorizzazione come qualità.
“Le carni di questi bovini, sebbene poco infiltrate di grasso, sono di ottima qualità, di un profumo gradevole e di un sapore
molto dolce e delicato. Ciò è dovuto ai pascoli ricchi di erbe aromatiche, di mirto, mortella, lentisco, che ricoprono le
montagne del Nuorese e della Gallura” (Manetti, 1924)
Non c’è dubbio che senza un utilizzo economico, mantenere una razza bovina è molto costosa e pone problemi per la sua
conservazione, ma nonostante ciò si può e si deve mantenere la razza in purezza (materna e paterna).
Il bestiame autoctono mostra una migliore adattabilità all’ambiente povero, utilizzando pascoli poveri, riproducendosi
regolarmente e con un certo tornaconto economico in condizioni di agricoltura sfavorevole, là dove popolazioni con più
elevata produttività sono eliminate per la riduzione della fertilità e l’aumento della morbilità.
In molte aree in cui si è voluto sostituirla con una razza specializzata oggi non esiste più produzione animale.
In determinati ambienti o si allevano le popolazioni rustiche o non si alleva più nulla. E’ più conveniente allevare l’animale
adatto all’ambiente, che non modificare l’ambiente per allevare animali più “specializzati”.
Bibliografia
1)
2)
3)
4)
5)
6)
7)
Azuni D.A. (1802) – Storia geografica politica e naturale della Sardegna – Parigi
Farina L. (1999) – Bobaculariu Sardu Nugoresu Italianu –Gallizzi – Sassari
Johansson I., Rendel J., (1982) Genetica ed Animale – Edagricole – Bologna
Manetti C. (1924) – Geografia Zootecnica Italiana – Francesco Battiato – Catania
Marchi E., Mascheroni E. (1925) Zootecnia Speciale – Unione Tipografico – Editrice Torinese – Torino
Pittau M. (1999) – Dizionario della lingua Sarda – Gasperini Editore – Cagliari
Porru V. (1866) – Dizionariu Sardu Italianu – Stamperia Nazionali – Casteddu
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
85
Bovina striata dell’Ogliastra
Distribuzione dei bovini striati
86
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
EFFETTI DEL LIVELLO DI CARBOIDRATI ALIMENTARI NON FIBROSI SU ALCUNI
PARAMETRI ENDOCRINO-METABOLICI NELLA PECORA SARDA IN LATTAZIONE
Bomboi G. (1), Parmegiani A. (2), Cannas A. (3), Sechi P. (1), Molle G. (4), Floris B. (1)
Dipartimento di Biologia Animale, Sassari
Dipartimento di Morfofisiologia Veterinaria e Produzioni Animali, Bologna
(3)
Dipartimento di Scienze Zootecniche, Sassari
(3)
Istituto Zootecnico e Caseario per la Sardegna, Olmedo Sassari
(1)
(2)
Riassunto
20 pecore Sarde al 3° mese di lattazione, suddivise in 2 gruppi omogenei e tenute in gabbia metabolica, vennero alimentate
per 3 settimane con 400 g/d di fieno di medica e pellets ad libitum. I pellets differivano nella concentrazione di NFC: 36%
(dieta NFC35) e 23% (dieta NFC24). Glucosio e FT4 ematici furono più elevati in NFC35 (62.1 vs. 59.8 mg/dl, P<0.02;
1.23 vs 0.99 ng/dl, P<0.001 rispettivamente), mentre il contrario avvenne per insulina, urea e GH (14.6 vs. 22.6 µU/ml,
P<0.002; 57.5 vs. 67.9 mg/dl, P<0.001; 3.36 vs. 5.20 ng/ml, P<0.02 rispettivamente). NEFA, PRL, cortisolo e FT3 non
mostrarono differenze legate al trattamento. I dati endocrino-metabolici, comparati con quelli zootecnici, suggeriscono
che, nelle pecore a metà lattazione, l’elevata concentrazione di NFC influisce negativamente sul rilascio di GH e sulla
lattazione.
Introduzione
I carboidrati alimentari, strutturali (NDF) e non strutturali (NFC), sembrano influenzare la secrezione lattea delle pecore
diversamente a seconda dello stadio di lattazione. In principio della secrezione mammaria, quando il bilancio energetico è
presumibilmente negativo, razioni con elevata quota di NFC hanno permesso di ottenere produzioni nettamente superiori
rispetto a razioni con un minor tenore (Brown e Hogue, 1985). A fine lattazione, invece, in pecore con bilancio energetico
positivo, Bomboi et al. (2001) osservarono che alti livelli di NFC assecondavano l’asciutta e la ricostituzione delle riserve
corporee. Si ritiene che ciò sia dovuto al diverso equilibrio endocrino-metabolico dominante nei due periodi. All’inizio
della lattazione, infatti, il quadro endocrino é dominato dagli effetti lipolitici della somatotropina (GH). A fine lattazione,
invece, prendono il sopravvento gli effetti di lipodeposizione dell’insulina. Per chiarire questi aspetti può essere importante
indagare la fase intermedia di lattazione, periodo in cui il bilancio energetico da negativo tende gradualmente a riassestarsi
per diventare positivo. Durante questo periodo è stato già effettuato uno studio mettendo a confronto 3 diverse razioni,
caratterizzate da 3 diversi rapporti Foraggio:Concentrati (Bomboi et al., 2002 e 2003). I risultati hanno dimostrato che a
metà lattazione un’elevata ingestione di NDF influenza positivamente il livello plasmatico di GH e, quindi, la persistenza
della secrezione lattea, se comparata a diete con minore concentrazione di NDF (e, quindi, a più alto tenore in NFC).
Considerando l’importanza della relazione tra NFC, digeribilità, metabolismo proteico e produzione di latte, é stata
condotta una prova sperimentale che aveva come obiettivi principali lo studio, su pecore di elevato livello genetico
e produttivo in fase intermedia di lattazione, dell’effetto degli NFC e della fibra: a) sulla ingestione alimentare, sulla
produzione e sulla qualità di latte e sulle variazioni di riserve adipose; b) sulla digeribilità delle razioni e sul bilancio
energetico degli animali; c) sulla relazione tra NFC della razione e urea del latte e del sangue; d) su alcuni parametri ematici
che hanno un consolidato ruolo come indicatori metabolici. Questa nota riporta le osservazioni endocrino-metaboliche
effettuate confrontando 2 razioni caratterizzate da un diverso rapporto F:C e, quindi, da una diversa concentrazione di
NDF e NFC. Per i rilievi zootecnici di cui sopra si rimanda a Cannas et al. (2003).
Materiali e metodi
La prova prevedeva l’applicazione di uno schema monofattoriale a 2 livelli con misurazioni ripetute per 3 settimane su
20 pecore di razza Sarda al 3° mese di lattazione (89±1 giorni di lattazione all’inizio del periodo sperimentale). Prima
della prova le pecore vennero alimentate al pascolo con integrazione di concentrati in coincidenza delle due mungiture
giornaliere. Quindi, esse vennero trasferite in un paddock e gradualmente abituate all’uso di razioni asciutte, costituite da
fieno di medica e concentrati.
Vi fu una fase preliminare (FP)di 2 settimane, durante la quale le pecore vennero introdotte in gabbie metaboliche
individuali, dove disponevano di acqua a volontà ed erano alimentate con una razione di 200 g/d di fieno di medica
trinciato e una miscela (50:50) dei due alimenti sperimentali pellettati.
All’inizio della fase sperimentale (FS) le pecore vennero divise in 2 gruppi isoproduttivi e di peso corporeo simile e quindi
alimentate, sempre nelle gabbie metaboliche individuali, con le diete sperimentali:
a) ad un gruppo (NFC24) vennero somministrati 400 g/d/capo di fieno di medica trinciato e pellets a volontà con il 23%
di NFC sulla S.S. Gli NFC nella razione totale ammontavano al 24% circa;
b) all’altro gruppo (NFC35) vennero somministrati 400 g/dcapo di fieno di medica trinciato e pellets a volontà con il 36%
di NFC sulla S.S. Gli NFC nella razione totale erano pari al 35% circa.
I prelievi ematici vennero effettuati alla giugulare, al mattino, sugli animali a digiuno, utilizzando provette vacutainer
con litio eparinato come anticoagulante. Il sangue veniva immediatamente centrifugato ed il plasma congelato a – 20
°C per le successive analisi. I prelievi vennero effettuati nell’ultima settimana della FP e alla fine di ciascuna delle 3
settimane sperimentali. Sul plasma vennero determinate le concentrazioni di glucosio, NEFA e urea tramite le usuali
metodiche enzimatico-colorimetriche (Roche Diagnostics, Mannheim, Germany), nonché quelle di GH e prolattina (PRL)
tramite RIA, insulina, cortisolo, tri-iodotironina libera (FT3) e tiroxina libera (FT4) tramite ELISA (Roche Diagnostics,
Mannheim, Germany).
I dati vennero sottoposti ad ANCOVA per misure ripetute, usando uno schema bifattoriale, con i fattori dati dal
trattamento alimentare (2 livelli) e dal tempo (3 livelli) e utilizzando i dati della FP come covariate.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
87
Risultati e discussione
Nelle tabelle sono riportate le medie reali dei singoli parametri, mentre l’analisi statistica si basa sull’ANCOVA.
Tab. 1 – Concentrazione ematica di NEFA (µEq/l), glucosio (mg/dl) e urea (mg/dl).
NEFA
NFC35 NFC24
Glucosio
NFC35 NFC24
Urea
NFC35 NFC24
388.8
312.3
60.82
65.35
55.4
46.2
Fase Preliminare
Fase Sperimentale
Settimana 1
Settimana 2
Settimana 3
Media Sperimentale
81.52
60.51
51.09
64.37
94.20
67.75
55.07
72.34
64.12
61.12
61.05
62.10a
59.24
58.40
61.69
59.78b
58.6
55.7
58.2
57.5A
68.2
66.9
68.5
67.9B
A,B = P<0.001; a,b = P<0.05; basati su ANCOVA
La concentrazione in NEFA (Tab. 1), già piuttosto bassa nella FP, fu ancora minore nel corso della FS, assumendo valori
tipici di animali in bilancio energetico fortemente positivo. Non vi furono effetti significativi associati al trattamento, ma
si ebbe un effetto significativo del periodo (P<0.01). I valori furono molto più bassi di quelli trovati non solo da Bizelis
et al. (2000) in pecore nei primi 20 giorni di lattazione e da Marongiu et al. (1995) in pecore Sarde nei primi 2 mesi di
lattazione, ma anche di quelli osservati da Marongiu et al. (1994) in pecore Sarde in fase intermedia di lattazione, con livelli
produttivi piuttosto bassi. Essi, tuttavia, furono simili a quelli precedentemente osservati da Bomboi et al. (2001) in pecore
a fine lattazione con livelli produttivi molto inferiori, ma con variazioni di peso simili a quelle dei nostri animali (Cannas
et al., 2003). Si può ragionevolmente ipotizzare che questo parametro abbia subito un netto calo tra FP e FS, perché
all’inizio l’ingestione alimentare non aveva ancora raggiunto i livelli della FS (era più bassa, da cui una maggiore richiesta
e mobilitazione lipidica). Da notare, inoltre, che il gruppo NFC24 durante la FS, nonostante la maggiore ingestione di
sostanza secca e il suo maggiore livello d’ingestione (P<0.005 per entrambi i parametri; vedi Cannas et al., 2003), ha
mantenuto valori di NEFA costantemente superiori all’altro gruppo. L’osservazione va probabilmente rapportata alla sua
maggiore produzione lattea e ad una tendenziale maggiore lipodeposizione (Cannas et al., 2003).
La glicemia (Tab. 1) si collocò nei normali ranges conosciuti per la specie ovina. Nelle prime 2 settimane sperimentali
risultò più elevata in NFC35, mentre nell’ultima settimana le differenze si annullarono. Nel complesso, i valori di NFC35
furono significativamente maggiori rispetto a NFC24 (P<0.02). Per tutto l’esperimento 1e concentrazioni di glucosio
risultarono più elevate di circa 5-10 mg/dl di quelle riscontrate in pecore a fine lattazione da Bomboi et al. (2001), con bassi
livelli produttivi, ma furono simili a quelle trovate in principio di lattazione da Bizelis et al. (2000) ed a metà lattazione
da Bomboi et al. (2002). In NFC24 la minore glicemia é verosimilmente da mettere in rapporto con la sua maggiore
produzione di latte e la contemporanea minore disponibilità di carboidrati alimentari.
Nella FP le concentrazioni di urea (Tab. 1) risultarono più elevate in NFC35 rispetto a NFC24, ma durante la FS assunsero
un andamento inverso con livelli significativamente superiori in NFC24 P<0.001). I valori sono dello stesso ordine di
grandezza di quelli riportati da Bomboi et al. (2001). I più alti livelli osservati in NFC24 potrebbero essere dovuti alla
maggiore ingestione di sostanza secca, e quindi di proteine (le razioni erano isoproteiche) di questo gruppo (Cannas et al.,
2003). L’alta correlazione negativa osservata tra urea e glucosio (r = - 0.63; P<0.003) fa supporre che in questo gruppo,
più povero in NFC, una quota degli amminocidi alimentari sia stata deviata verso la gluconeogenesi, necessaria per una
maggiore sintesi del lattosio. Perciò, mentre il livello glicemico calava rapidamente per via dell’attivo prelievo mammario,
quello dell’urea tendeva a mantenersi a concentrazioni superiori.
Le concentrazioni di FT3 e FT4 (Tab. 2) diminuirono passando dalla FP alla FS in entrambi i gruppi, ma il trattamento
sperimentale indusse un effetto significativo solo a carico dell’FT4 (P<0.001). Il calo, durante la FS, della frazione libera
ed attiva degli ormoni tiroidei indica un apporto alimentare superiore alle necessità della lattazione in entrambi i gruppi.
Ciò spiega il bilancio energetico positivo e l’ingrassamento, testimoniati dal livello dei NEFA e dalle variazioni di peso
corporeo (Cannas et al., 2003). Forse per lo stesso motivo l’FT4 risulta presente in concentrazioni maggiori in NFC35.
Questo ormone presenta un grado di attività nello stimolare il metabolismo nettamente inferiore all’FT3, di cui è una
riserva circolante. Da notare, infatti, che in questo gruppo c’è stata la minore produzione lattea.
88
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Tab. 2 – Concentrazione ematica di FT3 (pg/ml) e FT4 (ng/dl)
FT3
NFC35
NFC24
FT4
NFC35
NFC24
10.81
10.44
1.44
1.29
Fase Preliminare
Fase Sperimentale
Settimana 1
10.24
9.11
1.39
Settimana 2
5.86
5.65
1.12
5.28
5.28
1.20
Settimana 3
Media Sperimentale
7.13
6.68
1.23A
A,B = P<0.001; basati su ANCOVA.
1.11
0.90
0.96
0.99B
Tab. 3 - Concentrazione ematica di insulina (µU/ml) e cortisolo (µg/dl)
Insulina
NFC35
NFC24
13.49
15.45
14.78
14.57a
18.60
27.21
22.07
22.62b
Fase Preliminare
Fase Sperimentale
Settimana 1
Settimana 2
Settimana 3
Media Sperimentale
Cortisolo
NFC35
12.39
19.31
1.13
1.63
0.83
0.56
0.24
0.54
NFC24
0.84
0.59
0.23
0.55
a,b = P<0.05; basati su ANCOVA.
L’insulina (Tab. 3) si mantenne molto bassa per tutto l’esperimento. I suoi valori crebbero leggermente passando dalla
FP alla FS, e si mantennero significativamente superiori in NFC24 (P<0.02). Essi furono più elevati di quelli trovati da
Bizelis et al. (2000) in pecore nei primi 20 giorni di lattazione. Per contro, furono abbastanza simili a quelli riportati da
Marongiu et al. (1994, 1995) in pecore Sarde rispettivamente in fase intermedia e in principio di lattazione, e inferiori a
quelli osservati a fine lattazione da Bomboi et al. (2001) su pecore Sarde con livelli produttivi molto bassi. I suoi valori
aumentarono leggermente durante la FS, probabilmente per la maggiore ingestione di energia verificatasi in questa fase
e si accordano con quelli degli ormoni tiroidei in calo. Le differenze di concentrazione tra i 2 gruppi esistevano già nella
FS, per cui dipendono probabilmente dalle diverse caratteristiche insite negli animali che hanno composto i gruppi. In
teoria si avrebbero dovuto avere i maggiori livelli in NFC35, caratterizzato da maggiore disponibilità di amido e minore
produzione lattea. Il periodo fisiologico (3°-4° mese), caratterizzato ancora da bassi livelli dell’ormone, induce a ritenere che
le variazioni siano in realtà del tutto casuali, ma non si può escludere che siano un primo segnale della modifica del quadro
endocrino verso la ricostituzione delle scorte energetiche corporee.
I livelli di cortisolo (Tab. 3) diminuirono nel passaggio dalla FP alla FS in entrambi i gruppi. I trattamenti sperimentali
non indussero effetti significativi. Si tratta di un ormone il cui effetto metabolico, iperglicemizzante in particolare (r tra
glucosio e cortisolo = + 0.48; P<0.03), si rende particolarmente evidente in stati di stress e di digiuno. Poichè gli animali
erano alimentati ad libitum, quest’ultima situazione ovviamente non è plausibile. Il livello piuttosto basso ed il significativo
calo in entrambi i gruppi, durante la FS, suggeriscono che gli animali si sono adattati gradualmente e agevolmente alla vita
in gabbia, e che il livello alimentare era più che sufficiente per mantenere stabile la glicemia.
I livelli di PRL (Tab, 4), particolarmente elevati, aumentarono nel passaggio dalla FP alla FS, risultando in linea con
il periodo della prova, caratterizzato da fotoperiodi crescenti (Curlewis, 1992). Essi, tuttavia, non mostrarono differenze
legate al diverso trattamento alimentare. L’effetto metabolico della PRL (sblocco della sintesi proteica a livello alveolare
mammario) si rende indispensabile in principio di lattazione. Nelle fasi successive, tuttavia, non esiste una chiara prova del
ruolo svolto. E’ possibile, perciò, che nel proseguo della lattazione si abbia una netta riduzione dei suoi recettori a livello
mammario, nonostante gli alti livelli riscontrabili nel plasma.
Al contrario, i livelli di GH (Tab. 4) diminuirono nel passaggio dalla FP alla FS, ma si mantennero significativamente
più elevati in NFC24 (P<0.02). Ciò potrebbe spiegare perchè questo gruppo abbia prodotto più latte, con una maggiore
ingestione di sostanza secca e di energia (Cannas et al., 2003). Le osseervazioni sono in perfetto accordo con quanto osservato
in precedenza (Bomboi et al., 2002 e 2003). E’ curioso osservare, tuttavia, che il gruppo NFC24 ebbe anche la maggiore
concentrazione di insulina ed è noto l’antagonismo tra questi due ormoni. L’unica spiegazione che al momento possiamo
ipotizzare è che la maggiore concentrazione di insulina in circolo rappresenti, oltre a quanto già detto in precedenza, la
risposta ad un intenso processo di gluconeogenesi a partire dagli amminoacidi alimentari, come detto parlando dell’urea.
D’altra parte, è noto che l’assunzione mammaria del glucosio avviene a prescindere dall’insulina.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
89
Tab. 4 - Concentrazione ematica di prolattina (ng/ml) e somatotropina (ng/ml).
PRL
GH
NFC35
NFC24
Settimana 1
406
368
3.45
7,03
Settimana 2
451
429
3.42
4.33
Settimana 3
500
515
3.22
4.25
Media Sperimentale
452
437
3.36
5.20b
Fase Preliminare
NFC35
399
379
5.01
8.07
NFC24
Fase Sperimentale
a
a,b = P<0.05; basati su ANCOVA
Conclusioni – I livelli dei parametri ematici sono risultati in perfetto accordo con i dati zootecnici, sebbene le differenze
tra i due gruppi sperimentali non siano apparse tanto marcate quanto quelle produttive. La concentrazione di cortisolo
nel sangue, inoltre, suggerisce che gli animali si sono perfettamente adattati alla permanenza prolungata nelle gabbie
metaboliche. I dati confermano nella sostanza quanto già osservato da Bomboi et al. (2002 e 2003), e suggeriscono che fra
i numerosi fattori che possono incidere sul quadro endocrino e metabolico di una pecora in lattazione, un ruolo centrale
va assegnato agli aspetti quantitativi e, soprattutto, qualitativi, della razione. Perciò, anche nelle pecore ad elevato livello
produttivo il quadro metabolico-ormonale nella fase intermedia di lattazione é tale da sconsigliare la somministrazione di
razioni con concentrazioni elevate di carboidrati non strutturali. Questi, infatti, inducendo elevate produzioni ruminali di
propionato e lattato, determinano una notevole attività gluconeogenetica a livello epatico stimolando la lipodeposizione a
svantaggio della secrezione lattea in relazione ad un aumento della secrezione di insulina (Ørskov, 1986), fatto peraltro non
verificato in questo studio. Al contrario, in questa fase di lattazione, l’uso di razioni con elevate quote di fibra, di eccellente
qualità e tali da garantire elevati livelli di ingestione alimentare, si associa positivamente al livello plasmatico di GH ed
assicura, non solo la persistenza della lattazione, ma anche elevati livelli produttivi. Gli altri ormoni presi in considerazione
dalla presente ricerca (PRL, FT3, FT4, cortisolo) rivestono probabilmente un ruolo minore nella genesi del fenomeno
osservato.
Bibliografia
1)
Bizelis J. A., Charismiadou M. A., Rogdakis E. (2000): Metabolic changes during the perinatal period in dairy sheep in relation to
level of nutrition and breed. II. Early lactation. J. Anim. Physiol. A& Anim Nutr., 84: 73-84
2) Bomboi G., Sechi P., Rubattu R., Cannas A., Annichiarico G., Floris B. (2002): Effetto del rapporto foraggi/concentrati della
razione su alcuni parametri endocrini e metabolici nel sangue di pecore da latte a fine lattazione. Atti Fe.Me.S.P.Rum. IX, CD.
3) Bomboi G., Annichiarico G., Taibi L., Floris B., Sechi P., Rubattu R., Cannas A. (2002): Effetto del rapporto foraggi:concentrati
in pecore in fase intermedia di lattazione. Atti S.I.P.A.O.C. 15, 139, (Abstract).
4) Bomboi G., Cannas A., Parmeggiani A., Floris B. (2003): Effetti endocrino-metabolici di razioni a differente rapporto F:C in
pecore da latte nella fase intermedia di lattazione. Atti So.Fi.Vet., 5, in print.
5) Brown D.L., Hogue D.E. (1985): Effects of roughage level and physical form of diet on Finnsheep lactation. SID Research Digest,
11-14.
6) Cannas A., Cabiddu A., Bomboi G., Ligios S., Molle G. (2003): Effects of dietary non-fiber carbohydrates concentration on intake,
in vivo digestibility and milk yield in Sarda ewes. Proc. Annual Meeting EAAP, 54, in press.
7) Curlewis J.D. (1992) : Seasonal prolactin secretion and its role in seasonal reproduction: a review. Reprod. Fertil. Dev. , 4: 1-23.
8) Marongiu A., Molle G., Bomboi G., Ligios S. (1994a): Livelli ematici di glucosio, NEFA e insulina in pecore sarde al pascolo con
differenti disponibilità di erba e concentrato. Atti SISVET, 48: 395-399.
9) Marongiu A., Molle G., Bomboi G. (1995): Influenza della disponibilità di erba e concentrato sui livelli plasmatici di glucosio,
NEFA e insulina in pecore di razza Sarda a inizio lattazione. Atti SISVET, 49: 307-308.
10) Ørskov E.R. (1986): Starch digestion and utilization in ruminants. J. Anim. Sci. 63: 1624-1633
Lavoro effettuato con finanziamento ex 60% (anno 2001- Titolare Prof. Antonio Marongiu)
90
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
GLI ADDITIVI NELL’ALIMENTAZIONE DEGLI ANIMALI
Biagi Giulia1, Luchetti Elena1, Nannipieri Sandra 2, Signorini Giancarlo3
Dipartimento di Clinica Veterinaria – Università di Pisa
2
Veterinario Dirigente – AzUSL Livorno
3
Scuola di Specializzazione in “Diritto e Legislazione Veterinaria” – Università di Parma
1
Riassunto
Sulla Gazzetta Ufficiale n. 291 del 15 dicembre 2001 è stato pubblicato il Decreto del Presidente della Repubblica n. 433,
“Regolamento di attuazione delle direttive 96/51/CE, 98/51/CE e 1999/20/CE in materia di additivi nell’alimentazione
degli animali”, che sostituisce ed abroga il decreto del Presidente della Repubblica n. 228/92. Gli Autori riportano gli
aspetti innovativi relativi agli additivi presenti nella nuova norma e ribadiscono che quanto disciplinato dalla vigente
normativa in materia, con particolare riguardo al Decreto Legislativo n. 123/99, “Attuazione della direttiva 95/69/CE che
fissa le condizioni e le modalità per il riconoscimento e la registrazione di taluni stabilimenti ed intermediari operanti nel
settore dell’alimentazione degli animali”, deve essere ottemperato.
Summary - ANIMAL FEEDING ADDITIVES
On number 291 of the Official Gazette December, 15, 2001, has been published the President of the Republic Decree
n. 433, “Putting into effect rule of the directives 96/51/EC, 98/51/CE and 1999/20/EC in matter of animal feeding
additives. The new rule replaces and abrogates the President of the Republic decree n. 228/92. The authors underline the
innovative aspects relative the new norms regarding the additives and the underline the necessity that these norms must be
complied as soon as possible; particularly the norms, disciplined by the current provisions in matter, in connection with
the Legislative Decree n. 123/99, “Putting into effect of the 95/69/EC directive that fixed the conditions and the modality
for the recognition and the recording of the companies and the intermediary operators of the animal feeding sector” must
be refreshed.
Introduzione
Il concetto di Dose Giornaliera Ammissibile (DGA) per l’uomo, espressa sulla base del peso corporeo (milligrammi/
chilogrammo di peso corporeo) e definita come la quantità di un additivo alimentare che può essere assunta nella dieta
quotidiana senza rischi, anche per tutto l’arco della vita, fu sviluppato dal Comitato misto FAO/OMS di esperti per
gli additivi alimentari (Joint FAO/WHO Expert Committee on Food Additives, JECFA) e fu in seguito approvato dal
Comitato scientifico per l’alimentazione umana (Scientific Committee on Food) della Commissione Europea. In genere la
DGA viene definita in base a studi a lungo termine condotti sull’alimentazione degli animali, determinando per prima cosa
il cosiddetto “Livello Effetto Zero”, cioè la quantità di additivo che può essere somministrata giornalmente agli animali senza
alcun effetto tossico, al quale viene aggiunto un largo fattore di sicurezza, di solito uguale a 100, per arrivare alla DGA per
l’uomo, fattore di sicurezza che tiene conto sia della differenza tra l’animale e l’uomo che della variabilità tra i vari individui,
incluse le differenze di stato di salute, di alimentazione, di età, ecc.: ad esempio, se il Livello Effetto Zero osservato sugli
animali è 100 mg/kg di peso corporeo, questo è poi convertito nella dose giornaliera di 1 mg/kg di peso corporeo per gli
esseri umani. Occorre inoltre sottolineare che la DGA non rappresenta un livello di tossicità ma indica invece un livello di
assunzione prudenziale tanto che gli individui possono anche eccedere occasionalmente la DGA, a condizione che la media
giornaliera sia ad essa inferiore: la DGA, sebbene sia stata chiamata dose giornaliera ammissibile, in realtà dovrebbe essere
sempre confrontata con la media su periodi prolungati, piuttosto che con la quantità assunta giorno per giorno. Prima che
un additivo possa essere usato negli alimenti, nei quali sono consentiti solo quelli che hanno dimostrato, alle dosi proposte,
di essere sicuri, deve appunto aver superato severissimi controlli. D’altra parte, la sicurezza di un additivo alimentare non è
il solo criterio adottato per consentirne l’impiego negli alimenti: deve esserne dimostrata anche la necessità e se questa non
può essere provata, la Commissione Europea non consente l’uso dell’additivo. Attualmente la DGA si è dimostrata essere
il miglior strumento per i legislatori poiché ha contribuito a portare avanti un approccio uniforme su base mondiale per
indicare la sicurezza di una sostanza in relazione alla sua assunzione da parte dell’uomo.
Negli ultimi decenni, la ricerca spasmodica del profitto ha spinto allevatori, genetisti ed alimentaristi a studiare razioni
alimentari alle quali sono stati aggiunti gli additivi più diversi al fine di ottimizzare ed incrementare il tipo di produzione
proprio degli animali allevati. Naturale conseguenza di ciò è stato che l’igiene della produzione delle derrate di origine
animale sia diventata una fase complessa ed articolata di un processo unitario che inizia in allevamento, oltre che con la lotta
alle malattie infettive trasmissibili tra animali e la lotta alle zoonosi, con il controllo degli alimenti destinati agli animali,
la vigilanza sull’inquinamento ambientale di derivazione animale e la sorveglianza sul benessere e sanità animale. D’altra
parte è ormai superfluo sottolineare la stretta relazione esistente tra sanità animale, igiene della produzione e salubrità
delle derrate di origine animale e, se certe sostanze possono essere assunte dagli animali in modo del tutto involontario o
accidentale, altre molecole vengono somministrate agli animali a scopo terapeutico o per incentivare le produzioni.
Il concetto di DGA ritenuto valido per l’uomo, a maggior ragione deve essere ritenuto valido per gli animali per tutte le
molecole che possono essere loro somministrate, additivi compresi in quanto qualsiasi sia il composto che, in vario modo e
per diverse vie, può giungere agli animali per i quali si riconoscono due possibilità di comportamento a seconda della natura
chimica dei contaminanti, filtri o concentratori, ma comunque sempre responsabili di residui in grado di contaminare gli
alimenti da essi prodotti dagli stessi animali. Gli effetti biologici dei residui sono strettamente correlati alle caratteristiche
tossicologiche delle molecole originarie, alla metabolizzazione nell’animale, ai legami che i diversi metaboliti contraggono
con le sostanze biologiche e che ne condizionano la biodisponibilità, oltre alla loro degradazione.
Una cospicua legislazione è stata emanata a partire dagli anni settanta riguardante gli additivi nell’alimentazione degli animali
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
91
in base alla quale solo le sostanze elencate negli allegati delle direttive, ed unicamente alle condizioni indicate, possono essere
contenute negli alimenti per animali e non possono essere distribuiti in altra maniera nel quadro dell’alimentazione degli
animali. In generale si può dire che una sostanza può essere impiegata come additivo soltanto se ha un effetto favorevole
sulle caratteristiche degli alimenti in cui viene incorporata o sulla produzione animale; se non ha effetti sfavorevoli sulla
salute animale e umana; se non reca pregiudizio al consumatore dei prodotti animali. Naturalmente, in caso di minaccia
per la salute animale o umana, uno Stato membro può, per un periodo massimo di quattro mesi, sospendere l’impiego di
taluni additivi o ridurne il tenore massimo fissato. Inoltre, è prevista un’etichettatura speciale per gli alimenti per animali
contenenti additivi, e particolarmente gli alimenti complementari contenenti concentrati di alcuni additivi, in modo che
l’utilizzatore sia informato sulla natura degli additivi e protetto contro le frodi.
Sulla Gazzetta Ufficiale (GURI) n. 291 del 15 dicembre 2001 è stato pubblicato il Decreto del Presidente della Repubblica
(DPR) n. 433, “Regolamento di attuazione delle direttive 96/51/CE, 98/51/CE e 1999/20/CE in materia di additivi
nell’alimentazione degli animali”, che sostituisce ed abroga il decreto del Presidente della Repubblica n. 228/92. Il DPR n.
433/2001 regolamenta la filiera degli additivi e delle premiscele di additivi (preparazione, distribuzione, commercio, anche
a titolo gratuito, impiego) utilizzate nella alimentazione degli animali; alcuni aspetti relativi ai mangimi che contengono
additivi e premiscele, fermo restando quanto disciplinato dalla vigente normativa in materia, con particolare riguardo al
Decreto Legislativo (D. L.gs) n. 123/99, intitolato “Attuazione della direttiva 95/69/CE che fissa le condizioni e le modalità
per il riconoscimento e la registrazione di taluni stabilimenti ed intermediari operanti nel settore dell’alimentazione degli
animali” e pubblicato nella GURI del 7 maggio 1999, n. 105.
Decreto del Presidente della Repubblica n. 433 del 2 novembre 2001
L’art. 1, “ambito di applicazione”, dispone che il presente regolamento disciplina la preparazione, il commercio,
la distribuzione, anche a titolo gratuito, e l’impiego degli additivi, delle premiscele e dei mangimi che li contengono,
utilizzabili nell’alimentazione degli animali e che non si applica ai coadiuvanti tecnologici utilizzati deliberatamente come
sostanze nella trasformazione di materie prime per mangimi o di mangimi ai fini di un determinato obiettivo tecnologico,
durante il trattamento o la trasformazione, e il cui impiego può risultare nella presenza non intenzionale, ma tecnicamente
inevitabile, di residui di tali sostanze o di loro derivati nel prodotto finale, purché i suddetti residui non presentino rischi
sanitari e non abbiano alcun effetto tecnologico sul prodotto finito. Non sono considerati additivi neppure le sostanze che,
pur corrispondendo ad una sostanza autorizzata, sono presenti allo stato naturale nella materia prima, che rientrano nella
composizione normale dei mangimi, purché non si tratti di prodotti specificamente arricchiti con tali sostanze.
L’art. 2 dà le definizioni a cui fare riferimento. Ricordiamo quella di “additivi” (sostanze o preparazioni utilizzate
nell’alimentazione degli animali che hanno una o più delle seguenti finalità: influenzare favorevolmente le caratteristiche
delle materie prime per mangimi o dei mangimi composti o dei prodotti di origine animale; soddisfare le esigenze nutrizionali
degli animali o migliorare la produzione animale influendo, in particolare, sulla flora gastrointestinale o sulla digeribilità
dei mangimi; introdurre elementi favorevoli per raggiungere obiettivi nutrizionali particolari o per rispondere a esigenze
nutrizionali specifiche momentanee degli animali; prevenire o ridurre gli effetti nocivi provocati dalle deiezioni animali
oppure migliorare l’ambiente in cui si trovano gli animali); “materie prime per mangimi” (i diversi prodotti di origine
vegetale o animale, allo stato naturale, freschi o conservati nonché i derivati della loro trasformazione industriale, come
pure le sostanze organiche o inorganiche, comprendenti o no additivi destinati ad essere impiegati nell’alimentazione degli
animali per via orale, direttamente come tali o previa trasformazione, per la preparazione di mangimi composti oppure ad
essere usati come supporto delle premiscele); “premiscele” (che sostituisce il termine “integratore”): le miscele di additivi o
le miscele di uno o più additivi con sostanze che costituiscono un supporto, destinate alla fabbricazione di mangimi.
Nessun additivo può essere immesso in circolazione senza un’apposita autorizzazione comunitaria (art. 3), rilasciata con
regolamento della Commissione europea a seguito della procedura prevista nell’art. 4, a condizione che l’additivo utilizzato
nei mangimi abbia uno degli effetti previsti all’art. 2; che, tenuto conto delle condizioni di impiego, non abbia influenze
sfavorevoli sulla salute umana o animale o sull’ambiente e non danneggi il consumatore alterando le caratteristiche dei
prodotti di origine animale; che sia controllabile sia in quanto additivo stesso, sia nelle premiscele, sia nei mangimi o,
sia, eventualmente, nelle materie prime per mangimi; che, tenuto conto del tenore consentito, non possa essere usato
per il trattamento o la prevenzione delle malattie degli animali ad eccezione degli additivi appartenenti al gruppo dei
coccidiostatici e altre sostanze medicamentose; che per seri motivi attinenti alla salute umana o degli animali, non sia
esclusivamente riservato all’uso medico o veterinario. Gli additivi autorizzati possono essere immessi in circolazione e
possono essere utilizzati alle condizioni previste nel relativo regolamento di autorizzazione solo se incorporati nei mangimi
anche se in deroga gli additivi appartenenti a gruppi diversi da “antibiotici, “coccidiostatici e altre sostanze medicamentose”,
nonché “fattori di crescita”, possono essere utilizzati secondo modi di somministrazione diversi dall’incorporazione nei
mangimi, purché questi siano previsti dal regolamento di autorizzazione. Inoltre non devono essere aggiunti alle materie
prime per mangimi e ai mangimi semplici a meno che la loro utilizzazione non sia espressamente prevista nel regolamento
di autorizzazione.
La procedura per ottenere l’autorizzazione comunitaria (art. 4) prevede la scelta di uno Stato membro, per l’Italia l’autorità
competente è il Ministero della salute, quale relatore, in occasione della procedura d’esame, presentando un fascicolo
costituito conformemente alle disposizioni dell’allegato D al presente DPR.
Nel caso in cui un additivo sia costituito da o contenga organismi geneticamente modificati (art. 5) deve essere effettuata
una valutazione specifica dei rischi per l’ambiente in base al Decreto Legislativo (D. L.gs) n. 92/93, “Attuazione della
direttiva 90/220/CEE concernente l’emissione deliberata nell’ambiente di organismi geneticamente modificati” per
proteggere appunto sia la salute umana che l’ambiente.
L’art. 6 riguarda l’autorizzazione comunitaria associata al responsabile, l’art. 7 la protezione dei dati scientifici e le informazioni
contenuti nel fascicolo presentato ai fini del rilascio della prima autorizzazione, l’art 8 l’autorizzazione comunitaria non
associata al responsabile e l’art. 9, “Additivi già autorizzati”, consente l’immissione provvisoria in circolazione in attesa che
92
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
la Commissione europea riesamini le autorizzazioni, su istanza del richiedente, secondo le procedure previste dal presente
regolamento
I tenori massimi e minimi stabiliti (art. 10) per taluni additivi si riferiscono ai mangimi completi con tasso di umidità del
12%, quando i regolamenti comunitari di autorizzazione non prevedono disposizioni particolari e se la sostanza utilizzabile
come additivo esiste anche allo stato naturale in talune materie prime del mangime, la parte di additivo da incorporare
deve essere calcolata in modo che la somma degli elementi aggiunti e degli elementi presenti naturalmente non superi il
tenore massimo previsto nei regolamenti comunitari di autorizzazione. Inoltre, nelle premiscele e nei mangimi è ammessa
la miscelazione degli additivi unicamente se viene rispettata la compatibilità fisico-chimica e biologica tra i componenti
della miscela, in funzione degli effetti ricercati e se non si tratta di una miscela oggetto di autorizzazione specifica in
quanto additivo, non possono essere mescolati tra loro: gli antibiotici e i fattori di crescita, sia che appartengano ad uno
stesso gruppo, sia che appartengano ai due gruppi; i coccidiostatici e le altre sostanze medicamentose, con gli antibiotici
ed i fattori di crescita, quando gli stessi coccidiostatici esercitano, per una stessa categoria di animali, una funzione di
antibiotico o di fattore di crescita; i coccidiostatici e le altre sostanze medicamentose, se i loro effetti sono analoghi. Infine
la miscela di antibiotici, fattori di crescita, coccidiostatici e altre sostanze medicamentose con microrganismi e’ vietata a
meno che nel regolamento comunitario di autorizzazione del microrganismo non sia ammessa tale miscela.
In base all’art 11, il Ministero della salute può autorizzare, esclusivamente per esperimenti ai fini scientifici ed a fini non
commerciali, l’utilizzazione come additivi di prodotti non autorizzati a livello comunitario o l’utilizzazione di additivi a
condizioni diverse da quelle previste nel regolamento comunitario purché gli esperimenti siano effettuati secondo i principi
e le condizioni fissati in sede comunitaria e sotto il controllo delle AzUSL competenti per territorio, secondo le modalità
previste dal D. L.gs n. 116/92 e purché la sperimentazione di tali prodotti non comporti un rischio per la salute dell’uomo,
dell’animale o dell’ambiente.
L’art. 12 prescrive che gli additivi e le premiscele devono essere adeguatamente custoditi e contenuti in recipienti
particolarmente idonei alla loro conservazione che possono essere facilmente identificati e naturalmente devono essere
commercializzati in imballaggi o recipienti sigillati il cui dispositivo di chiusura sia tale da non poter essere riutilizzato
dopo l’apertura.
L’impiego di uno degli additivi autorizzati o la sua utilizzazione alle condizioni eventualmente fissate possono essere sospesi
provvisoriamente o limitati nel territorio quando si constati che essi comportano un pericolo per la salute dell’uomo o
degli animali o per l’ambiente (art. 13). L’adozione del provvedimento e i motivi che lo giustificano sono comunicati alla
Commissione europea e agli altri Stati membri a cura del Ministero competente (della salute e/o dell’ambiente e della tutela
del territorio).
I mangimi complementari, tenuto conto della diluizione prevista per il loro impiego, non possono contenere tenori di
additivi superiori a quelle fissati per i mangimi completi (art. 14). In particolare nei mangimi complementari i tenori di
antibiotici, di coccidiostatici ed altre sostanze medicamentose, di fattori di crescita, di vitamina D e di antiossidanti possono
superare i tenori massimi fissati per i mangimi completi solo se si tratta di mangimi complementari a disposizione di tutti
gli utilizzatori, a condizione che il loro tenore di antibiotico o di vitamina D o di fattore di crescita non superi il quintuplo
del tenore massimo fissato o se si tratta di mangimi complementari destinati a talune specie animali a disposizione di
tutti gli utilizzatori in considerazione del sistema particolare di nutrizione, presentando però nella composizione una o
più caratteristiche, quali proteine o minerali, che escludano il superamento dei tenori di additivi fissati per i mangimi
completi o la destinazione del mangime ad altre specie animali. Ad ogni modo, la percentuale non deve superare per gli
antibiotici ed i fattori di crescita 1000 mg/kg e per i bovini destinati all’ingrasso, 2000 mg/kg; per gli antiossidanti, nonché
per i coccidiostatici ed altre sostanze medicamentose, il quintuplo del tenore massimo fissato; per le vitamine D, 200.000
Ul/kg.
L’immissione in commercio è regolamentata dall’art. 15 che prevede che possano essere immessi in circolazione o utilizzati i
relativi additivi contemplati dal presente regolamento, le premiscele preparate con questi additivi per essere incorporate nei
mangimi composti, nonché i mangimi composti contenenti queste premiscele, soltanto dalle imprese o dagli intermediari
che soddisfano le condizioni previste dal D. L.gs n. 123/99. Tutti gli additivi del gruppo antibiotici, coccidiostatici e altre
sostanze medicamentose, fattori di crescita possono essere forniti soltanto da imprese riconosciute ai sensi del D. L.gs n.
123/99 ad intermediari o ad imprese di fabbricazione di premiscele che sono stati riconosciuti ai sensi del D. L.gs n. 123/99
e sotto forma di premiscele, soltanto ad intermediari o ad imprese che procedono alla fabbricazione di mangimi composti,
al fine della loro immissione in circolazione o esclusivamente per le necessità del bestiame allevato, riconosciuti sempre in
base alle disposizioni del citato D. L.gs n. 123/99. Gli oligoelementi (rame e selenio), le vitamine, provitamine e sostanze
con effetto analogo chimicamente ben definite (vitamine A e D) possono essere forniti soltanto da imprese riconosciute
ad intermediari o ad imprese di fabbricazione di premiscele che sono stati riconosciuti in base alle disposizioni del D. L.gs
n. 123/99 e sotto forma di premiscele, soltanto ad intermediari riconosciuti a norma del D. L.gs n. 123/99 o ad imprese
che procedono alla fabbricazione di mangimi composti al fine della loro immissione in circolazione o esclusivamente per le
necessità del bestiame allevato, registrate o riconosciute ai sensi del D. L.gs n. 123/99. Tutti questi additivi possono essere
incorporati nei mangimi composti soltanto se sono stati preventivamente preparati sotto forma di premiscele, che possono
essere incorporate nei mangimi composti soltanto in proporzione minima dello 0,2 per cento in peso, in stabilimenti
che soddisfano le condizioni previste dal D. L.gs n. 123/99. In deroga il Ministero della salute può consentire che siano
incorporate alcune premiscele nei mangimi composti in proporzione minore allo 0,2 per cento in peso, ma non al di sotto
dello 0,05 per cento in peso, a condizione che la composizione quantitativa e qualitativa delle premiscele lo consenta e
qualora sia stato preventivamente accertato dalla regione o dalla provincia autonoma, ai sensi del D. L.gs n. 123/99, che gli
stabilimenti soddisfano le condizioni definite nell’allegato I per ripartire in maniera omogenea le premiscele e per rispettare
i tenori in additivi prescritti per il mangime completo.
Per quanto riguarda l’etichettatura, ferme restando le vigenti disposizioni in materia, deve essere effettuata ai sensi dell’art. 16
per gli additivi, dell’art. 17 per le premiscele e dell’art. 18 per i mangimi. In particolare l’art. 16 in merito alla etichettatura
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
93
degli additivi prevede per tutti (ad eccezione degli enzimi e dei microrganismi) l’indicazione del nome attribuito all’additivo
all’atto della sua autorizzazione e del numero di registrazione CE dell’additivo. Inoltre, sulla etichetta degli additivi, la cui
autorizzazione è associata al responsabile dell’immissione in circolazione, devono essere indicate anche la denominazione
ed il numero di immatricolazione della ragione sociale del responsabile della immissione in circolazione. Al riguardo,
nelle more della pubblicazione dei previsti elenchi degli additivi autorizzati, ed anche per gli enzimi ed i microrganismi,
al fine di consentire una piena identificazione degli additivi in circolazione e la loro assoluta tracciabilità, si ritiene, per
quanto possibile, che occorra fare ancora riferimento agli elenchi di cui al DPR n. 228/92, alle successive modificazioni
ed integrazioni, nonché ai successivi regolamenti comunitari relativi all’autorizzazione di additivi, così come evidenziato
nella sezione relativa alle “condizioni per l’autorizzazione degli additivi e relative procedure”. Relativamente all’art. 18, il
numero di riconoscimento attribuito all’impresa, deve intendersi riferito al produttore del mangime e non al fabbricante
degli additivi. In via transitoria entro sei mesi a far data dalla pubblicazione dei summenzionati elenchi, e’ consentito lo
smaltimento delle giacenze di tutti i prodotti etichettati come indicato ai punti precedenti.
Per quanto riguarda i mangimi complementari (art. 20), fatte salve le disposizioni di cui alla L. n. 281/63, e successive
modificazioni, se contengono un tasso di additivo superiore ai tenori massimi fissati per i mangimi completi, possono essere
commercializzati solo se è dichiarata, secondo la specie animale e l’età, la quantità massima in grammi o in chilogrammi
di alimento complementare da somministrare per animale e al giorno, conformemente alle disposizioni di utilizzazione
previste dall’autorizzazione comunitaria dell’additivo.
Le autorità competenti, effettuano in base all’art. 20, nel corso della commercializzazione, almeno a campione, ai sensi del
D. L.gs n. 460/98, e successive norme di attuazione, il controllo ufficiale degli additivi, delle premiscele e degli alimenti per
animali relativo all’identità degli additivi utilizzati ed al rispetto delle altre disposizioni previste nel presente regolamento.
In mancanza di disposizioni comunitarie che fissano le tolleranze in caso di divergenza tra il risultato del controllo ufficiale
ed il tenore dichiarato dell’additivo nel mangime composto, le tolleranze stesse sono stabilite secondo quanto previsto dalla
L. n. 281/63, e successive modificazioni.
L’art 23 infine abroga il DPR n. 228/92.
Infine, il 4 luglio 2002 il Ministro della Salute ha emanato la Circolare n. 2, esplicativa del DPR 2 novembre 2001, n.
433, concernente “Regolamento di attuazione delle direttive 96/51/CE, 98/51/CE e 1999/20/CE in materia di additivi
nella alimentazione degli animali, che sostituisce ed abroga il decreto del Presidente della Repubblica n. 228/1992. La
Circolare è stata emanata per favorire una corretta applicazione delle nuove disposizioni e nell’intento di chiarire ogni
eventuale perplessità in merito, fornendo indicazioni sugli articoli per i quali potrebbero eventualmente sussistere dubbi
interpretativi.
Valutazioni conclusive
L’accresciuta attenzione in merito all’alimentazione degli animali, determinata anche dagli ultimi eventi epidemiologici, in
particolare BSE, afta epizootica e blue tongue, hanno ulteriormente evidenziato l’opportunità di intensificare i controlli,
ed eventualmente di attivarne ulteriori mirati sull’intera filiera degli alimenti per gli animali dato che la prevenzione e ed
il controllo delle patologie di allevamento passa anche attraverso la somministrazione agli animali di mangimi contenenti
sostanze farmacologicamente attive. D’altra parte è ormai dimostrata l’influenza dell’alimentazione degli animali sulle
qualità organolettiche e sulla salubrità delle derrate alimentari di origine animale per cui è l’evoluzione della normativa
comunitaria e nazionale non può essere altro che tendente ad una maggiore tutela della sanità pubblica ed a garantire
sempre più i consumatori in merito ai prodotti alimentari di origine animale.
Finalità anche del DPR n. 433/2001 è la tutela della sanità pubblica attraverso la vigilanza sull’alimentazione degli animali
produttori di alimenti destinati al consumo umano per contribuire ad assicurare la salubrità dei prodotti di origine
animale. Le linee direttrici per la valutazione degli additivi impiegabili nell’alimentazione degli animali prevedono infatti
che siano forniti i risultati degli studi intesi a stabilire l’identità, le condizioni di impiego, le proprietà fisico-chimiche, i
metodi di controllo e l’efficacia dell’additivo nonché il suo metabolismo e i suoi effetti biologici e tossicologici sulle specie
bersaglio e se l’additivo è destinato a una particolare categoria di animali appartenenti ad una data specie, gli studi devono
essere effettuati su questa categoria bersaglio. Dovranno poi essere effettuati studi necessari alla valutazione dei rischi
per la salute umana e per l’ambiente e questi dipenderanno essenzialmente dalla natura dell’additivo e dalle circostanze
del suo impiego. Per gli additivi destinati all’alimentazione degli animali da reddito, da cui vengono ottenuti prodotti
destinati al consumo umano, è sempre necessario prevedere un complesso di prove complete sulla tossicità cronica, sulle
proprietà mutagene e cancerogene specialmente se vi sono indicazione di mutazioni, in base alla composizione chimica,
alle esperienze nell’utilizzazione o altro. Inoltre, è di fondamentale importanza conoscere il metabolismo dell’additivo
nell’organismo degli animali da reddito nonché i residui e la relativa biodisponibilità per poter stabilire la portata degli
studi tossicologici da effettuare su animali da laboratorio al fine di valutare gli eventuali rischi per il consumatore; questa
valutazione non potrà in alcun caso basarsi su dati limitati all’azione diretta dell’additivo sull’animale da laboratorio perché
non permetterebbero di ottenere alcuna informazione specifica sugli effetti reali dei residui del metabolismo nelle specie
alle quali è destinato l’additivo. Particolare importanza rivestono gli studi concernenti la sicurezza dell’impiego dell’additivo
per le specie bersaglio; i rischi di inalazione o da altro contatto con mucose, occhi o pelle per le persone che dovranno
manipolare l’additivo tal quale o incorporato nelle premiscele o negli alimenti; i rischi per il consumatore che possono
derivare dal consumo di prodotti alimentari contenenti residui dell’additivo o suoi metaboliti; i rischi di inquinamento
dell’ambiente o di persistenza in esso dovuti all’additivo stesso o ai prodotti da esso derivati ed escreti dagli animali; gli
eventuali rischi per le specie non bersaglio.
A conclusione di questa breve disamina sulla nuova normativa in materia di additivi nell’alimentazione degli animali, poiché
l’alimentazione animale riveste un ruolo di estrema importanza soprattutto dal punto di vista sanitario e rappresenta sia una
componente fondamentale per garantire la sicurezza delle derrate alimentari che una base importante per valorizzare una
politica di qualità dei prodotti di origine animale, riteniamo indispensabile che sia sottoposta ad un particolare controllo e
94
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
che quindi sia necessario che per la preparazione e la somministrazione di additivi si ricorra alle buone pratiche di produzione,
al corretto uso degli ingredienti, oltre che all’applicazione delle buone norme di distribuzione e di somministrazione.
Soltanto da animali in perfette condizioni di salute, alimentati razionalmente e mantenuti in strutture idonee e tali
da rispondere ai requisiti previsti per garantire condizioni di benessere, si possono ottenere derrate sane ed accettabili.
Pertanto, data la stretta correlazione esistente tra alimentazione e salute animale, riteniamo opportuno sottolineare come il
DPR n. 433/2001 faccia nei suoi disposti riferimento al D. L.gs n. 123/99 (GURI n. 105, 07 maggio 1999) riguardante
l’«Attuazione della direttiva 95/69/CE che fissa le condizioni e le modalità per il riconoscimento e la registrazione di taluni
stabilimenti ed intermediari operanti nel settore dell’alimentazione degli animali» il cui fine è stato quello di realizzare un
metodico e sistematico controllo dell’alimentazione animale con l’intento di tutelare lo stato di salute degli animali, la
sicurezza dei prodotti di origine animale ed escludendo nel contempo qualsiasi impatto negativo con l’ambiente.
Concludiamo ricordando che la Commissione europea ha intenzione di proporre nuove regole di sicurezza alimentare
mettendo al bando dai mangimi per animali da carne entro il 1° gennaio 2006 anche altri antibiotici, quali flavofosfolipidi,
monensin sodio, salinomycina sodio e avilamycina, sostanze proibite per l’uomo ma ancora autorizzati negli allevamenti
europei, utilizzati allo scopo di stimolare la crescita e nella cura delle patologie, con l’intento di evitare il rischio di un aumento
dei batteri resistenti agli antibiotici nell’uomo e negli animali, preservando l’efficacia dei farmaci in caso di necessità. Non
dimentichiamo che l’Unione europea è impegnata sul fronte “carne pulita” da diversi anni ed ha già cancellato ben venti
antibiotici utilizzati per “gonfiare” gli animali. Fino a qualche anno fa, gli antibiotici che venivano usati per la salute degli
uomini e degli animali ammontavano a 10.000 tonnellate e che di questi il 15% finiva nei mangimi specialmente negli
allevamenti intensivi per limitare le malattie e per favorire una crescita veloce.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
95
IL BOLDENONE NEI BOVINI DA CARNE
Tassinari M.
Dimorfipa, Facoltà Di Medicina Veterinaria – Università Di Bologna, Italia
Via Tolara Di Sopra, 50 – 40064 Ozzano Emilia (Bo)
Tel: 051792865 Fax: 051792869 E-mail: [email protected]
Abstract
The androgenic steroid Boldenone is an anabolic compound wich affects the growth and food conversion of cattle for
meat production. During 2001-2002 years many Boldenone’s urine positiveness were discovered in beef cattle. Some
authors attribute to boldenone an alimentary source from phytosterols by Mycobacterium sp. activities in the gut. More
than 5,000 urine samples of veal calves were collected during officials controls by Public Veterinary in some farms. The
samples were collected in different ways: with plastic zootechnical bag, with or without preliminary cleaning before
taking off the urine in a saucepan, or directly from bladder at slaughter house. The samples that were collected in
saucepan without cleaning or with plastic zootechnical bag showed a Boldenone’s positiveness from 1.5% to 20%. All
samples collected at slaughter house from bladder or in the farm with preliminary cleaning were negative. We suppose
that faecal contamination of urine samples may be the origin of positiveness to Boldenone.
Introduzione
Il boldenone (1,4-androstadien-17β-ol-3-one) è un ormone steroideo ad attività androgenica e rientra, secondo la
Direttiva 96/23/CE, nella categoria A3 (sostanze ad effetto anabolizzante e sostanze non autorizzate). Il suo impiego
quale anabolizzante è stato rilevato nel cavallo sportivo (O’Connor e coll., 1993), nel cane (Williams e coll., 2000) e
persino nel piccione (Hagedorn e coll., 1996).
A partire dalle fine del 2000, e soprattutto negli anni 2001 e 2002, nel corso di controlli effettuati nell’ambito del Piano
Nazionale Residui (PNR) nel nord Italia centinaia di campioni di urine provenienti da vitelli a carne bianca e vitelloni
sono risultati positivi all’α-boldenone e, in misura molto ridotta, anche al β-boldenone (le due forme isomeriche del
boldenone delle quali l’α costituisce il prodotto metabolico di inattivazione della forma β).
Le prime ricerche sulla presenza del boldenone nelle urine di vitello sono state eseguite da Arts e coll. (1996). I risultati
ottenuti hanno indotto gli Autori ad ipotizzare che il 17 α-boldenone poteva essere presente nelle urine di vitelli
sicuramente non trattati e con valori fino a 3 ng/ml; di conseguenza, il ritrovamento del 17 α-boldenone nelle urine non
poteva essere considerato prova di un trattamento illecito. Per quanto riguarda il β-boldenone, invece, ritrovato a livelli
che non superavano mai 0,1 ng/ml, gli Autori non escludevano la possibilità di una sua presenza in vitelli non trattati.
Van Puymbropeck e coll. (1998) analizzando le feci di 50 vitelli nell’ambito di uno screening routinario in sede di
macellazione hanno riscontrato la presenza di α e β boldenone e, inoltre, anche di 1-4 androstadiene 3-17 dione (ADD o
boldione, precursore del boldenone) e di 4 androstene 3-17 dione (AED, metabolita del boldenone).
Nei vitelli non è stata dimostrata la presenza endogena di boldenone a livello di ghiandole sessuali primarie; nei testicoli
del suino si è ritrovato sia il β-boldenone che l’ADD, mentre il 17 α-boldenone non è stato evidenziato (Schilt, 2002). Una
recente ricerca di Ho e coll., del Racing Laboratory – the Hong Kong Jockey Club di Hong Kong in Cina, ha dimostrato
la natura endogena di questa molecola anche nel cavallo intero.
In Italia fino alla fine del 2002 il ritrovamento del boldenone nelle urine dei bovini da carne, sia nella forma α e/o β, era
considerato sempre indice di trattamento illecito, indipendentemente dai valori ritrovati.
Il Consiglio Superiore di Sanità (Sezione IV) nelle sedute del 24/10 e 18/11/2002, alla luce delle conoscenze scientifiche
alla fine del 2002, ha raccomandato un livello analitico di riferimento di 2 ng/ml solamente per l’α-boldenone, senza però
esprimersi nel merito dell’origine dell’α-boldenone e, pertanto, questo si presta di fatto ad una soglia di tolleranza.
L’origine naturale dell’α-boldenone è accreditata come scientificamente plausibile, dal Laboratorio Europeo di Riferimento
di Bilthoven, a partire da steroli presenti nella dieta dei vitelli (fitosteroli) ed in base ad alcune segnalazioni che riguardano
la presenza di boldenone in feci provenienti da animali sotto stretto controllo sperimentale. Il lavoro più specifico in
materia alla fine del 2002 risultava quello di Song e coll. (2000) in cui è dimostrata la presenza nelle feci di precursori
del testosterone e del boldenone (ADD o boldione) in ratti alimentati con una miscela di fitosteroli (β-sitosterolo,
campesterolo e stigmasterolo).
Alla luce di quanto ritrovato in Bibliografia e sulla base delle ipotesi formulate da alcuni Autori relativamente alla
possibile origine “naturale” del boldenone, si è pensato che le positività al boldenone delle urine dei vitelli a carne bianca
potessero derivare da una contaminazione fecale. Certi della buona fede di parecchi allevatori, si è sposata l’ipotesi di
alcuni Autori i quali sostengono che determinati ceppi di Micobatteri presenti nel pabulum microbico intestinale sono in
grado di trasformare i fitosteroli, normalmente presenti nelle diete dei vitelli (e che possono arrivare fino a 300 mg/kg di
latte ricostituito), in ADD, il precursore del boldenone (Schilt, 2002).
Materiale e metodi
A partire da Agosto 2001 e fino ad Agosto 2002 sono stati effettuati, da parte dei Servizi Veterinari del Piemonte e della
Lombardia, 5275 campionamenti di urine di vitelli a carne bianca nel corso di controlli ufficiali “su sospetto”, come
previsto dal PNR in caso di positività ad una sostanza di tipo anabolizzante, in allevamenti di alcuni soci del Consorzio
Italiano del Vitello di Qualità. Nell’ambito di questi controlli si sono prelevate le urine da vitelli di età compresa fra 30 e
260 giorni. Le urine sono state raccolte con 4 diverse modalità:
- tramite il sistema normalmente utilizzato dal Servizio Veterinario, ovvero con l’apposizione all’animale del cosiddetto
“grembiule zootecnico” (3821 campioni);
96
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
- mediante contenitore (“pentolino”) mantenuto al di sotto del prepuzio senza toelettatura prima del prelievo (388
campioni);
- con pentolino previa pulizia accurata (e in molti casi anche rasatura del pelo) della zona prepuziale (978 campioni) ;
- direttamente dalla vescica in sede di macellazione (88 campioni totali in 2 diversi macelli).
In parecchi allevamenti, in giorni diversi, si sono effettuati i prelievi tramite le diverse modalità descritte. Si sono quindi
considerati i dati analitici di tutti i campioni, analizzati dagli Istituti Zooprofilattici di pertinenza.
Risultati
Nella tabella 1 vengono riportati i risultati delle analisi delle urine prelevate con le diverse modalità. Appare subito
evidente che la modalità di prelievo ha comportato significative differenze nelle positività riscontrate.
Il 17 α-boldenone è stato ritrovato in 714 campioni prelevati tramite grembiule zootecnico (positività pari al 18,7%),
mentre nei campioni di urine raccolte mediante il pentolino senza preventiva toelettatura della zona prepuziale la positività
è nettamente inferiore e pari a 1,6% (6 campioni positivi su 388 prelievi). Il β-boldenone è risultato presente in 70
campioni (su 3821 prelievi) ottenuti con grembiule zootecnico (positività pari a 1,8%) mentre non è mai stato riscontrato
nei campioni raccolti mediante il pentolino senza toelettatura prima del prelievo. In tutti i campioni di urine raccolti
con pentolino ma con accurata pulizia e toelettaura della zona prepuziale prima del prelievo (978 in totale) ed in tutti
quelli effettuati in sede di macellazione direttamente dalla vescica (88 campioni, dei quali la maggior parte erano risultati
positivi al prelievo in allevamento) non è mai stato ritrovato il 17 α-boldenone e neppure il β-boldenone.
Tabella n.1: Positività al boldenone delle urine prelevate con metodiche diverse
Modalità di prelievo
Campioni (n°)
Positività α-boldenone
Positività β-boldenone
Grembiule zootecnico
3821
714 (18,7%)
70 (1,8%)
Pentolino senza toelettatura
388
6 (1,6%)
--
Pentolino con toelettatura
978
--
--
Vescica (al macello)
88
--
--
I prelievi di urine effettuati mediante grembiule zootecnico indicano chiaramente, accettando per valida l’ipotesi della
presenza “naturale” del boldenone nelle feci dei vitelli, che la presenza di materiale fecale e/o peli imbrattati può essere
determinante per la presenza dell’α-boldenone e del β-boldenone. Non è possibile, infatti, ottenere urine “pulite” con questo
metodo di campionamento. A conferma di questo è ben evidente la bassissima positività ottenuta con il campionamento
tramite pentolino ma, soprattutto, la negatività delle urine raccolte con accurata pulizia e toelettatura della zona prepuziale
prima del prelievo oppure direttamente dalla vescica.
Discussione
E’ noto da tempo che i fitosteroli vengono utilizzati, dalle industrie farmaceutiche, quale substrato di fermentazione
microbica per la formazione di ADD (boldione), con efficienza di formazione di ADD fino al 40%. L’ADD viene impiegato
per la successiva sintesi di ormoni steroidei. Nei lavori di fermentazione in vitro risulta che la selezione dei ceppi batterici
più attivi nel fermentare i fitosteroli dipende dal tempo di contatto dei germi con il substrato e dalle concentrazioni del
substrato stesso. Concentrazioni troppo alte o troppo basse inibiscono o non inducono, rispettivamente, tale selezione
microbica.
Nella flora microbica intestinale del colon e del cieco dei vitelli possono essere presenti Micobatteri a rapida crescita (M.
fortuitum, M. vaccae) ed è noto che vitelli, nati da bovine da latte con andamento subclinico di paratubercolosi, alla nascita
possono venire in contatto con alte concentrazioni di M. paratuberculosis.
I batteri dell’intestino risultano dotati, tra l’altro, di attività beta idrossilasica per cui è possibile la formazione sia di αboldenone che di β-boldenone a partire dal diretto precursore ADD o boldione.
Con una nota datata 18 marzo 2003 la Commissione Europea (Health & Consumer protection, Directorate D–Food
Safety, D3-Chemical and physical risk; surveillance) dirama il report del gruppo esperti (riuniti il 25/02/2003) della
Commissione dove si afferma che l’α-boldenone è stato trovato in campioni di urina bovina di animali che non sono mai
stati trattati con Boldenone, mentre il β-boldenone non è stato ritrovato, ma che le forme α e β del boldenone sono state
entrambe ritrovate nei campioni di feci di bovini che non sono mai stati trattati con boldenone.
Ancor più recentemente Sgoifo Rossi e coll. (2003) riportano che le urine campionate mediante il grembiule zootecnico
sono di norma contaminate a seguito di dilavamento del materiale fecale presente sui peli del prepuzio durante la minzione,
per caduta accidentale nel grembiule zootecnico di materiale fecale presente sul prepuzio, sulla zona adiacente allo stesso
e sul ventre dell’animale e, inoltre, per contatto prolungato delle urine raccolte con il materiale fecale presente sulle zone
citate. Nelle ricerche effettuate gli Autori riportano che le urine raccolte dagli stessi animali nell’arco di poco tempo con
grembiule zootecnico o con metodologia che eviti la contaminazione fecale (tramite pentolino previa accurata toelettatura
della zona prepuziale) risultano, rispettivamente, positive e negative alla presenza di boldenone.
Pompa e coll. (2003) riportano che nell’ambito delle loro ricerche sulle feci fresche di vitelli a carne bianca e vitelloni
(animali non trattati con nessun tipo di anabolizzante) è stato ritrovato soprattutto il β-boldenone ma anche l’α-boldenone.
Inoltre, aspetto ancor più interessante, gli Autori hanno evidenziato che rilevanti quote di α-boldenone e ADD si formano
durante il processo di naturale disidratazione anche in feci in cui, in origine, non era rilevabile né boldenone (α e β) né
ADD e depongono per un’origine “naturale” del boldenone nelle feci bovine.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
97
Conclusioni
Alla luce delle recentissime ricerche effettuate sulle feci dei vitelli e dei vitelloni da carne e considerando le diverse modalità di
prelievo delle urine si può ragionevolmente concludere che non è corretto eseguire un prelievo di urine bovine contaminate
da feci poiché questo potrebbe interferire con la positività dei campioni all’analisi del boldenone.
E’ stata dimostrata scientificamente la presenza “naturale” del boldenone (α e β) e dell’ADD (boldione, diretto precursore
del boldenone) nelle feci di animali sicuramente non trattati.
Le recenti positività al boldenone delle urine di bovini fanno quindi deporre a favore di una presenza della molecola
per contaminazione da materiale fecale e non certamente a trattamenti illeciti. E’ ovvio, a questo punto, che appare di
fondamentale importanza eseguire prelievi di urine non contaminate da materiale fecale (urine assolutamente pulite) al fine
di poter stabilire se la presenza di boldenone sia imputabile o meno ad un trattamento illecito.
Bibliografia
Arts C.J.M., Schilt R., Schreurs M., Van Ginkel L.A. (1996) Boldenone is a naturally occuring (anabolic) steroid in cattle. In Proceedings
of the Euroresidue III Conference, Veldhoven, 6-8 May 1996, Ed. N. Haagama and A. Ruiter, University of Utrecht, The Netherlands,
212-217
European Commission, Health & consumer Protection Directorate General. Directorate D - Food safety: production and distribution
chain: Unit D3 - Chemical and physical risks; surveillance (2003) Ad hoc meeting of experts – 25/02/2003 – Report. Brussels, 18 March
2003
Hagedorn H.W., Zankl H., Grund C., Schulz R. (1996) Nachweis von Dopingsubstanzen in der Brieftaube. Berliner und Munchener
Tierarztliche Wochenschrift, 109:344-347
Lettera del Prof. Rainer W. Stephany Director, EU Communities Reference Laboratori (CRL) – RIVM alla EU-EC/ Health &
Consumer Protection Directorate General – Directorate D - Food Safety: production and distribution chain Unit D3 - Chemical and
physical risks; surveillance. 20 January 2003
O’Connor J.J., Stillions M.c., Reynolds W.A., Linkenheimer W.H., Maplesden D.C. (1973) Evaluation of boldenone undecylenate as
an anabolic agent in horses. Can. Vet. Jour., 14: 154-158
Pompa G., Arioli F., Sgoifo Rossi C.A., Biondi P.A., Bartolino L.E., Cantoni C. (2003) Boldenone nelle feci di vitello e vitellone. Atti
Soc. It. Buiatria, Vol. XXXV: 167-174
Schilt R. (2002) Boldenone, an intriguing anabolic steroid of endogenous or exogenous origin. 4th Int. Symposium on Hormone and
Veterinary Drug Residue Analysis. Antwerp, 4-7 June 2002
Sgoifo Rossi C.A., Arioli F., Bassini A., Chiesa L.M., Dell’Orto V., Montana M., Pompa G. (2003) Interferenza della contaminazione
fecale sulla presenza di boldenone nelle urine di vitello. Atti Soc. It. Buiatria, Vol. XXXV, 157-166
Song Y.S., Jin C., Park E.H. (2000) Identification of metabolites of phytosterols in rat feces using GC/MS. Arch. Pharm. Res. Vol. 23
(6): 599-604
Van Puymbroeck M.V., Kuilman M.E.M., Maas R.F.M., Witkamp R.F., Leyssens L., Vanderzande D., Gelan J., Raus J. (1998)
Identification of some important metabolites of boldenone in urine of cattle by gas chromatography-mass spectrometry.
Analyst, 123: 2681-2686
Williams T.M., Kind A.J., Hyde W.G., Hill D.W. (2000) Characterisation of urinary metabolites of testosterone, methyltestosterone,
mibolerone and boldenone in grey-hound dogs. Jour. Vet. Pharm. Ther., 23:121-129
98
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
INTOXICACIÓN AGUDA POR ÁCIDO OXÁLICO: HALLAZGOS BIOQUÍMICOS
González Montaña Jr, Álvarez Nistal R, López Méndez S, Palma Barriga A, Prieto Montaña F.
Dpto. Medicina Veterinaria. Facultad de Veterinaria. Universidad de León. 24007. León. España.
E-mail: [email protected]
Resumen
Se han descrito múltiples casos de intoxicación por plantas que contienen cantidades variables de ácido oxálico. Intentando
comprobar en un futuro la toxicidad de la remolacha azucarera, planta con gran contenido en ácido oxálico, hemos
administrado el ácido oxálico puro a ovejas.
Para ello se han dado dos tipos de dosis a ovejas estabuladas en nuestra Facultad. Uno de los grupos recibió 300 mg/kg
p.v./día mientras que el otro recibió 600 mg/kg p.v./día. Realizamos muestreos diarios de sangre al objeto de comprobar la
posible toxicidad aguda del ácido oxálico. Se describen los hallazgos laboratoriales encontrados con ambas dosis de tóxico.
INTOSSICAZIONE ACUTA DA ACIDO OSSIALICO: REPERTI BIOCHIMICI
Riassunto
Sono stati descritti molteplici casi di intossicazione per ingestione di piante che contenevano quantita’ variabili di acido
ossialico. Per comprovare la tossicita’ della barbabietola da zucchero, che contiene alte concentrazioni del suddetto composto,
abbiamo somministrato a pecore acido ossialico puro.
Sono state fornite due tipi di dosi a pecore stabulate nella nostra facolta’. Un gruppo ha ricevuto 300mg/kg pv/dia, l’altro
600mg/kg pv/dia.
Furono realizzati prelievi giornalieri di sangue per comprovare la possibile tossicita’ acuta dell’acido ossialico. Si descrivono
i reperti laboratoriali incontrati con entrambe le dosi
Introducción
En la provincia de León, la remolacha azucarera (Beta vulgaris) se viene utilizando de forma rutinaria para la alimentación del
ganado ovino, bien directamente, bien a través de sus subproductos o bien de los productos resultantes de su transformación
para la obtención de azúcar.
Si tal como se ha citado en la bibliografía esta planta posee gran cantidad de ácido oxálico (Radostits et al, 1999) y otras
plantas que tienen distintas cantidades de ácido oxálico han sido causantes de intoxicaciones en distintas especies de
rumiantes, cabe la posibilidad que la alimentación con remolacha y sus subproductos pueda tener efectos adversos para el
ganado ovino.
Así la ingestión en exceso de ácido oxálico parece provocar diversas patologías que van desde irritación gastrointestinal hasta
patologías renales, debido a la precipitación de cristales de oxalato en la luz de los túbulos renales, e incluso la muerte de los
animales por una importante caída del calcio sanguíneo debido a que es quelado por el ácido oxálico (González- Montaña
et al, 2002).
Por tanto el objetivo final del presente trabajo ha sido valorar el efecto sobre animales vivos de la administración de ácido
oxálico puro en distintas cantidades, al objeto de determinar las alteraciones bioquímicas producidas.
Material y métodos
Utilizamos 6 ovejas adultas de raza Churra, convenientemente desparasitadas y en buen estado de salud. Durante su
estancia en las instalaciones en el Pabellón Clínico de la Facultad de Veterinaria de León, se alimentaron a base de forraje
de heno, paja de cebada, y concentrado de grano de cebada y de avena.
Las ovejas se dividieron al azar en dos grupos, para la administración de distintas cantidades de ácido oxálico. Se les
administró ácido oxálico dihidratado (RectapurTM, Prolabo, C2H2O42H2O, con 99% pureza) disuelto en 1 litro de agua
mediante sonda esofágica. A tres ovejas se les aplicó 600 mg/kg p.v./día, mientras que las otras 3 recibieron una dosis 300
mg/kg p.v./día hasta el fallecimiento.
Diariamente y previa a la administración del preparado se procedió a la exploración de las ovejas y la recogida de sangre
mediante punción en yugular con jeringas heparinizadas. Se han valorado los siguientes parámetros: fosfatasa alcalina,
ASAT, ALAT, GGT, urea, glucosa, creatinina, calcio, fósforo, magnesio y proteínas totales.
Resultados
Las ovejas a las que se ha administrado 600 mg de ácido oxálico/kg p.v./día murieron a los 5, 7 y 9 días. Los principales
síntomas encontrados han sido depresión, inapetencia, temblores, indiferencia al medio y disminución de la actividad
ruminal, evolucionando posteriormente a anorexia, parálisis ruminal, diarrea importante y estado comatoso. En un animal
se realizó la eutanasia cuando observamos que la evolución del proceso era irreversible.
En las tres ovejas comprobamos un importante incremento de la creatininemia y azoemia, ya observado a partir del día 3
(excepto una oveja que en el día 5 presenta una ligera disminución).
La ASAT y la GGT tienen valores por encima de los fisiológicos en toda la experiencia, incluso a partir del primer día. Se
evidencia un descenso de los valores de ALAT, GGT y ASAT (excepto en las últimas tomas).
La glucemia desciende ligeramente o se mantiene, con un importantísimo incremento en el último muestreo en una las
ovejas, correspondiéndose con las horas previas a la muerte del animal. Los niveles de proteínas totales no se alteran, excepto
en aquella oveja que sobrevive más días, donde se observa una caída continua.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
99
Se observa una caída importante de la calcemia hasta niveles incompatibles con la vida. Esto coincide con un descenso
continuo de la fosfatemia (excepto en los últimos días donde la evolución es inversa). No se evidencian variaciones
importantes en la magnesemia. La fosfatasa alcalina sigue prácticamente la misma evolución que la fosfatemia disminuyendo
a lo largo de la experiencia.
Las tres ovejas a las que se administró 300 mg de ácido oxálico/kg p.v./día tuvieron un comportamiento diverso, una
murió tras 18 días de administración, otra murió el día 63 de administración y la tercera oveja murió repentinamente 75
días después de haber comenzado la aplicación del tóxico.
Los hallazgos patológicos encontrados en la oveja muerta a los 18 días postadministración son similares a los encontrados
en las ovejas tratadas con 600 mg/Kg p.v./día. Por el contrario, los otros dos animales presentaron importantes lesiones
renales, que podrían justificar su fallecimiento.
La mayoría de hallazgos laboratoriales encontrados en la oveja fallecida el día 18 son similares a los indicados en las ovejas
que recibían el doble de dosis tóxica. Sólo en este animal se observa una disminución de la calcemia y un incremento
importante de la azoemia y creatininemia, sin modificaciones importantes en las otras ovejas.
Los valores de ASAT y GGT están elevados en todos los animales y durante toda la experiencia. En una de las ovejas (la que
sobrevive más tiempo) se observa un incremento continuo, tanto de ASAT como de ALAT, a partir de la segunda semana
hasta el momento de su muerte. En otra oveja comprobamos un importantísimo incremento de la GGT a partir del día 10
con retorno a los valores iniciales a medida que avanza la experiencia.
La glucemia presenta valores aceptables en todo el experimento, sin seguir un patrón marcado, de forma similar a como
evolucionan las proteínas totales.
Se observa un comportamiento similar de la calcemia y la magnesemia en los dos animales que sobreviven más tiempo,
manteniéndose en valores constantes. Por el contrario, la fosfatemia oscila de manera importante durante todo el protocolo
experimental. No se observa que exista relación entre estos minerales y los niveles de fosfatasa alcalina.
Discusión
El importante incremento de la creatininemia y azoemia coincide con lo señalado en la intoxicación natural por plantas
que contienen este tóxico (Roger et al, 1990; Pritam et al, 1996), pudiendo ser la posible causa de la muerte de los animales
(Watts, 1959; James y Butcher, 1972).
También la muerte de las ovejas pude achacarse a la hipocalcemia, al descender hasta valores incompatibles con la
vida (Watts, 1959; James 1972; Littledike et al, 1976; Roger et al, 1990; Radostits et al, 1999; Pritam et al, 1996). La
hipocalcemia es confirmada por Littledike et al (1976) administrando ácido oxálico en dosis cercanas al doble de la que
nosotros empleamos. Sin embargo, Duncan et al (1997) afirmaron que la concentración de calcio y de creatinina en
plasma no presenta modificaciones significativas. La hipocalcemia constatada por los investigadores revisados es justificada
mediante la posible quelación del calcio por parte del ácido oxálico (García-Partida et al, 1984; Libert y Franceschi, 1987;
Dhoot et al, 1995), formando complejos insolubles (García-Partida et al, 1984). Además de la interacción con el calcio
también se altera la absorción del magnesio (Wittwer et al, 1983).
Estamos en desacuerdo con James (1972) y Littledike et al (1976) para quienes la tasa de magnesio y de fósforo aumenta
en animales que ingieren ácido oxálico, ya que comprobamos un descenso de la fosfatemia y sin variaciones importantes
de la magnesemia. Existe una relación entre la fosfatemia y la fosfatasa alcalina (Watts, 1959). James en 1972 habla de la
interferencia del ácido oxálico sobre las enzimas que participan en el metabolismo del calcio y del magnesio. El incremento
del fósforo y magnesio sérico producido inmediatamente antes de morir es debido a la movilización de minerales originada
por la hipocalcemia, lo que provoca la alteración en la excreción renal del fósforo (Littledike et al, 1976).
Los valores elevados de la ASAT y la ALAT han sido citado por Pritam et al (1996) y por James (1972), si bien en nuestro
caso se hace más evidente en las ovejas que recibieron dosis menores del tóxico y sobre todo en aquella que sobrevivió más
tiempo.
No existen variaciones importantes ni de la glucemia (Pritam et al, 1996), ni de la proteinemia (Dhoot et al, 1995, Pritam et
al, 1996), pero sí observamos un importantísimo incremento de la glucosa sérica en las horas previas a la muerte de algunas
ovejas. La hipoproteinemia es justificada por la pérdida proteica en orina como consecuencia de la alteración de la función
renal por (Mcintosh, 1972; Katra y Khera, 1965).
Conclusiones
La administración oral de ácido oxálico a dosis de 600 mg de ácido oxálico/kg p.v./día provoca una intoxicación aguda en
ovejas que conduce a su muerte.
Los principales alteraciones bioquímicas encontradas son incremento de la azoemia y creatininemia, así como importante
hipocalcemia.
Si la dosis es de 300 mg de ácido oxálico/kg p.v./día los resultados son más dispares y las alteraciones laboratoriales no son
tan marcadas.
Bibliografía
Dhoot VM et al. (1995). Clinico-biochemical aspects of experimental oxalic acid poisoning in crossbred calves. Indian J. Vet. Med,
15 (1): 43-44.
Duncan AJ, Frutos P, Young SA. (1997). Rates of oxalic acid degradation in the rumen of sheep and goat in response to different levels
of oxalic acid administration, 65: 451-455.
García-Partida P, Alonso A, Prieto Montaña F (1984). Hematuria vesical bovina por ingesta de coronas de remolacha azucarera. XIII th
World Congress on Diseases of Cattle. 691.
James LF, Butcher J. (1972). Halogeton poisoning of sheep: effect of high level oxalate intake. Journal Animal Science, 35: 1438-1441.
James LF. (1972). Oxalate Toxicosis. Clinical Toxicology, 5 (2): 231-243.
Katra MS, Khera SS. (1965). Pathology of oxalate poisoning in catle. Indian J. Vet. Sci.. 35 (2):157-164.
100
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Libert B, Franceschi VR. (1987). Oxalate in crop plants. J Agric Food Chem, 35 (6): 926-938.
Littledike E.T. et al (1976). Oxalate (Halogeton) poisoning of sheep:certain physiopathologic changes. Am J Vet Res, 37 (6): 661-666.
Mcintosh GH. (1972). Chronic oxalate poisoning in sheep. Australian Veterinary J, 48 : 535.
Pritam K et al. (1996). Oxalate toxicity in ruminants fed overgrown napier grass (Pennisetum purpureum). Indian J. Animal Nutr, 13
(3): 181-183.
Radostits OM, Gay CC, Blood DC, Hinchcliff KW. Oxalate (soluble forms) poisoning. En: Veterinary Medicine. A texbook of the
diseases of cattle, sheep, pigs, goats and horses. 9 th edition. London: Saunders Company. 1999: 1639-1643.
Roger J et al. (1990). Acute oxalate poisoning attributable to ingestion of curly dock (Rumex crispus) in sheep. JAVMA, 196 (12):
1981-1984.
Watts PS. (1959). Effects of oxalic acid ingestion by sheep I. Small doses to chaff fed sheep. J. Agricultural Science, 52: 244-249.
Watts PS. (1959). Effects of oxalic acid ingestion by sheep I. Small doses to chaff fed sheep. J. Agricultural Science, 52: 250-255.
MODIFICACIONES SANGUÍNEAS RELACIONADAS CON LA ADMINISTRACIÓN ORAL DE ÁCIDO
OXÁLICO
González Montaña JR, Alvarez Nistal R, López Méndez S, Prieto Montaña F.
Dpto. Medicina Veterinaria. Facultad de Veterinaria. Universidad de León. 24007. León. España. E-mail:
[email protected]
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
101
IL RUOLO DELLA FORMAZIONE AI FINI DELL’APPLICAZIONE DEL SISTEMA HACCP
NELL’INDUSTRIA ALIMENTARE
Formato G.*, De Angelis G.**, Chiaro M.***, Bozzano A.I.*
*Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana [email protected]
** Azienda USL RM B
***Veterinary pactitioner.
Riassunto
L’applicazione del Sistema HACCP nell’industria alimentare richiede un cambiamento di mentalità sia negli operatori
del settore, sia per chi svolge attività di controllo ufficiale (veterinari ed altre figure preposte). Attualmente in Italia, detta
applicazione risulta non essere omogenea e, probabilmente, ciò potrebbe essere imputato anche ad una non appropriata
formazione degli operatori e dei controllori ufficiali.
Gli Autori illustrano una metodologia didattica basata su un coinvolgimento attivo dei partecipanti che garantisce buoni
risultati ai fini dell’applicazione dell’HACCP. E’ un metodo che, tenendo in considerazione il tipo di apprendimento degli
adulti, si articola nelle seguenti fasi:
• analisi del contesto in cui i partecipanti lavorano;
• analisi dei loro fabbisogni formativi;
• progettazione dell’intervento formativo;
• verifica e valutazione immediata;
• verifica e valutazione a distanza.
Detta metodologia prevede un ampio ricorso a esercitazioni in piccoli gruppi consistenti nella trattazione di casi realistici
che possono intervenire nella pratica.
Per rafforzare l’apprendimento maturato in aula, è raccomandabile una successiva e/o parallela formazione sul lavoro.
Essa può venire effettuata anche dagli organi ufficiali durante l’attività di vigilanza.
Infatti, in accordo ai recenti orientamenti europei, il veterinario ufficiale ha anche un ruolo educativo, il cui corretto
svolgimento richiede, a sua volta, una specifica formazione.
Abstract
HACCP implementation in food chain production needs a significative change of mentality both in personnel staff and
in controllers (veterinarians and other technicians).
At the moment, HACCP system implementation is not uniform in Italy. Probably it could be due also to a not proper
training of personnel staff and controllers.
The Authors show a training methodology based on an active involvment of partecipants, which allows good results
for HACCP implementation.
This metodology takes in account the learning way of adults, and it is characterized by the following phases:
- analysis of the context where the partecipants work
- analysis of the partecipants’ training needs
- planning of the training course
- course making
- short term training results evaluation
- long term training results evaluation.
In this method a strong importance is given to working in small groups to solve realistic cases which could happen in
practice.
At the same time, to strengthen the partecipants’ learning bound to the attended courses, is advisable the training on
the job.
It can be carried out by the controller during inspection activities. In accordance with the last European trends, the
controller has also an educational role. But to perform this important role, a specific training is also required for the
controllers.
Introduzione
Con il Decreto legislativo n.155 del 26.05.1997, l’Italia ha recepito la Direttiva Europea 43/93 del 15.06.1993, che
prevede l’adozione del sistema HACCP (Hazard Analysis Critical Control Point) per garantire la salubrità degli alimenti
lungo tutta la filiera produttiva (Carraro, 2000; Peccolo and Cinotti, 1998; Spiridigliozzi e coll., 2003).
Il sistema HACCP è un metodo di autocontrollo di tipo sistematico e preventivo basato sull’identificazione, prevenzione
e controllo di quei pericoli (di natura biologica, fisica o chimica) che possono compromettere la qualità igienico-sanitaria
degli alimenti (Codex Alimentarius, 1997; Hulebak and Schlosser, 2002; USDA/FSIS, 1998).
Malgrado la Direttiva 43/93 in Europa e il D.L.vo 155/97 in Italia siano in vigore da diversi anni, l’applicazione effettiva
del sistema HACCP sembra non essere uniforme, come indicato da diversi autori (Gilling e coll., 2001; Formato e coll. 2003;
Panisello e coll., 1999; Walker e coll., 2003).
Tra le motivazioni di tale fenomeno si può riconoscere una certa difficoltà degli operatori ad accettare e applicare la nuova
impostazione che i principi dell’ HACCP comporta in tutte le fasi della produzione alimentare.
Alcuni addetti lo considerano, infatti, un sistema troppo burocratico, o eccessivamente costoso in termini di tempo o di
danaro (Carraro, 2000; Formato e coll., 2003; Gilling e coll., 2000; Walker e coll., 2003).
L’effettiva adozione del sistema richiede ancora un processo di cambiamento sia di forma mentis, sia di modus operandi di
102
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
tutti gli attori coinvolti, a diverso titolo, nella filiera: responsabili dell’industria alimentare, addetti, personale adibito al
controllo ufficiale e, in una certa misura, consumatori.
Uno degli strumenti essenziali per facilitare il cambiamento è la formazione, in quanto processo costituito dall’insieme di
iniziative volte a fornire nuove conoscenze, sviluppare competenze e capacità, modificare i comportamenti delle persona, in
relazione sia agli specifici ambiti tecnico-professionali, sia a quelli della cultura aziendale.
Il ruolo primario della formazione ai fini dell’acquisione delle competenze essenziali a rendere operativo il sistema in oggetto viene
richiamato dalle numerose norme di tipo “orizzontale” e “verticale”, comunitarie e nazionali, che hanno previsto l’applicazione
dell’autocontrollo e l’utilizzo dello strumento HACCP, e diversi Autori lo evidenziano nei loro lavori (Ehiri, 1995; USDA/FSIS,
1998; Walker et coll., 2003; Williams, 2003).In Italia è dal 1997 che si assiste alla realizzazione di un numero elevato di
iniziative di aggiornamento e formazione sui temi dell’autocontrollo e dell’HACCP rivolti a diverse categorie professionali: addetti
del settore alimentare, personale laureato e tecnico operante negli organismi di controllo, altre figure professionali impegnate in
attività di consulenza.
Nonostante questa imponente attività di formazione, l’applicazione dell’autocontrollo risulta ancora incompleta e la
cultura dell’HACCP rischia di essere più teorica che pratica. I motivi di tale fenomeno, peraltro non omogeneo sul territorio
nazionale, sono articolati e complessi, e probabilmente tra essi potremo annoverare la qualità della formazione erogata.
Scopo di questo lavoro è di illustrare la metodologia impiegata dagli Autori in diverse iniziative formative finalizzate
all’apprendimento di concetti e metodologie trasferibili in comportamenti coerenti con i principi igienico-sanitari
dell’HACCP.
Materiali e metodi
Nel periodo 1997 – 2002 sono state realizzate diverse iniziative formative indirizzate ad operatori del settore carni, a veterinari,
tecnici della prevenzione e tecnici di laboratorio impegnati in organismi di controllo (Aziende USL e Istituti Zooprofilattici) e a
consulenti aziendali , per lo più biologi e chimici.
Due le tipologie di formazione adottate: la prima organizzata in veri e propri interventi (formazione strutturata), la seconda si
sviluppa nel corso delle attività di vigilanza (formazione sul lavoro).
La formazione strutturata
Affinché un intervento formativo sortisca i risultati auspicabili, cioè il cambiamento effettivo dei comportamenti, è
necessario progettare e realizzare le azioni utilizzando metodologie formative attualmente riconosciute efficaci per gli adulti,
e che tengano quindi conto delle loro peculiari modalità di apprendimento teorico-applicative.
Le lezioni tradizionali, caratterizzate unicamente dalla esposizione di informazioni e concetti, risultano sicuramente
inappropriate allo scopo e causa di spreco delle risorse impiegate.
E’ opportuno seguire una metodologia scientifica articolata nelle seguenti fasi:
• analisi del contesto;
• analisi dei fabbisogni formativi;
• progettazione degli interventi;
• realizzazione e monitoraggio degli interventi;
• verifica e valutazione immediata;
• verifica e valutazione a distanza.
Considerando, per esempio, il caso di un progetto formativo da realizzarsi nei confronti di addetti di nella lavorazione
di alimenti le fasi elencate possono essere così illustrate: analisi del contenuto, analisi dei fabbisogni formativi,
progettazione degli interventi, realizzazione degli interventi, verifica e valutazione immediata, verifica e valutazione a
distanza.
Analisi del contesto: determinazione del tipo di economia della zona; tipologia degli esercizi e stabilimenti in cui operano
gli addetti (piccole strutture artigianali, supermercati, grossi stabilimenti, ecc.); tipo e volumi di produzione; tipologia
della clientela; esito delle visite ispettive effettuate in passato dai servizi pubblici negli esercizi coinvolti e degli esami di
laboratorio effettuati su campioni di alimento ivi prelevati; titolo di studio dei partecipanti, formazione pregressa, ecc.
Tutte informazioni necessarie ad impostare degli interventi adeguati ai partecipanti e funzionali al conseguimento
dell’obiettivo del piano.
Analisi dei fabbisogni formativi: è “un momento di interrogazione effettuato raccogliendo informazioni attraverso gli
strumenti dell’osservazione diretta e dell’intervista individuale o di gruppo”, finalizzata alla identificazione delle reali e
specifiche esigenze formative. Può essere effettuata anche con l’ausilio di questionari. E’ un momento cruciale ai fini della
corretta individuazione degli obiettivi formativi e delle relative metodologie.
Gli obiettivi specifici, da esprimersi in termini di competenze che i partecipanti matureranno a seguito dell’intervento
formativo, saranno tanto più validi quanto più:
§ chiari e precisi nella formulazione
§ pertinenti ai problemi definiti e alle esigenze identificate in sede di analisi di contesto e di fabbisogni formativi;
§ adeguati al livello di competenze già possedute dagli interessati ( né troppo facili, né troppo difficili);
§ realizzabili nel contesto dato e con le risorse disponibili;
§ completi e misurabili, quindi dovranno essere indicate:
- le prove che il discente dovrà compiere al termine dell’intervento al fine di una
valutazione di apprendimento;
- campi da apprendimento da saggiare (sapere; saper fare; saper essere);
- livello di accettabilità della prestazione.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
103
Inoltre, l’analisi dei fabbisogni formativi, è utile per instaurare dei canali di comunicazione efficaci tra formatori
e futuri discenti. Quest’ultimi apprezzeranno l’interesse per i loro reali problemi, il che potrà contribuire a ridimensionare
gli ostacoli alla comunicazione esistenti tra operatori e formatori, favorendo l’instaurarsi di un clima di inizio corso aperto
e collaborativo.
Progettazione degli interventi: si realizza tenendo conto degli obiettivi generali e specifici che si intende perseguire; di
quanto emerso dalle due precedenti fasi; dei sistemi di verifica e valutazione dell’efficacia degli interventi che si ritiene
utilizzare; della necessità di dover impiegare metodologie didattiche tese al coinvolgimento attivo dei partecipanti e alla
valorizzazione delle loro esperienze.
Realizzazione degli interventi: da quanto detto nasce la necessità di ricorrere, oltre che alla lezione frontale, a dei momenti
interattivi, quali:
- discussione in plenaria di casi pratici
- lavori in sottogruppi su casi pratici o problematiche
- dimostrazioni pratiche.
Durante la lezione frontale, che potrà intervallare i metodi didattici più interattivi, il docente procederà secondo uno stile
che tenga conto delle modalità di apprendimento degli adulti, avvalendosi di alcune raccomandazioni:
1. centrarsi sul ricevente, trasmettendo messaggi assimilabili dalla struttura psicologica, culturale e professionale
di chi ascolta;
2. essere semplici ed essenziali;
3. partire dal generale, inquadrare l’argomento e poi analizzarlo;
4. preoccuparsi della comprensione prima di sviluppare l’idea, specie se si utilizza un linguaggio tecnico;
5. ribadire/ripetere i concetti chiave del messaggio: le idee più importanti vanno ripetute in maniera diversa;
6. organizzare il proprio messaggio a stadi: uno stadio deve essere completato prima di introdurne un altro;
7. concentrarsi sugli aspetti essenziali del messaggio: non sovraccaricare gli ascoltatori di informazioni;
8. mettere in relazione le idee nuove con quelle già possedute da chi partecipa.
In tal senso il docente non può essere una figura che impone dei concetti o delle regole, bensì un facilitatore che
introduce gli argomenti, aiuta a focalizzare i problemi e a trovare le possibili soluzioni.
Verifica e valutazione immediata: costituisce il momento più delicato dell’intervento, ma anche quello che conferisce
credibilità scientifica al processo formativo.
Il formatore valuta il progetto, gli obietti raggiunti e quindi le competenze acquisite dai discenti e il cambiamento dei
comportamenti. Questa valutazione di apprendimento può essere effettuata secondo diverse modalità: questionari “in
entrata” e “in uscita”, colloqui, stesure di documenti, simulazioni, prove pratiche, ecc. La scelta della tecnica dipende da
diversi fattori: obiettivi formativi, numero e tipologia di partecipanti, esperienza del docente, tempo e risorse disponibili.
Le prove di valutazione dovranno essere introdotte con le necessarie spiegazioni, al fine di ridurre “la paura dell’esame”.
D’altra parte, lo stesso formatore richiederà ai discenti una loro valutazione, o gradimento, dell’intervento, per esempio
con l’utilizzo di apposite schede anonime, nelle quali si prevedono delle domande che sondino le diverse dimensioni
dell’evento: chiarezza e completezza degli argomenti trattati, disponibilità e attitudini relazionali dei docenti, raggiungimento
degli obiettivi prestabiliti, qualità del materiale didattico, aspetti logistici (confort aula, puntualità, ecc.). Queste schede
forniranno preziosi suggerimenti utili a modificare successivi eventi e faciliteranno il consolidamento di un clima di
reciproco rispetto e fiducia tra formatori e discenti, fondamentale nella formazione degli adulti.
Verifica e valutazione a distanza. La modificazione dei comportamenti eventualmente prodotta dall’intervento formativo sui
singoli soggetti e sul loro operato nella quotidianità lavorativa, richiedono un certo tempo affinché possano svilupparsi.
Sono, inoltre, aspetti di non facile verifica, considerati sia i molteplici fattori che, anche indipendentemente dall’azione
formativa, influenzano i comportamenti delle persone, sia i costi che detta verifica comporta.
E’ necessario individuare degli indicatori significativi di cambiamento, che conseguono dagli obiettivi formativi, e dei
relativi standard di accettabilità. Ad esempio, nel caso di un intervento formativo che mirasse a migliorare i comportamenti
igienico-sanitari di addetti alla preparazione e vendita di preparazioni a base di carne, si potrebbe andare a controllare gli esiti
delle visite di vigilanza a distanza di 4-5 mesi dall’evento formativo, comparandole con quelle eseguite nei mesi precedenti
all’intervento. Nella stessa maniera si potrebbero paragonare i risultati di esami di laboratorio eseguiti su campioni e/o
tamponi ambientali effettuati nei 5-6 mesi prima dell’intervento, con quelli effettuati dopo 4-mesi.
Una verifica a distanza, meno scientifica e quindi di carattere orientativo, è quella di riunire i partecipanti ad un corso
dopo 5-6 mesi dallo stesso, al fine di sviluppare un confronto, con l’aiuto del formatore, su ciò che ciascuno ha fatto o
modificato nel proprio contesto lavorativo a seguito dell’intervento.
La formazione strutturata, secondo la metodologia sopra illustrata, è stata da noi impiegata nei seguenti progetti
formativi:
104
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Tabella n. 1: progetti formativi realizzati
CATEGORIA
PROFESSIONALE
DURATA
N. DI INTERVENTI
N. COMPLESSIVO DI PERSONE
COINVOLTE
Operatori di stabilimenti di
macellazione
8 giornate/intervento
2
40
Operatori di stabilimenti di
sezionamento e trasformazione 8 giornate/intervento
carni
1
30
5 giornate/intervento
4
300
Veterinari, tecnici della
prevenzione, biologi e chimici 3 giornate/intervento
7
173
Operatori di macelleria
La formazione sul lavoro
La formazione sul lavoro, a differenza della formazione strutturata, si sviluppa nell’ambito dell’attività di vigilanza e viene
effettuata nei confronti degli operatori del settore alimentare che si incontrano nelle visite di controllo
effettuate o dalle autorità competenti o dai consulenti aziendali.
Diversi sono gli elementi che caratterizzano tale tipo di formazione (tabella n. 2), come risultato dalle esperienze
maturate dagli Autori nel periodo indicato.
Tabella n. 2 – Elementi caratterizzanti la formazione sul lavoro
>
>
>
>
>
>
>
>
>
>
Riguarda le problematiche dell’azienda controllata
Diretta a poche persone
Elevato livello di attenzione
Molto efficace per gli operatori
Prevede intuito da parte del formatore nel focalizzare gli errori fatti dagli operatori
E’ facoltativa
E’ “gratuita” – non prevede ricompense “extra”
Richiede tempo
Richiede competenze didattiche e competenze professionali da parte dei controllori
Non viene sempre valorizzata
Anzitutto è quasi sempre rivolta ad un numero ristretto di individui. Questo consente di modulare l’intervento formativo,
che verterà principalmente sulle problematiche riscontrate nell’ambito del controllo, in funzione del livello delle persone
che si hanno di fronte. Si instaura così un rapporto controllore/controllato in un clima che spinge gli operatori a porre delle
domande per capire e risolvere i loro errori.
Indubbiamente si è avvantaggiati dal fatto che i soggetti cui è diretto tale tipo di formazione manifestano solitamente un
elevato livello di attenzione, vuoi per la paura di essere sanzionati, vuoi per l’occasione che hanno di potersi confrontare con
un professionista che li può aiutare a gestire meglio la loro attività per quanto riguarda gli aspetti igienico-sanitari.
Di importanza fondamentale per il formatore è porre frequenti domande per verificare che siano stati compresi a fondo
i concetti base di igiene ed i principi su cui si impernia il sistema di autocontrollo aziendale. A volte, infatti, capita che
dal punto di vista documentale tutto sia in ordine (es. il manuale di autocontrollo è presente, le schede di monitoraggio
sono compilate, ecc…) ma si rischia di non rendersi conto, se non facendo appunto delle domande, che manca una
consapevolezza di ciò che viene fatto. E’ questa purtroppo la situazione peggiore. Quando è così, infatti, le cose vengono
fatte dagli operatori “perché me lo richiede la legge” e non “perché effettivamente è meglio”, arrivando al punto di compilare
meccanicamente, “a tavolino”, la documentazione necessaria per adempiere quanto richiesto dalla legge, mentre in realtà si
rifiuta e ci si sente vittime del sistema di autocontrollo aziendale.
Da quanto premesso, si capisce che la formazione sul lavoro risulta essere di singolare efficacia per gli operatori. Malgrado
ciò, questi interventi formativi non vengono sempre accuratamente svolti, se non del tutto omessi.
Si deve poi considerare che essa richiede un notevole investimento di tempo.
Risultati
Le attività formative svolte secondo le metodologie adottate, hanno sortito positivi risultati sia in termini di apprendimento
concettuale dei principi del sistema HACCP, sia nelle pratiche lavorative quotidiane. Ciò è stato verificato tramite
questionari di apprendimento, esercitazioni in piccoli gruppi, dibattiti in plenaria, esiti di visite ispettive eseguite dopo gli
interventi formativi, risultati di esami di laboratorio effettuati su prodotti alimentari.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
105
Discussione e conclusioni
Sulla base delle esperienze sviluppate, si ritiene che una completa applicazione del sistema HACCP viene favorito dalla
impostazione di processi formativi che si basano su metodologie simili a quelle esposte e che si fondano sulle caratteristiche di
apprendimento degli adulti, sull’utilizzo di tecniche didattiche interattive, sulla verifiche di apprendimento e di cambiamento e
su un ampio impiego della formazione sul lavoro. Quest’ultima, ad oggi, non viene ancora tenuta in debita considerazione, ma
tale atteggiamento dovrà certamente essere rivalutato nel tempo, anche in considerazione delle nuove tendenze della normativa
europea.
Bibliografia
1. Carraro V. 2000. Verifiche dei piani di autocontrollo: primi riscontri. Atti Seminario Food Quality di San Michele all’Adige:
9-14.
2. Codex Alimentarius. 1997. Guidelines for the application of the Hazard Analysis Critical Control Point system. Annex to
CAC/RCP-1 (1969), Revision 3.
3. Ehiri J.E., Morris G.P. 1995. HACCP implementation in food businesses: the need for a flexible approach. J. R. Soc. Health
115: 249-253.
4. Formato G., Bozzano A. 2003. HACCP system in the retail sale of raw meat and meat products. In press.
5. Gilling S.J., Taylor E.A., Kane K., Taylor J.Z. 2001. Successful Hazard Analysis Critical Control Point implementation in the
United Kingdom: understanding the barriers through the use of a behavioral adherence model. J. Food Protect 64 (5): 710-715.
6. Hulebak K.L., Schlosser W. 2002. Guest editorial: Hazard Analysis and Critical Control Point (HACCP) history and
conceptual overview. Risk Anal. 22 (3): 547-552.
7. Panisello J.P., Quantick P.C., Knowles M.J. 1999. Toward the implementation of HACCP; results of a UK regional survey.
Food Control. 10 (2): 87-98.
8. Peccolo G. and Cinotti S. 1998. Evoluzione legislativa in materia di autocontrollo nelle aziende agroalimentari e sistema
HACCP. Atti S.I.S.Vet 52: 359-360.
9. Spiridigliozzi S., Abetti P., Santini F. 2003. Aziende sotto controllo. La prevenzione è a singhiozzo. Alimenti & Bevande. 1/2:
45-53.
10. USDA/FSIS. 1998. Hazard Analysis and Critical Control Point Principles and Application Guidelines. J. Food Protect. 61:
1246-1259.
11. Walker E., Pritchard C., Forsythe S. 2003. Hazard Analysis Critical Control Point and prerequisite programme implementation
in small and medium size food business. Food Control. 14: 169-174.
12. Williams A.P., Smith R.A., Gaze R., Mortimore S.E., Motarjemi Y., Wallace C.A. 2001. An international future for standards
of HACCP training. Food Control. 14: 111-121.
106
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ATTI
VENERDÌ 23 MAGGIO 2003
PREVALENZA ED ABBONDANZA STAGIONALI DEI NEMATODI DEL PICCOLO
INTESTINO IN PECORE DI UN ALLEVAMENTO DELLA SICILIA OCCIDENTALE
PREVALENCE AND ABUNDANCE OF SMALL INTESTINE NEMATODES IN ONE SHEEP
FARM IN WEST SICILY
Torina A., Vullo A., La Terra D., Caracappa S.
A 3-YEAR EPIDEMIOLOGICAL SURVEY OF GASTRO-INTESTINAL NEMATODES IN A
SHEEP FLOCK FROM SOUTH SARDINA
Scala A., Gruner L., Carta A. Nieddu M.S.
IDENTIFICAZIONE DEGLI OSvvwPITI INTERMEDI DI MUELLERIUS CAPILLARIS
(MUELLER, 1889) IN SARDEGNA E LORO INFESTAZIONE SPERIMENTALE.
Polinas L., Chighine C., Sardo D., Scala A., Garippa G.
ANALISI DELLA DIFFUSIONE DELLA NEOSPOROSI MEDIANTE IFI E PCR IN
ALLEVAMENTI OVINI E CAPRINI DELLA SARDEGNA
Madau L., Tanda A., Fiori S., Porcu R., Chisu V., Sanna G., Tola S. , Masala G.
EFFICACIA DELLA MOXIDECTINA IN FORMULAZIONE INIETTABILE E POUR ON PER
IL CONTROLLO DELL’IPODERMOSI BOVINA IN BASILICATA
Lia R., Agostini A., G. Prestera, Otranto D.ù
EFFICACIA DI UN TRATTAMENTO DI ROUTINE CON IVERMECTINA O
DORAMECTINA IN BOVINI ALL’INGRASSO.
Stancampiano L., Bulgarelli M., Corradini D., Micagni G., Battelli G.
XI Congresso
Internazionale
della Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
107
108
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
PREVALENZA ED ABBONDANZA STAGIONALI DEI NEMATODI DEL PICCOLO INTESTINO
IN PECORE DI UN ALLEVAMENTO DELLA SICILIA OCCIDENTALE
Torina A., Vullo A., La Terra D., Caracappa S.
Istituto Zooprofilattico Sperimentale della Sicilia “A.Mirri”(*)
Riassunto
E’ stato intrapreso da aprile 1996 a marzo 1997 uno studio sui nematodi infestanti il piccolo intestino di ovini della Sicilia
occidentale. La ricerca è stata condotta su un campione di ovini di provenienza da un allevamento pilota sito a 1360 m.s.l.m.
. Sono stati esaminati 8 visceri in inverno, 9 in primavera, 24 in estate e 12 in autunno. Le specie riscontrate appartengono
al genere Trichostrongylus , Nematodirus e Bunostomum, e Cooperia. Sui 53 piccoli intestini esaminati 35 erano infestati
(66 %), la percentuale di infestazione era del 62.5% in inverno, 44.4% in primavera, 66.6% in estate e 83,3% in autunno.
La carica parassitaria media era rispettivamente 370, 482, 1101 e 1914. le specie con maggiore prevalenza ed abbondanza
erano T.vitrinus e T.colubriformis. T.vitrinus era piu abbondante in autunno (516) con una prevalenza del 41.7 %, mentre
in inverno la prevalenza si mantiene elevata (50%) ma l’abbondanza assume valori molto bassi (25). B.trigonocephalus
mantiene valori di prevalenza intorno al 30% per tutto l’anno ad esclusione della primavera durante la quale si ha un
calo (11%), l’abbondanza assume il suo massimo valore in inverno (34). I nematodi appartenenti al genere Nematodirus
sono presenti in tutte le stagioni, N.filicollis ha prevalenza ed abbondanza maggiori in autunno (33% e 227), N.spatiger
ha i valori più elevati di prevalenza ed abbondanza in inverno (38% e 126). I nematodi del genere Cooperia sono poco
rappresentati , avendo per ciascuna specie valori di prevalenza inferiori al 4% e di abbondanza inferiori a 34.
Introduzione
Il calcolo dei danni arrecati dalle parassitosi al patrimonio zootecnico registra ovunque perdite ingenti nell’ordine di milioni
di dollari all’anno. Il minor rendimento in carne, lana e latte ed i costi dei trattamenti antielmitici (Barger 1982), sono
la maggiore causa delle perdite di produzione dell’attività Zootecnica nel mondo (A.A.V.P. 1983) e sono considerate il
maggiore ostacolo in una produzione ovina efficiente.(Urguhart et al. 1987)
Anche in Italia stime attendibili attribuiscono ai parassiti perdite che rappresentano oltre il 6% del reddito agricolo
nazionale. Si calcola che per alcune specie in produzione zootecnica, quali ovini e caprini, i parassiti sono i responsabili dei
4/5 dell’intera patologia (Arru E. 1985).
Negli ovini i nematodi gastrointestinali più largamente diffusi appartengono ai Trichostrongylidi con i generi Haemonchus,
Ostertagia (Teladorsagia), Trichostrongylus, Cooperia e Nematodirus, ciascuno con diverse specie, agli Strongilidi coi generi
Oesophagostomum e Chabertia, agli Ancylostomidi col genere Bunostomum ed ai Tricuridi. Ogni genere è presente con
numerose specie che hanno uno specifico potere patogeno e localizzazione in diversi distretti dell’apparato gastro intestinale.
Inoltre manifestano la patologia con una spiccata polispecificità eziologica, nel senso che, l’alto numero di generi e specie,
contribuiscono a determinare una situazione sostanzialmente unitaria e riconducibile in ultima analisi ad un’unica entità
nosologica (Ambrosi M. 1991).
L’azione patogena può essere determinata sia dalle forme larvali che dai parassiti adulti o da entrambi .La capacità dei
nematodi gastroenterici di sfuggire all’azione combinata di vari sistemi di controllo deriva dall’associazione di fattori legati
a conduzione dell’allevamento, resistenza agli antielmintici e dalla presenza di serbatoi di parassiti allo stato larvale nei
pascoli. Lo sviluppo e la sopravvivenza di questa popolazione larvale richiede l’esistenza di condizioni ambientali adeguate
per cui l’importanza clinica ed i quadri di trasmissione di queste parassitosi differiscono da una regione all’altra (Zojac e
Moore 1993).
E’ noto che il distretto anatomico dell’apparato gastrointestinale maggiormente parassitato è l’abomaso e diversi studi sono
stati condotti per lo studio dei Nematodi maggiormente implicati e della loro stagionalità nel territorio siciliano (Gallo
1960; Caracappa et al. 1994; Caracappa et al. 1996, Torina & Dara 1998;Caracappa & Torina 1998; Torina et al 2002),
ma un’alta prevalenza di infestazione è stata riscontrata anche nel piccolo intestino (Caracappa et al. 1996; Caracappa &
Torina 1998), pertanto in questo lavoro ci riproponiamo di esaminare le specie di nematodi del piccolo intestino e la loro
stagionalità.
Materiale e metodi
L’indagine ha avuto inizio nell’Aprile 1996. L’ allevamento ovino preso in considerazione è ubicato a 1360 m.s.l.m. in
contrada Monte Zimmara Comune di Gangi PA, superficie 60 ha ricoperta per la maggior parte da pascoli polifiti naturali
la natura del terreno è argilloso calcareo, costituito da 160 capi allevati allo stato brado, gli animali hanno subito un solo
trattamento antiparassitario nel mese di Dicembre ed hanno partorito a Settembre;.
Per l’isolamento del materiale gastrointestinale e la tipizzazione dei parassiti adulti presenti nell’apparato, l’intestino
è stato suddiviso in modo da esaminare separatamente il materiale presente nell’abomaso, nel piccolo intestino, nel
grosso intestino e nel cieco, con la tecnica della doppia legatura. Ogni singolo tratto è stato poi esaminato con apertura
longitudinale in bacinella, leggera raschiatura e lavaggio della mucosa, raccolta del materiale intestinale e del liquido di
lavaggio e sua decantazione attraverso filtrazioni per setacci calibrati (pori di diametro decrescente 212-75-38 micron) ,
facilitando il passaggio del materiale con getti d’acqua sotto pressione. Per ciascun campione è stata prelevata, dopo accurato
rimescolamento un’aliquota pari al 10% del materiale ed i parassiti, in esso contenuti, sono stati raccolti e mantenuti in
alcol a 70°; per l’identificazione sono stati chiarificati in lattofenolo e classificati secondo le chiavi tassonomiche di Skrjabin
et al. (1961), Durette - Desset (1983), Cabaret et al. (1986) ed in accordo con la nomenclatura proposta da Durette Desset (1989).
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
109
È stata calcolata la prevalenza stagionale per ogni specie riscontrata e l’abbondanza intesa come il numero dei parassiti totali
di una data specie in rapporto al numero di campioni esaminati (Margolis et al., 1982)
Risultati e conclusioni
Sui 53 piccoli intestini esaminati 35 erano infestati (66 %), la percentuale di infestazione era del 62.5% in inverno, 44.4%
in primavera, 66.6% in estate e 83,3% in autunno. La carica parassitaria media era rispettivamente 370, 482,1101 e 1914
(Tab.1).
le specie con maggiore prevalenza ed abbondanza erano T.vitrinus e T.colubriformis.
T.vitrinus era piu abbondante in autunno (516) con una prevalenza abbastanza elevata durante tutte le stagioni (20.850 %), in inverno la prevalenza è elevata (50%) ma l’abbondanza assume valori bassi (25). B.trigonocephalus mantiene
valori di prevalenza intorno al 30% per tutto l’anno ad esclusione della primavera durante la quale si ha un calo (11.1%),
l’abbondanza assume il suo massimo valore in inverno (34). I nematodi appartenenti al genere Nematodirus sono presenti
in tutte le stagioni, N.filicollis ha prevalenza ed abbondanza maggiori in autunno (33.3% e 227), N.spatiger dimostra invece
di essere più resistente durante le stagione invernale con valori di prevalenza ed abbondanza più elevati (37.5% e 126). I
nematodi del genere Cooperia sono poco rappresentati , avendo per ciascuna specie valori di prevalenza inferiori al 8.3 %
e di abbondanza inferiori a 34 (Tab.2).
Tab 1. Prevalenza di infestazione e carica media parassitaria dei nematodi del piccolo intestino
Stagione
Nr. Tot
Nr. Pos
Prev
C.M.
Inverno
8
5
62,5 %
370
Primavera
9
4
44,4 %
482
Estate
24
16
66,7 %
1101
Autunno
12
10
83,3 %
1914
Totale
53
35
66,0 %
967
Tab 2. Prevalenza ed abbondanza stagionale per singola specie
Specie
B.trigonocephalus
N.abnormalis
N. filicollis
N.spatiger
N.battus
T.axei
T.capricola
T.vitrinus
T.colubriformis
C.pectinata
C.oncophora
C.punctata
C.curticei
Teladorsagia spp
Inverno
Prev
A
25,0 %
34
12,5 %
7
12,5 %
3
37,5 %
126
25,0 %
11
0 0
0 0
50,0 %
25
37,5 %
21
0
0
0
0
0
0
0
0
0
0
Primavera
Prev
A
11,1 %
2
11,1 %
7
11,1 %
7
22,2 %
20
0
0
11,1 %
4
11,1 %
3
22,2 %
80
33,3 %
71
0
0
0
0
0
0
0
0
11,1 %
7
Estate
Prev
29,2 %
20,8 %
25,0 %
20,8 %
8,3 %
8,3 %
8,3 %
20,8 %
20,8 %
8,3 %
8,3 %
4,2 %
0
8,3 %
A
20
10
25
21
125
2
13
287
206
5
5
2
0
3
Autunno
Prev
A
33,3 %
30
33,3 %
110
33,3 %
227
33,3 %
77
0
0
0
0
25,0 %
373
41,7 %
516
41,7 %
157
0
0
0
0
0
0
8,3 %
34
8,3 %
4
L’estate e la primavera sono le stagioni con la maggiore prevalenza ed abbondanza di nematodi ed i livelli più elevati di
poliparassitismo, anche se comunque nelle altre stagioni nel piccolo intestino riscontriamo non meno di 7 differenti specie
di nematodi. Questi dati confermano il dato più volte segnalato in letteratura dell’incremento di infestazioni nel periodo
preparto e durante la lattazione.
Il trattamento antielmintico effettuato nel mese di Dicembre contiene il numero di nematodi nella stagione invernale, ad
eccezione di B.trigonocephalus e N.spatigher , evidentemente specie resistenti sia ai trattamenti antielmintici che alle basse
temperature.
Inoltre, essendo l’allevamento ubicato in una zona interna a 1300 mslm , per le condizioni climatiche rigide nei mesi
invernali, verrebbero comunque indotti meccanismi di ipobiosi, ciò nonostante la discordanza fra prevalenza ed abbondanza
stagionale dimostra come anche a bassi livelli di carica media si ha un alto potere infestante, per cui le specie parassite
permangano durante l’intero anno per manifestarsi al massimo livello di infestazione nei mesi più caldi.. Queste osservazioni
ci conducono alla conclusione che tale tipo di indagine, soprattutto nella nostra regione, caratterizzata per condizioni
climatiche e morfologia di territorio particolari, è la base indispensabile per affrontare il problema delle parassitosi gastrointestinali in maniera organica , prestando una maggiore attenzione ai periodi più opportuni per la somministrazione dei
110
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
trattamenti antielmintici e per cercare di sincronizzare tali trattamenti, almeno per fasce di altitudine, per contenere la
diffusione dei parassiti
Ibliografia
1. Barger I.A. (1982) Helminth parasites and animal production in Symons LEA, Donald A.D. Dineen J.K. (eds): Biology and
control of Endoparasites Sydney, Australia, Academic Press; 133-155.
2. AAVP (American Association of Vetrinary Parasitologist) (1983) Research needs and priorities for ruminant internal parasites in the
United States - America Journal of Veterinary Research 44, 1836-1847.
3. Urquhart G.M., Armour J., Duncan J.L., Dunn A.M., Jennings F.W. (1987) Veterinary Parasitology. Avon Longman Scientific and
Technical.
4. Arru E. (1985) Principali Nematodi e Trematodi degli animali domestici - Elmintiasi: problemi veterinari e zootecnici. Atti Pfizer
9: 5-12.
5. Ambrosi M. (1991) Le elmintiasi degli ovini nelle aree interne dell’Italia centrale - Regione Umbria. Piani di intervento mediterranei
- Contributi scientifici e tecnici.
6. Zajac A.M., Moore G.A. (1993) Trattamento e controllo dei nematodi gastroenterici degli ovini. “The compendium on continuing
education for the Practicing Veterinariana” 15; 7: 999-1010.
7. Gallo C. (1960) I Tricostrongilidi degli ovini nella Sicilia sud-orientale. Parassitologia II°, 179-180.
8. Caracappa S., Riili S., Prato F., Stancanelli A., Di Marco V., Loria G.R., Manfredi N.T. (1994) Indagine sulla fauna elmintica
abomasale in ovini e caprini siciliani. Atti Congresso S.I.P.A.O.C., 287-290.
9. Caracappa S., Di Marco V., Dara S., Torina A., Riili S. (1996) Indagine sulla diffusione dei nematodi intestinali in allevamenti di
ovini e caprini della Sicilia. Atti Congresso S.I.P.A.O.C..
10. Torina A., Dara S. “Condizioni climatiche ed infestazioni da Trichostrongili: osservazioni su ovini e caprini” Atti XIII Congresso
Nazionale SIPAOC (1998): 255-259.
11. Caracappa S., Torina A. “Nematodi gastrointestinali in ovini della Sicilia occidentale” Atti XIII Congresso Nazionale SIPAOC
(1998): 267-270.
12. A. Torina, S. Riili, S. Caracappa, C. Genchi. “Seasonal variation of prevalence and abundance of trichostrongylid infections in one
sheep farm in west Sicily”, (2002) XXII Congresso Nazionale della Società Italiana di Parassitologia.(2002) Parassitologia 44 (suppl. 1);
186.
13. Skrjabim K.I., Shikhobalova N.P., Schulz R.S. (1961) Key to parasitic nematodes. Strongylata Israel Program for Scientific
Translation, Jerusalem (3).
14. Durette-Desset M.C. (1983) Key to genera of the Superfamily Trichostrongyloidea. Ediz. CAB.-Cabaret J., Morales G., DuretteDesset M.C. (1986) Ann. Parasit. Hum. Comp., 61(1) 55-64.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
111
A 3-YEAR EPIDEMIOLOGICAL SURVEY OF GASTRO-INTESTINAL NEMATODES IN A
SHEEP FLOCK FROM SOUTH SARDINA
Scala A.1, Gruner L.2, Carta A.3 Nieddu M.S. 1
Dipartimento di Biologia Animale, Università di Sassari, Italy, 2INRA-BASE, 37380 Nouzilly, France,
3
IZCS Olmedo, Italy.
1
Parasitological investigations were conducted from January 2000 to March 2003 in a flock of 980 ewes born on December
1998 and located at Monastir (South Sardina), with the purpose of identification of Quantitative Trait Locus (QTL) related
to resistance to gastro-intestinal nematode infection. They grazed some hours each day annual irrigated pastures, out of
dry season (August). Thirty faecal egg counts were done to monitor the evolution of egg excretion and individual counts
processed on all the ewes at 7 times (McMaster method). Species diversity was investigated by the use of larval identification
from pooled cultures and by necropsy of 2-3 ewes at each time.
Teladorsagia circumcincta and Trichostrongylus colubriformis were dominant species in winter, Haemonchus contortus was
abundant during the spring, favoured by the irrigation. High numbers of worms in early June were H. contortus at larval
stage, highest egg excretion being observed later on. Breeding group and father had significant effects. The repeatability
of faecal egg count was 0.23.
INDAGINE EPIDEMIOLOGICA TRIENNALE SUI NEMATODI GASTRO-INTESTINALI DI UN GREGGE
DI OVINI NELLA SARDEGNA MERIDIONALE
Scala A.1, Gruner L.2, Carta A.3 Nieddu M.S. 1
Dipartimento di Biologia Animale, Università di Sassari, Italy, 2INRA-BASE, 37380 Nouzilly, France, 3IZCS Olmedo,
Italy.
1
Da gennaio 2000 a marzo 2003 sono state effettuate indagini parassitologiche su un gregge di 980 ovini nati nel dicembre
1998 e allevati a Monastir (CA) con l’obiettivo di identificare dei Quantitative Trait Locus (QTL) in rapporto alla resistenza
alle infestioni da nematodi gastro-intestinali. Gli ovini, divisi in diversi gruppi, pascolavano per qualche ora al giorno su
pascoli irrigui, ad eccezione della stagione secca (agosto).
Per valutare l’evoluzione dell’eliminazione delle uova dei nematodi sono state effettuate analisi copromicroscopiche
quantitative su ogni soggetto per 7 volte nell’arco del periodo di monitoraggio (metodo McMaster).
Ad ogni campagna di prelievi, per stabilire la composizione dell’elmintofauna presente, sono state allestite coprocolture per
l’identificazione delle larve da pools di feci ed effettuata la necroscopia di 2-3 soggetti.
Teladorsagia circumcincta e Trichostrongylus colubriformis erano le specie dominanti in inverno, Haemonchus contortus
era abbondante durante la primavera, favorito anche dall’irrigazione. Un alto numero di parassiti dati soprattutto da
larve di H. contortus si riscontrava ai primi di giugno. La loro successiva evoluzione si rendeva responsabile dell’aumento
dell’eliminazione di uova che si registrava subito dopo questo periodo. L’elaborazione dei dati evidenziava un effetto
significante dei gruppi pascolo. La ripetibilità legata ai valori delle uova per grammo di feci era di 0,23.
112
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
IDENTIFICAZIONE DEGLI OSPITI INTERMEDI DI MUELLERIUS CAPILLARIS (MUELLER,
1889) IN SARDEGNA E LORO INFESTAZIONE SPERIMENTALE.
Polinas L., Chighine C., Sardo D., Scala A., Garippa G.
Dipartimento di Biologia Animale, Sezione di Parassitologia-Malattie Parassitarie, Università degli Studi di Sassari.
Summary
Muellerius capillaris determina nei piccoli ruminanti, ed in particolare nei caprini, danni alle performance produttive
e come gli altri protostrongilidi, necessita per completare il ciclo biologico di gasteropodi terresti dei generi Helicella,
Agriolimax, Euparipha, ecc.
Raccolte di molluschi, effettuate in pascoli esclusivamente riservati a capre, hanno evidenziato che in Sardegna Helix
aperta, H. aspersa, H. (Eubania) vermiculata, Rumina decollata, Helicella spp. e Murella spp. sono coinvolte nel ciclo
biologico di M. capillaris. L’intensità media di L2-L3 variava da 0,32 per gli esemplari giovani di Eubania vermiculata, a
1,53 per Helix aperta. Infestestazioni sperimentali atte a valutare la recettività e le modalità di sviluppo delle larve in Helix
aperta, H. (Eubania) vermiculata, Cyclostoma elogans e di Helicella spp., hanno permesso di rilevare valori di Intensità
Media (L2-L3) compresi tra 0,17 in Cyclostoma elogans e 4,09 in Helicella spp.. Infine gli A A hanno evidenziato che il picco
massimo di eliminazione larvale (L3) si ha a 18 gg. dalla morte dei molluschi.
Introduzione
Muellerius capillaris, è uno dei protostrongilidi responsabili della broncopolmonite verminosa dei piccoli ruminanti,
causa danni alle performance produttive e necessita per completare il ciclo biologico di gasteropodi terresti dei generi
Helicella, Agriolimax, Euparipha, ecc.. (Ambrosi M., 1995). In Sardegna è stato e riscontrato nel 21,3% degli ovini (Scala
et al., 2000) e nel 40,6% delle aziende ovine (Pietrobelli et al, 2002),
Numerose le ricerche condotte sull’argomento, soprattutto in Francia e Spagna, mentre in Italia risulta un’unica indagine
effettuata in Abruzzo e Puglia (Scaramozzino et al., 1992).
In considerazione dell’assenza di notizie sulle specie di molluschi coinvolti nel ciclo biologico dei protostrongilidi
nella nostra isola, e nell’ambito di ricerche atte a migliorare le conoscenze sulla biologia di questi parassiti finalizzate
all’individuazione di idonee misure di profilassi, di seguito vengono riferiti i primi risultati di indagini volte ad identificare
gli ospiti intermedi di M. capillaris in Sardegna.
Materiali e metodi
Da un allevamento di circa 150 capre, situato nel Comune di Ittiri (SS), risultato, da indagini all’uopo effettuate,
particolarmente infestato da Muellerius capillaris, sono stati prelevati pool di feci e contemporaneamente effettuate
raccolte di gasteropodi terrestri.
Sui campioni fecali è stato eseguito un esame copromicroscopico quali-quantitativo per la ricerca e la conta delle larve L1
utilizzando la metodica di Bearmann, l’identificazione dei generi è stata fatta utilizzando le chiavi riportate da Euzeby
(1982).
I gasteropodi raccolti sono stati suddivisi per generi e quando possibile per specie e ulteriormente in giovani ed adulti.
I molluschi così suddivisi sono stati sacrificati per annegamento in acqua e sottoposti ad esame parassitologico secondo
le seguenti metodiche:
a) sezionamento e successiva compressione: esame microscopico di sezioni di piedi dei molluschi compressi tra due vetrini
portaoggetti;
b) digestione artificiale semplice: sminuzzamento separato del piede e dell’addome, che vengono collocati in appositi
rettangoli di garza e posti in provettoni da 50ml contenenti una soluzione cloridro-peptica (acqua distillata, 100ml; HCl
al 35%, 2 ml; pepsina 1:2,5, 2 gr)
Il tutto è stato posto in termostato 37° C per 15-16h, la sospensione così ottenuta viene centrifugata a 2000 giri per 10
minuti. Esame del sedimento al microscopio conta e classificazione delle larve utilizzando le chiavi proposte da Rose
(1947) e Cabaret (1981).
Durante lo stesso periodo da terreni non pascolati da ovini e caprini, sono stati raccolti 516 gasteropodi terresti. (tab 1)
I gasteropodi sono stati divisi per sito di raccolta, per generi e dove è stato possibile per specie ed ancora in giovani ed adulti.
Nonostante si sia ritenuta l’assenza di infestione naturale da larve di protostrongilidi si è preferito, come ulteriore garanzia,
controllare il 10% di ogni campione, utilizzando la digestione artificiale semplice.
Tab. 1. Gasteropodi inseriti nella prova
N. camp Specie
1
2
3
4
5
6
7
8
N. ind. Rac
Eubania vermiculata adulti
Helicella spp.
Eubania vermiculata giovani
Cyclostoma elegans
Helicella spp.
Eubania vermiculata adulti
Eubania vermiculata giovani
Helix aperta
Tot.
4
95
18
37
281
9
71
1
516
N. ind ins.
nella prova
3
85
16
34
253
8
60
1
460
I molluschi rimasti sono stati collocati in 4 gabbie seguendo la disposizione riassunta nella tabella n. 2.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
113
Tab. 2. Suddivisione dei gasteropodi nelle gabbie
Specie
Gabbia 1 Helicella spp.
Tot.
Gabbia 2 Cyclostoma elegans
Tot.
Gabbia 3 Eubania vermiculata adulti
Helicella spp.
Eubania vermiculata giovani
Tot.
Gabbia 4 Eubania vermiculata adulti
Eubania vermiculata giovani
Helix aperta
Tot.
N. ind.
253
253
34
34
3
85
16
104
8
60
1
69
Per la successiva infestazione dei gasteropodi, sono state utilizzate le feci prelevate dall’allevamento precedentemente
descritto.
Sul materiale fecale prima di essere introdotto nelle gabbie, è stato calcolato l.p.g. (1100 larve per grammo), utilizzando la
metodica di Bearmann, ed in seguito le feci sono state suddivise in quattro aliquote da 30gr. ciascuna, sono state sciolte con
acqua e fatte sedimentare, e il sedimento è stato versato sul fondo delle gabbie, introducendo così circa 33.000 L1.
Le gabbie sono state tenute per tutta la durata della prova all’aperto.
Dal 15° giorno dall’infestazione in poi sono stati sacrificati periodicamente gruppi di gasteropodi.
I molluschi dopo essere stati sacrificati, sono stati sottoposti ad esame parassitologico secondo le metodiche precedentemente
descritte (sezionamento e compressione e digestione artificiale semplice).
Inoltre due gruppi composti uno da 11 e uno da 12 esemplari di Helicella spp., appartenenti rispettivamente al gruppo
n. 2 e n. 5, dopo essere stati sacrificati, sono stati messi a macerare in acqua, l’acqua di macerazione è stata allontanata ed
esaminata ogni tre giorni, e sostituita con altra fino alla completa disgregazione dei molluschi.
In ultimo sono stati valutati: le specie di gasteropodi sensibili, il grado di infestazione sia in natura che indotta sperimentalmente
ed inoltre sono stati valutati i tempi di “rilascio” delle larve infestanti L3 dopo la morte dei gasteropodi.
Risultati – Le raccolte dei molluschi, effettuate su terreni frequentati esclusivamente da caprini, hanno evidenziato che
Helix aperta, H. aspersa, H. (Eubania) vermiculata, Rumina decollata, Helicella spp. e Murella spp. sono coinvolte nel ciclo
biologico di M. capillaris.
Infatti gli esami copromicroscopici hanno rilevato che sia i caprini oggetto dell’indagine erano massivamente infestati da
Muellerius capillaris (1.100 l.p.g.), che i gasteropodi raccolti, ad eccezione dei quattro adulti di Eubania vermiculata, erano
portatori di larve L2-L3.
La digestione peptidica semplice, ha permesso di raccogliere da 146 gasteropodi 108 larve M. capillaris e precisamente:
91 dal piede e 17 dall’addome. L’intensità media riscontrata variava da 0,32 larve per gli esemplari giovani di Eubania
vermiculata, a 1,53 per Helix aperta (Tab. 3).
Tab. 3. Gasteropodi raccolti in natura e loro grado di infestazione
N. Larve raccolte
Specie
Helix aperta giovani
Helix aspersa giovani
Eubania vermiculata giovani
Eubania vermiculata adulti
Helicella spp.
Rumina decollata
Murella spp.
Totale
N. ind.
26
56
28
4
14
5
13
146
Piede
30
37
7
0
3
5
9
91
addome
10
2
2
0
3
0
0
17
tot
40
39
9
0
6
5
9
108
IM
1,53
0,69
0,32
0
0,42
1
0,69
0,7
Infestestazioni sperimentali hanno permesso di rilevare che Helix aperta, H. (Eubania) vermiculata, Cyclostoma elogans
e di Helicella spp. sono recettive a M. capillaris. Nei gasteropodi sperimentalmente infestati (n. 460) sono state
complessivamente repertate 550 larve di 2° e 3° stadio di M. capillaris, n.521 nel piede e n.29 nell’addome (IM 1,19).
Da rilevare che, almeno nelle condizioni della prova, la suscettibilità all’infestazione sembra risultare influenzata da
diversi fattori come ad esempio la densità dei gasteropodi.
L’esame della tabella 4 mostra come l’IM di M. capillaris in Helicella spp., sia inversamente proporzionale al numero di
soggetti presenti, infatti a fronte di un’IM di 0,22 della gabbia n.1 (253 esemplari) quella della n. 3 risulta nettamente
superiore (4,09).
Inoltre a differenza di quanto riportato in Bibliografia Cyclostoma elogans, almeno a livello sperimentale, risulta suscettibile
114
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ad essere parassitato da Muellerius capillaris.
Tab. 4 risultati infestazione sperimentale
Specie
Gabbia 1
Gabbia 2
Helicella spp.
Cyclostoma elegans
Gabbia 3
Eubania vermiculata adulti
Helicella spp.
Eubania vermiculata giovani
Gabbia 4
Eubania vermiculata adulti
Eubania vermiculata giovani
Helix aperta
Tot
N. ind.
253
Tot.
253
34
Tot.
34
3
85
16
Tot.
104
8
60
1
Tot.
69
460
Piede
56
addome
1
3
3
8
324
30
0
24
0
2
82
16
0
1
0
521
29
Tot
57
57
6
6
8
348
30
386
2
83
16
101
550
I.M.
0,22
0,22
0,17
0,17
2,6
4,09
1,8
3,71
0,25
1,38
1,46
1,19
Infine dall’esame della tabella 5 si evidenzia che il picco massimo di eliminazione larvale (L3) si ha a 18 gg dalla morte
dei molluschi.
Tab 5 Durata liberazione delle larve (L3) dopo la morte dei molluschi
n.
20
larve
rac co15
lte
Cp 2
10
5
0
Cp 5
0° 3° 6° 10° 14° 18° 21° 24° 27° 30° 33° 37°
giorni
Considerazioni conclusive - Le indagini condotte hanno permesso di stabilire per la prima volta in Sardegna che
Helix aperta, H. aspersa, H. (Eubania) vermiculata, Rumina decollata, Helicella spp. e Murella spp. sono ospiti intermedi
di M.capillaris. Inoltre almeno in condizioni sperimentali C.elogans risulta potenziale ospite intermedio di detto
protostongilide.
Il piede non deve essere considerato l’unico sito di localizzazione di larve di M.capillaris, infatti alcune larve sono state
riscontrate anche nell’addome
Da rilevare inoltre che in condizioni naturali i giovani esemplari risultano portatori di un numero maggiore di larve
infestanti (L3) rispetto agli adulti e che pertanto, in considerazione delle ridotte dimensioni, della fragilità del guscio e
della loro localizzazione sulle piante pabulari possono assumere un importante ruolo nell’epidemiologia di M. capillaris.
Tra le due metodiche utilizzate (sezionamento e compressione e digestione artificiale semplice), la seconda è risultata essere la
più efficace, sia per la semplicità nell’esecuzione che per la sensibilità, al contrario della prima.
Lavoro eseguito con fondi MURST legge 488/92
Bibliografia
Ambrosi M. Parassitologia Zootecnica. Edagricole, Bologna (1995) - Euzeby J. Diagnostic Experimental des Helminthoses Animales.
Travaux Pratiques d’Helminthologie Veterinaire. Edition “Information Thecniques des Services Veterinaires, Ministere de L’Agricolture,
Paris (1982). - Scaramozzino P., Fasanella A., Giangaspero A., Puccini V. (1992), Parassitologia, 34 (1): 26-27. Scala A., Pintori A., Uras
P., Marrosu R., Parassitologia 42 (suppl. 1) 91, 2000 - Pietrobelli M,. Scala A:, Garippa G. Progetto Giasone, Regione Sardegna, 2002
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
115
ANALISI DELLA DIFFUSIONE DELLA NEOSPOROSI MEDIANTE IFI E PCR IN
ALLEVAMENTI OVINI E CAPRINI DELLA SARDEGNA
Madau L.1, Tanda A.1, Fiori S.2, Porcu R.1, Chisu V.1, Sanna G.1, Tola S. 1, Masala G.1
1: Istituto Zooprofilattico Sperimentale della Sardegna “G. Pegreffi” – Sassari
2: Associazione Regionale Allevatori della Sardegna
Riassunto
La neosporosi, frequentemente diagnosticata nella specie bovina in varie parti del mondo, si manifesta nelle aziende in
forma endemica od epidemica. L’infezione naturale da Neospora caninum è nota anche in altre specie animali, quali la
pecora, la capra ed il cane.
Scopo del nostro lavoro è valutare la diffusione della neosporosi negli allevamenti della Sardegna, ricercando la
presenza del parassita mediante PCR su placente ed organi di feti ovini e caprini, e studiando la sieroprevalenza tramite
immunofluorescenza indiretta su emosieri prelevati in azienda.
Nel periodo 1999 – 2002 sono stati analizzati, per la ricerca di Neospora caninum, 2421 organi fetali ovini ed 356 caprini
( placenta, cervello, muscolo, fegato, milza e IV stomaco) provenienti da 964 allevamenti, distribuiti sull’intero territorio
regionale. Negli allevamenti in cui venivano riscontrate positività in PCR per Neospora caninum, è stata eseguita una visita
aziendale durante la quale venivano prelevati tutti i capi presenti, compresi i cani.
I sieri sono stati analizzati in IFI per evidenziare la risposta anticorpale.
I risultati ottenuti indicano una presenza sporadica del parassita ed una bassa sieroprevalenza.
Introduzione
Neospora caninum è un protozoo appartenente al Phylum Apicomplexa, famiglia Sporozoasidae. Presenta un ciclo biologico
coccidio simile, caratterizzato da fasi schizogoniche nell’ospite intermedio (rappresentato da bovino, cavallo, pecora, capra,
cane, ecc) (Dubey,1996), una fase gametogonica nell’intestino del cane, riconosciuto come ospite definitivo, ed una fase
di sporulazione nell’ambiente esterno, che porta alla formazione di oocisti contenenti due sporocisti, ciascuna con quattro
sporozoiti (McAllister et al, 1998; Lindsay et al, 1999).
La trasmissione all’ospite intermedio avviene in larga prevalenza per via verticale, transplacentare (Dubey, 1999), mentre
appare di minor importanza la quota di infezione postatale, ad opera di oocisti sporulate nell’ambiente o di tachizoiti
contenuti nelle lochiazioni di animali che hanno abortito a seguito dell’infezione.
Descritta inizialmente nel cane (Bjerkas et al, 1984), è stata poi riconosciuta come importante causa di aborto, natimortalità
e debolezza neonatale nel bovino (Dubey, 1996). E’ stato successivamente osservato che numerosi altri animali, tra cui
pecora e capra, sono suscettibili all’infezione, sia naturale che sperimentale, e le lesioni messe in evidenza su feti e placente
sono simili a quelle osservate nella specie bovina (McAllister et al, 1996; Buxton et al, 1997). Scopo del nostro lavoro è
valutare la diffusione della Neosporosi negli allevamenti della Sardegna, ricercando la presenza del parassita mediante PCR
su placente e feti ovini e caprini (Buxton et al.1998), e studiando la sieroprevalenza in Immunofluorescenza Indiretta su
emosieri prelevati in aziende in cui si erano riscontrati organi positivi in PCR.
Materiale e metodi
Campioni clinici e collezione organi
Nel corso degli anni 1999-2002 sono stati collezionati 145 placente e 2632 organi di feti abortiti, ovini e caprini, pervenuti
al nostro Istituto. Da ciascuno dei feti sono stati prelevati: fegato, IV stomaco, milza, cervello e muscolo. Organi e placente
sono stati lavati più volte con un buffer salino (PBS; 0,1 M phosphate; 0,33 M NaCl; pH 7,2) addizionato con 1.000.000
UI/L di penicillina (Pharmacia-Upjohn) e streptomicina (Bristol-Myers Sqibb), e successivamente digeriti con tripsina
(Difco, Detroit, MI,USA) al 2% per tre ore a 37° C. Per il cervello è stata utilizzata la tripsina allo 0,6%.
Dopo filtrazione con garza sterile i campioni sono stati centrifugati a 3500 rpm per 10’, lavati tre volte in PBS, risospesi
in siero fetale bovino (FBS, Gibco BRL) e dimetilsulfossido (DMSO, Sigma Chemical Co) al 10%, aliquotati e congelati
a – 80° C fino al momento dell’uso.
MUSCOLO
CAMPIONI
OVINI
496
CAMPIONI
CAPRINI
80
FEGATO
479
79
IV STOMACO
420
63
MILZA
394
41
CERVELLO
499
81
PLACENTA
133
12
TOTALE
2421
356
ORGANO
Tab.1.Totale numero di organi ovini e caprini analizzati nel periodo 1999-2002
Ricerca di neospora caninum nei tessuti con polymerase chain reaction
Il DNA di Neospora caninum è stato estratto dai campioni clinici totali (2421 ovini e 356 caprini) mediante l’uso di
116
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Dneasy Tissue Kit (Quiagen, GmbH). Il DNA genomico di Neospora caninum (BPA1, ATCC 75710) è stato estratto
con fenolo-cloroformio-isoamil alcool secondo la metodica descritta da Ausubel et al. (1992), utilizzato come controllo
positivo nella reazione di amplificazione in PCR.
Si è proceduto alla ricerca del Dna di Neospora caninum mediante una nested PCR, utilizzando come target la sequenza
intergenica ITS1 dell’ rRNA, ideale perché ripetuta e altamente conservata.
Per la reazione di PCR sono stati utilizzati quattro primers (NF1; NS2; NR1; SR1), che amplificano un frammento di 146
bp, secondo quanto descritto da Ellis et al. (1999).
La PCR è stata eseguita in un GeneAmp PCR System 9700 (Applied Biosystem).
Aziende problema
A seguito di un riscontro positivo per Neospora caninum in PCR, è stata eseguita una visita aziendale durante la quale, oltre
alla raccolta dell’anamnesi, venivano eseguiti prelievi di sangue dalla vena giugulare all’intero gregge, al fine di monitorare il
movimento anticorpale.
Sono stati esaminati 1722 sieri ovini e 290 sieri caprini provenienti da 6 allevamenti “problema”. Laddove possibile, sono
stati prelevati campioni di sangue dei cani presenti in azienda.
ALLEVAMENTO
Emosieri OVINI
Emosieri CAPRINI
Emosieri CANI
1
-
290
-
2
314
-
6
3
172
-
6
4
608
-
24
5
250
-
2
6
378
-
1
TOTALE
1722
290
39
Tab.2. Aziende problema in cui si è eseguito il prelievo di sangue su tutti i capi presenti.
Ceppo, linea cellulare, condizioni di crescita e preparazione dell’antigene
L’antigene per l’esecuzione dell’immunofluorescenza indiretta è stato ottenuto utilizzando una linea cellulare fibroblastica
(BS CL86 Vero) infettata con Neospora caninum ( BPA1, ATCC 75710). La cultura infetta è stata amplificata e fatta
crescere in fiasche da 25cm2 (Corning, NY) contenenti Minimum Essential Medium (MEM, Gibco) addizionato con siero
equino al 10% (Horse Serum, Gibco) a 37° C con 5% di CO2.
A seguito della lisi del monostrato cellulare i tachizoiti sono stati raccolti e centrifugati a 1200 x g per 15 minuti, e lavati
2 volte con un buffer salino (PBS; 0,1 M phosphate; 0,33 M NaCl; pH 7,2). Il pellet finale è stato risospeso in PBS e
dispensato, nella quantità di 10 µl per pozzetto, in vetrini da 24 pozzetti (Teflon –coated slides, Immuno-Cell Int). I vetrini
sono stati fatti asciugare per 1 ora, fissati con acetone freddo per 15 min. e stoccati a – 20° C fino al momento dell’uso.
Immunofluorescenza indiretta
I sieri prelevati nelle aziende problema sono stati diluiti 1: 200 in PBS per la ricerca delle IgG per gli ovini e i caprini, e 1:50 per
i cani; un’aliquota di 10 µl di ciascun siero è stata dispensata in ogni pozzetto; i vetrini sono stati posti ad incubare per 30 minuti
a 37° C in camera umida. Dopo una fase di lavaggio in PBS, sono stati incubati per 30 min. a 37°C con le FITC coniugate
rabbit anti-goat, rabbit anti-sheep e goat anti-dog (KPL, Gaithersburg, MD) diluite 1:100 in Blu di Evans, ed esaminati al
microscopio a fluorescenza. I campioni positivi sono stati successivamente titolati con diluizioni scalari fino a 1: 1600 per gli ovini
e i caprini e 1:400 per i cani. In ogni vetrino sono stati inclusi anche i controlli positivo e negativo.
Risultati
Su 2777 campioni esaminati in PCR , solo 11 organi ovini (0,4%) e 8 caprini (0,3%) sono risultati positivi per Neospora
caninum (tabella 3).
Il cervello è l’organo in cui più volte è stato messo in evidenza il DNA di Neospora caninum (6 campioni ovini, 4 campioni caprini)
come precedentemente descritto da Buxton et al (1998) in un’infezione sperimentale nelle pecore. Il protozoo è stato anche evidenziato in
due IV stomaci, una placenta e due fegati ovini. Nella specie caprina il DNA di N. caninum è stato inoltre evidenziato in due campioni
di tessuto muscolare e due fegati. Non è stata riscontrata invece alcuna positività a carico della milza.
ORGANO
MUSCOLO
FEGATO
IV STOMACO
MILZA
CERVELLO
PLACENTA
TOTALE
CAMPIONI OVINI
POSITIVI
2
2
6
1
11 (0,4%)
CAMPIONI CAPRINI
POSITIVI
2
2
4
8 (0,3%)
Tab. 3. Organi ovini e caprini risultati positivi in PCR
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
117
Anticorpi nei confronti di N. caninum sono stati reperiti in tutte le sei aziende monitorate.
La sieropositività varia dall’1,97% al 57,2% nella specie ovina, con una media del 15,61%, mentre si aggira intorno al 20% a
carico dell’unico allevamento caprino sottoposto a controllo.
La presenza di anticorpi specifici nei sieri ovini e caprini è indice di sicura esposizione verso Neospora caninum, in quanto non
esiste cross-reattività con altri protozoi (Dubey et al, 1996; Dubey et al, 2002). La grande variabilità dei valori di sieroprevalenza
è probabilmente legata al fatto che i prelievi sono stati eseguiti a distanza di tempo differente rispetto al momento dell’aborto;
quindi, considerato che la quantità di anticorpi si dimezza ogni quindici giorni, potremmo aver eseguito i prelievi ematici quando
il titolo anticorpale era già decaduto.
E’ stato possibile fare i prelievi ai cani in cinque aziende problema, su alcuni cani presenti non è stato possibile eseguire i prelievi
perchè mordaci e non contenibili. La sieropositività varia dal 12,5% al 100%, con una media del 45,7%.
Allevamento
Soggetti esaminati
Ovini positivi Ovini dubbi Caprini positivi Caprini dubbi
1
290
-
-
60 (20,68%)
56 (19,31%)
2
314
18 (5,73%)
2 (0,63%)
-
-
3
172
19 (11,04%)
-
-
-
4
608
12 (1,97%)
8 (1,31%)
-
-
5
250
143 (57,2%)
34 (13,6%)
-
-
6
378
8 (2,11%)
11 (2,91%)
-
-
Tab. 4. Sieroprevalenza per N. caninum nelle aziende problema su ovini e caprini
ALLEVAMENTO
1
2
3
4
5
6
Cani esaminati
6
6
24
2
1
Cani positivi
2 (33%)
5 (83%)
3 (12,5%)
neg
1 (100%)
Tabella 5. Sieroprevalenza per N. caninum sui cani delle aziende problema.
Discussione e conclusioni
L’analisi dei risultati di attività del nostro Istituto evidenzia la sporadica presenza di Neospora caninum negli allevamenti ovini
e caprini della Sardegna.
L’accertamento diagnostico per neosporosi in PCR è entrato nel novero degli esami che vengono routinariamente eseguiti nel nostro
laboratorio per la ricerca di agenti infettivi e parassitari causa di aborto negli ovini e caprini.
Considerazioni di opportunità e praticità hanno favorito la scelta della PCR come metodica routinaria per la diagnosi diretta
dell’infezione in quanto l’esame può essere eseguito anche su campioni fetali congelati o in cattivo stato di conservazione, e consente
di disporre di un esito in tempi brevi.
Il rinvenimento del protozoo in azienda dovrebbe essere in ogni caso occasione di un controllo generale della situazione
igienica e manageriale, in particolare sarebbe opportuno avviare una attenta ricerca di possibili fattori di rischio o cause
scatenanti dell’episodio ed attuare gli eventuali interventi correttivi.
Il rilievo di sieropositività nei confronti di N. caninum fornisce certamente una buona indicazione diagnostica se i prelievi
vengono eseguiti in prossimità del fenomeno aborto. In particolare è consigliabile utilizzare l’esame sierologico per una
diagnosi aziendale piuttosto che limitarlo a singoli animali, e conviene prelevare campioni di sangue anche da soggetti non
coinvolti nell’episodio di aborto.
Da non sottovalutare la presenza sporadica di N. caninum, considerato che la trasmissione avviene prevalentemente per via
verticale, e può generare linee familiari già infette.
Il ruolo del cane nella trasmissione è stato peraltro accertato solo in laboratorio e non ancora verificato in situazioni di
campo. Rimane ancora da chiarire la possibilità di infezione tramite ingestione di altri stadi vitali infettanti del parassita da
fonti non identificate quali altre specie animali ospiti.
Al momento la combinazione della ricerca diretta del parassita e degli esami sierologici si è dimostrato una strategia utile
per identificare gli allevamenti infetti ed ha permesso di rivelare la presenza di N. caninum nelle aziende ovine e caprine
della nostra regione.
Sicuramente Neospora caninum non va annoverata tra i principali problemi ancora irrisolti degli allevamenti ovini e caprini
dell’isola, ma gioca un ruolo di corresponsabilità in allevamenti in cui esistono già altri problemi legati sia alla presenza di agenti
infettivi che al tipo di management.
Bibliografia
Dubey J.P., Lindsay D.S., 1996. A Review of Neospora caninum and neosporosis. Vet. Parasit. 67:1-59.
Lindsay D.S., Dubey J.P., Duncan, 1999. Confirmation that the dog is a definitive host for Neospora caninum. Vet. Parasit. 82: 327333.
McAllister, Dubey J.P., Lindsay D.S., Jolley,W.R., Willis, R.A., McGuire, A.M., 1998. Dogs are definitive hosts of Neospora caninum.
118
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Int.J. Paras. 28, 1473-1478.
McAllister M.M., McGuireA.M., Jolley, W.R., Lindsay, D.S., Trees, A.J., Stobart, R.H. 1996. Experimental neosporosis in pregnant
ewes and their offspring. Vet. Pathol. 33, 647-655.
Buxton, D., Maley, S.W., Thomson, K.M., Trees, A.J., Innes, E.A. 1997. Experimental infection of non-pregnant and pregnant sheep
with Neospora caninum. J. Comp. Pathol. 117: 1-16.
Buxton, D., Maley, S.W., Wright, S., Thomson, K.M., Rae, A.G., Innes, E.A.1998. The pathogenesis of experimental neosporosis in
pregnant sheep. J. Comp. Path. 118: 267-279.
Bjerkas, I., Mohn, S.F., Presthus, J. 1984. Unidentified cyst-forming sporozoon causing enchefalomyelitis and myositis in dogs. Z. Parasitenk.
70, 271-274.
Ellis, J.J., McMillan, D., Ryse, C., Payne, S., Kinson, R.T., Harper, P.A.W. 1999. Development of a single tube nested Polymerase
Chain Reaction assay for the detection of Neospora caninum DNA. Int. J. for Paras. 29: 1589-1596.
Dubey, J.P., Barr, B.C., Barta, J.R., Bjerkas, I., Bjorkman, C., Blagburn, B.L., Bowman, D.D., Buxton, D., Ellis, J.T., Gottstein, B.,
Hemphill, A., Hill, D.E., Howe, D.K., Jenkins, M.C., Kobayashi, Y., Koudela, B., Marsh, A.E., Mattson, J.G., McAllister, M.M., Modry’,
D., Omata, Y., Sibley, L.D., Speer, C.A., Trees, A.J., Uggla, A., Upton, S.J., Williams, D.J.L., Lindsay, D.S. 2002.Redescription of Neospora
caninum and its differentiation from related coccidia. Int. J.for Paras. 32 : 929-946.
Ausubel F.M., Brent R., KingstonR.E., Moore D.D., Seidan J.G., Smith A.A., StruhlK. Current protocolsa in molecular biology. 1992. Vol.
I. Wiley- Interscience, New York, NY.
Allevamento
Pos. Chlamydophila a.
Pos. Coxiella b.
1
2
3
4
5
6
34 (11,7%)
5 (1,59%)
2 (1,16%)
15 (2,46%)
3
2
13 (4,48%)
3 (0,95%)
4 (2,32%)
26 (4,27%)
135 (54%)
Da Fare
Allevamento
Feti abortiti
Organo positivo
Agente abortigeno
1
1
cervello
Neospora; toxoplasma
2
1
Cervello
Milza
Neospora; Toxoplasma
Toxoplasma
3
4
1
2
Feto intero
cervello
Neospora
Neospora; Toxoplasma
5
1
Cervello
IV Stomaco
Muscolo
Neospora
Neospora
Toxoplasma
6
1
Cervello
IV stomaco
Neospora
neospora
Allevamento
Pos. Toxoplasma IgG
Pos. Toxoplasma IgM
Pos. Neospora
1
125 (43,1%)
87 (30%)
60 (20,63%)
2
301 (95,85%)
Neg
18 (5,73%)
3
18 (10,46%)
Neg
19 (11,04%)
4
383 (62,99%)
247 (40,62%)
12 (1,97%)
5
141 (56,4%)
84 (33,6%)
143 (57,2%)
6
165 (43,65%)
176 (46,56%)
8 (2,11%)
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
119
EFFICACIA DELLA MOXIDECTINA IN FORMULAZIONE INIETTABILE E POUR -ON PER IL
CONTROLLO DELL’IPODERMOSI BOVINA IN BASILICATA
Lia R., 2Agostini A., 3G. Prestera, 1Otranto D.
1
Facoltà di Medicina Veterinaria, Valenzano (BA) Italy
2
Fort Dodge Animal Health S.p.A. Bologna, Italy
3
Associazione Provinciale Allevatori, Potenza Italy
1
Dipartimento di Sanità e Benessere degli Animali. Tel. +39 080 5443802/39 Strada Provinciale per
Casamassima Km 3 -70010 Valenzano (BA) Italy. e-mail: [email protected]
1
Riassunto
L’ipodermosi dei bovini è una miasi causata da larve di Hypoderma bovis e Hypoderma lineatum (Diptera, Oestridae).
In Italia la prevalenza oscilla tra il 3 e il 70%. In provincia di Potenza è stato eseguito un programma pilota per il
controllo dell’ipodermosi mediante trattamento di 9.939 bovini allevati allo stato brado e provenienti da 304 aziende
utilizzando una formulazione iniettabile all’1% (200 µg/Kg) e pour -on allo 0.5% (500 µg/ Kg) di moxidectina
(Cydectin® Fort Dodge Animal Health). L’efficacia del trattamento è stata verificata mediante esame parassitologico
pre- e post- trattamento; inoltre, su un gruppo di animali, è stato eseguito un test sierologico. La moxidectina ha
dimostrato un’efficacia del 99.9% e del 100% rispettivamente per la formulazione pour-on e iniettabile.
Introduzione
L’ipodermosi dei bovini è una miasi degli organi interni, causata da larve di Hypoderma bovis e Hypoderma lineatum
(Diptera, Oestridae), caratterizzata dalla presenza di noduli sottocutanei che emergono, nella regione dorso-lombare degli
animali, durante i mesi primaverili ed estivi. I danni arrecati alle produzioni zootecniche dei bovini da questa patologia
sono ingenti (ridotto accrescimento, riduzione delle produzioni di latte e della qualità delle pelli).
L’ipodermosi è diffusa in molti Paesi dell’emisfero settentrionale: Canada (Colwell, 1992), U.S.A. (Scholl, 1998) ed Europa
(O’Brien, 1998). Nei Paesi che si affacciano nel bacino del Mediterraneo è segnalata in: Albania (Tagari e Manehasa, 1973),
Algeria (Benakla et al., 1998), Libia (Beesley e Gabaj, 1991), Marocco (Dakkar et al., 1981) e Tunisia (Jaballah, 1983).
Nonostante questa patologia sia diffusa in Italia, non sono mai stati avviati piani di eradicazione a livello nazionale. I primi
tentativi di controllo dell’ipodermosi in Italia risalgono agli anni ‘60-70, quando furono avviate sporadiche campagne
di profilassi in Puglia (Nardi e Lellis, 1959), e su base regionale in Trentino Alto Adige (Leinati et al., 1971) e Sardegna
(Ruatti et al., 1971). Solo successivamente alcune regioni hanno continuato ad attuare misure di controllo nei confronti
dell’ipodermosi spesso in maniera sporadica e occasionale.
In diversi Paesi europei, il controllo dell’ipodermosi è stato da anni avviato a livello nazionale e in alcuni Paesi (Gran
Bretagna, Irlanda, Repubblica Ceca, Repubblica Slovacca, Paesi Bassi, la maggior parte delle regioni della Francia) la
prevalenza dell’infestazione è attualmente inferiore allo 0,5%.
In Italia l’avvio dei programmi di controllo sono in notevole ritardo, sia sul piano della conoscenza della reale diffusione di
questa patologia sul territorio, ma anche sul piano legislativo regionale e nazionale. Ciononostante l’ipodermosi bovina è
una malattia “diffusiva” inserita nell’Art. 1 del Regolamento di Polizia Veterinaria, quindi, soggetta a denuncia obbligatoria
(D.P.R. 320 del 08-02-1957, suppl. G.U. 24-06-1954 n° 142).
I progetti europei denominati COST 811 prima e COST 833 dopo, si sono proposti di affrontare in maniera coordinata
il controllo dell’ipodermosi stabilendo linee di intervento comuni, con particolare riferimento ai sistemi di rilevamento,
allo studio dell’epidemiologia e ai trattamenti (Boulard, 1997). In passato, il trattamento sistematico con avermectine
(ivermectina e doramectina) ha determinato il successo nel controllo/eradicazione dell’infestazione.
Recentemente, la moxidectina è stata impiegata per il controllo dell’ipodermosi bovina in diversi Paesi: Algeria (Benakhla
et al., 1998), Belgio (Losson and Lonneux, 1993 a, b; Lonneux e Losson 1994), Canada (Colwell et al., 1997), Francia (Le
Stang et al., 1995), Libia (Beesley e Gabaj, 1991), Olanda (Sol et al., 1994) e U.S.A. (Scholl et al. 1992).
Questo studio è stato condotto con lo scopo di confermare in condizioni di campo, su larga scala, l’efficacia della
moxidectina (Cydectin® Fort Dodge Animal Health) in formulazione iniettabile all’1% e pour -on allo 0,5%. Il programma
per il controllo dell’ipodermosi è stato svolto su bovini autoctoni infestati in condizioni naturali nella provincia di Potenza
(Basilicata, Sud-Italia).
Materiali e metodi
Il territorio oggetto di questa indagine ricade interamente nella provincia di Potenza e si estende per la maggior parte sulla
dorsale dell’Appennino Lucano; l’area è prevalentemente montuosa con estese superfici di bosco, e nella zona collinare,
ampi pascoli naturali assicurano l’alimento agli animali.
Il patrimonio zootecnico della Regione Basilicata ammonta a 86.756 bovini, circa 59.621 capi sono bovini da carne e
39.000 capi sono di razza Podolica o suoi derivati, e di questi, 17.691 sono distribuiti nella provincia di Potenza in 492
aziende.
La prova è stata condotta da Gennaio 2000 a Giugno 2001 su 9.939 bovini appartenenti a 304 aziende presenti in
42 comuni. Gli allevamenti, omogeneamente distribuiti sul territorio, erano così distribuiti: 121 allevamenti situati ad
altitudine compresa tra 300 e 700 m (sul livello del mare), 159 allevamenti situati ad altitudine compresa tra 700 e 1200
m s.l.m. e 24 allevamenti situati ad altitudine oltre i 1200 m s.l.m.
120
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Nella zona in esame è stata stimata una prevalenza di ipodermosi del 70% degli allevamenti di bovini di razza Podolica.
Nel periodo Gennaio-Giugno 2000 sulla base della distribuzione territoriale sono state monitorate tutte le aziende e tutti
i capi presenti. E’ stato eseguito un primo controllo parassitologico mediante palpazione del dorso dei bovini. Dopo aver
effettuato il segnalamento (età e sesso), gli animali sono stati identificati (mediante targhetta auricolare), divisi in quattro
gruppi e trattati con le modalità riportate di seguito, nel periodo Ottobre-Novembre 2000.
Nei soggetti del gruppo 1, costituito da 2.989 capi (113 aziende), il trattamento è stato effettuato utilizzando una
formulazione pour -on di moxidectina (Cydectin® 0.5%) alla dose di 500 μg/Kg p.v.
Nei soggetti del gruppo 2, costituito da 5.803 capi (140 aziende), il trattamento è stato effettuato mediante iniezione
sottocutanea di moxidectina (Cydectin® 1%) alla dose di 200 μg/Kg p.v.
Nei soggetti del gruppo 3, costituito da 665 capi (27 aziende), il trattamento è stato effettuato mediante iniezione
sottocutanea di una microdose (0.1 ml per capo) di una formulazione iniettabile di moxidectina (Cydectin® 1%).
I soggetti del gruppo 4, costituito da 482 capi (24 aziende), non sono stati trattati ed hanno costituito il gruppo
controllo.
Tutti gli animali inclusi nella sperimentazione sono stati controllati a 1 ora e dopo 24 ore.
Sono state selezionate 42 aziende (18 del gruppo 1 e 24 del gruppo 4) e in ognuna di esse sono stati effettuati 5 prelievi di
campioni di sangue per effettuare la diagnosi sierologica. Sui sieri, conservati a -20°C fino al momento dell’esame, è stata
effettuata la ricerca degli anticorpi specifici mediante test immunoenzimatico (ELISA), impiegando l’Hypodermosis Elisa
kit (Vétoquinol Diagnostics, France) allestito con antigene estratto da larve di H. bovis.
Nel periodo Gennaio-Giugno 2001 su tutti i capi è stato eseguito un secondo controllo parassitologico, per rilevare la
presenza dei noduli di Hypoderma spp.
Durante il secondo controllo parassitologico le larve presenti sono state raccolte, conservate in alcool e successivamente
identificate utilizzando le chiavi di identificazione di Zumpt (1965) e di James (1947).
Risultati
Durante il primo controllo parassitologico (prima del trattamento) l’esame clinico svolto ha rilevato la presenza di noduli
in 5.502 animali (43.27%) distribuiti in 338 aziende (68.6%) sulle 492 esaminate.
L’esame sierologico svolto su un totale di 210 sieri con la metodica ELISA ha rilevato il 99% di positività dei capi
esaminati.
Nessuno degli animali sottoposti al trattamento con moxidectina pour –on e per via sottocutanea ha manifestato reazioni
secondarie o effetti clinici collaterali al farmaco.
Al controllo parassitologico successivo al trattamento l’esame clinico ha rilevato nei bovini dei differenti gruppi i seguenti
risultati:
nei soggetti del gruppo 1 (trattamento pour –on) è stata osservata la presenza di 3 noduli in 2 animali (0.06%);
nei soggetti del gruppo 2 (trattamento per via sottocutanea) non sono comparsi noduli negli animali;
nei soggetti del gruppo 3 (trattato con microdose) è stata osservata la presenza di noduli in 437 animali (65.71%);
nei soggetti del gruppo 4 (gruppo controllo) è stata osservata la presenza di noduli in 154 bovini (31.95%).
In tabella n°1 sono riportati in dettaglio i dati relativi alla prevalenza ed alla positività riscontrata nei diversi gruppi. I noduli
emersi durante il secondo controllo clinico-parassitologico sono stati osservati dalla fine del mese di Gennaio fino alla metà
del mese di Giugno, con una intensità di noduli da 1 a 18 (media 9,89 ±4,76), il picco massimo di numero di noduli è
stato registrato tra fine Marzo e fine Maggio.
Durante il controllo parassitologico sono state
prelevate dai noduli della regione dorsale 36 larve, tutte di III stadio: 15, raccolte durante il periodo Gennaio-Aprile, sono
state identificate come H. lineatum, mentre 21 larve, raccolte durante il periodo Marzo-Giugno, sono state identificate
come H. bovis.
Discussione e conclusioni
La somministrazione della moxidectina pour –on e per via sottocutanea alla dose consigliata, è risultata altamente efficace
(rispettivamente del 99.9% e 100%) nel trattamento dell’ipodermosi bovina. In particolare, l’applicazione della formulazione
pour –on si è dimostrata di facile e pratico impiego.
Questo programma di controllo dell’ipodermosi mediante l’utilizzo della moxidectina ha contribuito a ridurre la prevalenza
dell’ipodermosi bovina sul territorio della regione oggetto dell’indagine.
Nei soggetti del gruppo 1, la presenza di 3 noduli in 2 animali (provenienti dalla stessa azienda), può essere spiegata dal
non corretto utilizzo dell’erogatore durante l’applicazione del medicamento, o da un sottodosaggio dovuto al non corretto
calcolo del peso del bovino. Questo in analogia all’attività che è strettamente dipendente dalla dose somministrata.
Negli animali del gruppo 2, la formulazione iniettabile di moxidectina alla dose di 200 μg/Kg p.v. ha dimostrato di
possedere un’efficacia pari al 100%.
Al contrario, il trattamento con microdose, non ha dato risultati soddisfacenti ed è stata registrata una percentuale di
positività del 65.71%.
Negli animali del gruppo controllo il 31,95% dei bovini hanno presentato noduli di ipoderma.
L’allevamento dei bovini in Basilicata rappresenta un settore importante per la zootecnia della regione ed è indispensabile portarlo
a standard produttivi più elevati. Un piano di trattamenti di durata triennale o quinquennale sarebbe importante per attuare
l’eradicazione di questa patologia che è tutt’oggi sottostimata nonostante i comprovati danni che essa causa alle produzioni.
Le linee guida di un programma di risanamento nei confronti dell’ipodermosi, devono definire la situazione epidemiologica
nella regione, informare gli enti e tutte le figure coinvolte nel programma, trattare con antiparassitari tutti gli animali
presenti e introdotti nella regione e monitorare costantemente i risultati ottenuti con prove sierologiche (ELISA). Gli
animali trattati dovrebbero essere controllati sierologicamente, utilizzando sia il sangue (Boulard, 1985; Puccini et al.,
1995) sia il latte (Otranto et al., 1999) al fine di sottoporre ad un nuovo trattamento i bovini sieropositivi finché in
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
121
tutta l’area non si registrino nuovi casi di ipodermosi. Inoltre occorrerebbe applicare i regolamenti di polizia sanitaria sui
movimenti di Introduzione e uscita degli animali dal territorio, e certificare l’avvenuto trattamento degli animali.
Per quanto riguarda l’Italia è assolutamente auspicabile che l’attenzione nei confronti di questa patologia aumenti e
che i trattamenti, oggi esclusivamente condotti su base volontaria da singoli allevatori, si trasformino in iniziative più
organizzate che coinvolgano tutti gli allevamenti e di conseguenza territori più ampi e geograficamente delimitati in modo
che gli interventi di chemioprofilassi in combinazione con rilievi sierologici ed epidemiologici ci permettano di realizzare
l’eradicazione su base nazionale dell’ipodermosi.
Tabella n°1. Risultati dell’esame clinico parassitologico sugli animali appartenenti ai diversi gruppi di
trattamento.
POUR –ON
INIETTABILE
MICRODOSE
GRUPPO CONTROLLO
TOTALE
Animali
esaminati
2.989
5.803
665
482
9.939
Animali negativi
Animali positivi
Percentuale
2.987
5.803
228
328
9346
2
0
437
154
593
0.06 %
65.71 %
31.95 %
5,96 %
Ringraziamenti
Si ringraziano i Direttori dell’Associazione Provinciale Allevatori di Potenza (Dott. G. Giuratrobocchetti) e di Matera
(Dott. A. Calbi) e tutti i colleghi veterinari dell’ Associazione che hanno operato in campo per la realizzazione del piano
di controllo.
Bibliografia
Beesley W.N., Gabaj M.M. (1991) New records for Rhipicephalus bursa, Boophilus microplus, B. decoloratus and Hypoderma lineatum
from Libya. Med. Vet. Entomol. 5 (2): 259-60.
Benakla A., Losson B., Lonneux J.F., Boulard C., Benouareth D. (1998) Comparative efficacy of different insecticides in the treatment
of cattle hypodermosis in north-eastern Algeria. Vet. Res. 29: 21-29.
Boulard C. (1985) Avantages de l’immunodiagnostic de l’hypodermose bovine établi par hémagglutination passive et par Elisa, a partir
du sérum et du lactosérum sur la numération des varons. Ann. Rech. Vet. 16 (4): 335-343.
Boulard C. (1997) History of cost action 811. In: Improvements in control measures for warble flies in livestock. COST 811. Tours,
France.
Colwell D. (1992) Cattle grubs biology and control. Pubblication n° 1880/E, Ottawa, Ontario, Communication Branch, Agricolture
Canada, 17.
Colwell D., Barin R.W., Lysyk T.J. (1997) Influence of parasiticide treatment on kinetics of antigen specific antibody responses in cattle
infested with Hypoderma lineatum (Diptera : Oestridae). Vet. Parasitol. 68, (1/2), 175-186.
Dakkar A. (1981) Valuer preventive de l’Ivermectine (Ivomec N.D.) contre l’hypodermose bovine. Resultates préliminaires.
Laboratoire de Parasitologie, Institut agronimiques et Vétérinaires Hassan II, Rabat.
Jaballah A. (1983) Contribution à l’ètude de l’hypodermose bovine dans la presque ile du Cap-Bon. Essai de traitement par
l’ivermectine. Thèse docteur Vètèrinaire, Tunisie. N° 171.
James M.T. (1947) The flies that cause myiasis in man United States Department of Agriculture. Miscelaneous publication n° 631.
Le Stang J.P., Cardinaud B., (1995) Efficacite de la moxidectine 1% injectable dans le traitement de l’hypodermose bovine. Bullettin
des G.T.V. 1-B-505; 55-57.
Leinati L., Oberosler R., Beber L. (1971) Cli. Vet. 94: 65-70.
Lonneux J.F., Losson B.J. (1994) The efficacy of moxidectin 0.5% pour-on against Hypoderma bovis in naturally infested cattle:
parasitological and serological data. Vet. Parasitol. 52: 313-320.
Losson B.J., Lonneux J.F. (1993a) Une estimation de l’activite remanente de la moxidectine 1% injectable contre Hypoderma spp. Ann.
Med. Vet. 137: 105-108.
Losson B.J., Lonneux J.F., (1993b) Activity of moxidectin 0.5% pour-on against Hypoderma bovis in naturally infested cattle. Proceeding
of COST 811 Improvement in the control methods for warble fly livestock. 39-47.
Nardi E., Lellis M. (1959) Vet. It. 10: 325-328.
O’Brien D. (1998) Warble fly prevalence in Eurepe, 1997 after Cost 811. Proceeding of COST 811 Improvement in the control
methods for warble fly livestock. 20-27.
Otranto D., Testini G., Sottili R., Capelli G., Puccini V. (1999) Screening of commercial milk samples using ELISA for immunoepidemiological evidence of infection by the cattle grub (Diptera: Oestridae).Vet. Parasitol. 3: 241-248.
Puccini V., Giangaspero A., Caringella M.P. (1995) Immunological response agasinst Hypoderma spp. in naturally infested cattle:
comparative study with different antigens. XI Meeting of European Working Group on Hypodermosis, Weybridge, Guilford. 157170.
Tagari V., Manehasa M. (1973) Disa te dthena mbi kriveliozen (Hipodermatozen) e dhive, demet qe shkakton ihe luftimi i saj.
Buletin I Shkencave Bujqesore, 12: 200-207.
Ruatti A., Huber H.O. (1971) L’ipodermosi bovina: esempio di lotta su vasta scala. Atti Soc. It. Buiatria. 3: 591-595.
Scholl P.J., Guillot F.S., Wang G.T. (1992) Moxidectin: Systemic activity against common cattle grubs (Hypoderma lineatum) (Diptera:
Oestridae) and Trichostrongyle nematodes in cattle. Vet. Parasitol. 41: 203-209.
Sol J., Sampimon O.C. (1994) Treatment of L3 larvae of the warble fly with moxidectin 0.5% pour-on. Proceeding of COST 811
Improvement in the control methods for warble fly in cattle and goats. 141-142.
Zumpt F. (1965) Myiasis in Man and Animals in the Old World. Butterworths, London.
122
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
EFFICACIA DI UN TRATTAMENTO DI ROUTINE CON IVERMECTINA O DORAMECTINA
IN BOVINI ALL’INGRASSO.
Stancampiano L*1., Bulgarelli M.*, Corradini D.*, Micagni G.**, Battelli G.*
*Alma Mater Studiorum Università di Bologna e **Azienda Sanitaria Locale di Reggio Emilia, Italia
Laura Stancampiano. DIPROVAL- Sez. Allevamenti Zootecnici, Via F.lli Rosselli 107, 42100 Coviolo (RE),
Italia.
Tel 0522.290625; fax 0522.290523; e-mail: [email protected]
1
Riassunto
Centodiciannove bovini da carne di età media 12 mesi importati dalla Francia nel periodo marzo-agosto 2003 sono
stati trattati, 3-4 settimane dopo l’arrivo, con ivermectina (n=38) o con doramectina (n=81) in soluzione iniettabile.
Esami coprologici (quantitativi solo per nematodi e cestodi), effettuati il giorno successivo all’arrivo e 8-10 settimane
dopo il trattamento, hanno evidenziato uova di Nematodirus spp. (Ne), altri strongili gastrointestinali (Sgi), Trichuris spp.,
Capillaria spp., cestodi (Ce), trematodi e oocisti di coccidi (Co). Al controllo post-trattamento, sono risultati inferiori
(p<0,05): i) le prevalenze per Ne (5,9% vs 16,0), Sgi (8,4% vs 60,5%), Ce (1,7% vs 7,6%) e Co (6,7% vs 61,3%); ii) il
numero di uova di Sgi per grammo di feci (media: 1,4 vs 40; massimo: 40 vs 300). Nessuna differenza significativa è stata
osservata tra animali trattati con ivermectina e con doramectina. La maggiore durata dell’azione antiparassitaria riportata
in letteratura per doramectina non sembra comportare una diversa efficacia del trattamento in condizioni di allevamento
intensivo. Il contesto ambientale, sfavorevole al ciclo biologico dei parassiti (condizioni igieniche, assenza di pascolo, ecc.),
probabilmente impedisce le reinfezioni.
Abstract
EFFICACY OF ONE ROUTINARY TREATMENT USING IVERMECTIN OR DORAMECTIN
IN FATTENING BEEF CATTLE.
One-hundred and nineteen beef cattle, 12 months of age on average, imported from France between March and August 2003
were treated with an injectable solution of ivermectin (No. 38) or doramectin (No. 81), 3-4 weeks after their arrival in Italy. Faecal
examinations (quantitative tests only for nematodes and tapeworms) were performed the day after the arrival of the animals and
were repeated 8-10 weeks after the treatment. Eggs of Nematodirus spp. (Ne), as well as of other gastrointestinal strongyles (Sgi),
Trichuris spp., Capillaria spp., tapeworms (Ta), trematodes, and oocysts of coccidia (Co) were detected. After the treatment,
the following data were lower (p<0.05) than the ones observed at the arrival: i) prevalence of Ne (5.9% vs 16.0), Sgi (8.4% vs
60.5%), Ta (1.7% vs 7.6%) e Co (6.7% vs 61.3%); ii) egg output per gram of faeces of Sgi (mean: 1,4 vs 40; maximum: 40 vs
300). No significant differences were found out between animals dosed with ivermectin and doramectin. The long-lasting action
reported for doramectin compared to ivermectin, doesn’t seem to influence the efficacy of the treatment. The intensive husbandry
conditions of fattening beef cattle in Italy, unsuitable for parasite cycles (hygienic conditions and management, absence of pasture,
etc.), would probably prevent reinfections.
Introduzione
A livello internazionale, i dati relativi alle parassitosi in bovini da carne allevati in stabulazione permanente risultano,
anche negli ultimi anni, estremamente scarsi. La maggior parte dei lavori riguardano animali da latte o allevati al pascolo,
quest’ultimo considerato il fattore di rischio per eccellenza per le principali parassitosi dei ruminanti (Ballweber et al.,
1997; Eddi et al., 1997; Williams et al., 1997; Epperson et al., 2001).
In Italia una certa attenzione verso le parassitosi bovine si è avuta nei confronti di quelle dell’apparato digerente di vacche
da latte o di animali allevati al pascolo. Inoltre, malgrado la maggior parte dei bovini da carne allevati in Italia sia importata
dall’estero ed in particolare dalla Francia (Ismea-Osservatorio latte, 2002) in letteratura i dati reperibili su animali importati
sono estremamente scarsi (Battelli et al, 1989; Genchi et al, 1997).
Le scarse informazioni sui parassiti presenti nei bovini all’ingrasso in Italia si riflettono in una mancanza di dati scientifici
relativi al controllo dei parassiti stessi. Tale controllo viene spesso effettuato con l’ausilio di farmaci la cui opportunità di
uso andrebbe confermata con prove effettuate nella specifica realtà degli allevamenti. In particolare per quanto riguarda
i lattoni macrociclici, gruppo di antiparassitari del quale fanno parte ivermectina e doramectina, le prove sperimentali
relative alla loro efficacia vengono effettuate in condizioni di elevata probabilità di reinfezione, solitamente al pascolo, od
utilizzando animali infettati sperimentalmente (Genchi et al., 1995; Ballweber et al., 1997; Eddi et al., 1997; Ranjan et al.,
1997; Williams et al, 1997). Tali condizioni sono estremamente diverse da quelle che si riscontrano nei tipici allevamenti
intensivi da carne in Italia. In condizioni di elevato rischio di infezione vengono solitamente riportati migliori risultati con
l’utilizzo della doramectina rispetto all’ivermectina, in particolare una maggiore durata dell’efficacia protettiva nei confronti
delle reinfezioni (Eddi et al., 1997; Ranjan et al., 1997).
Scopo del presente studio è stato quello di valutare l’efficacia dei trattamenti antiparassitari effettuati routinariamente in
allevamento in animali da carne importati dalla Francia e di confrontare l’efficacia dell’ivermectina e della doramectina
nelle condizioni di allevamento considerate.
Materiali e metodi
Lo studio è stato effettuato presso l’allevamento Bernolda, del Consorzio Carni Naturali di Novellara (Reggio Emilia).
Sono stati esaminati 119 bovini di razza Charolaise (n=89) e meticci (n=30) appartenenti a 6 diverse partite, 2 di maschi
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
123
(per un totale di 42 animali) e 4 di femmine (77 animali), importate dalla Francia nel periodo marzo-agosto 2002. Gli
animali erano di età compresa tra i 5 e i 18 mesi (media 12 mesi) e di peso medio pari a 350 kg. Dopo una prima fase di
ambientamento gli animali vengono permanentemente stabulati in box su pavimento di grigliato.
Il giorno successivo all’arrivo in allevamento sono stati prelevati campioni di feci individuali direttamente dall’ampolla
rettale.
Ciascun animale è stato sottoposto ad un trattamento antiparassitario, effettuato di routine in allevamento, 3-4 settimane
dopo l’arrivo, utilizzando ivermectina (IVOMEC®) o doramectina (DECTOMAX®) in soluzione iniettabile all’1%
sottocute, per 38 (23 maschi; 15 femmine) e 81 (19 maschi; 62 femmine) animali, rispettivamente. Il dosaggio è di 1
ml/50 kg peso-vivo. Agli animali, non pesati individualmente, sono stati somministrati 10 ml/capo.
Un secondo campionamento individuale di feci è stato effettuato dopo circa 9 settimane dal trattamento (59-70 giorni).
I campioni sono stati conservati a +4°C ed esaminati entro 2 gg, oppure congelati e scongelati a temperatura ambiente prima degli
esami parassitologici. Ciascun campione è stato sottoposto ad esame qualitativo per sedimentazione e flottazione utilizzando una
soluzione a p.s. 1500. I campioni positivi per nematodi o cestodi sono quindi stati sottoposti ad esame quantitativo con la camera
di McMaster per la conta del numero di uova per grammo di feci (UPG) utilizzando 5 g di feci sospesi in 30 ml di soluzione a
p.s. 1300 (soglia di sensibilità: 20 UPG).
L’elaborazione statistica dei risultati relativi alle prevalenze è stata effettuata utilizzando: a) test del Chi-quadrato o test della
probabilità esatta di Fisher per valutare differenze tra categorie (campioni indipendenti) (Siegel, 1980); b) test per il confronto delle
proporzioni per il paragone tra primo e secondo controllo (campioni dipendenti) (Armitage, 1971). L’elaborazione dei risultati
degli esami quantitativi, a causa della non normalità della distribuzione di frequenza delle UPG, è stata effettuata utilizzando i
seguenti test non parametrici (Siegel, 1980): a) test di analisi della varianza per ranghi di Kruskal-Wallis (campioni indipendenti);
b) test di Wilcoxon per il confronto tra primo e secondo controllo (campioni dipendenti); c) test di correlazione per ranghi di
Spearman.
Risultati
Sono state evidenziate oocisti di Coccidi ed uova dei seguenti parassiti: Strongili gastrointestinali (Sgi); Nematodirus
spp.; Trichuris spp.; Capillaria spp.; Cestodi; Paramphistomum spp; Dicrocoelium dendriticum; Fasciola hepatica. I risultati
relativi agli Sgi non comprendono i Nematodirus che, pur facendo parte dello stesso gruppo di parassiti, hanno uova
morfologicamente differenziabili.
I risultati degli esami qualitativi e quantitativi sono riportati rispettivamente in Tabella 1 e in Tabella 2.
1° controllo
P(%)
61,3
60,5
16,0
5,9
3,4
7,6
27,7
1,7
0
Parassita
Coccidi
Sgi
Nematodirus spp.
Trichuris spp.
Capillaria spp.
Cestodi
Paramphistomum spp.
D.dendriticum
F.hepatica
2° controllo
P(%)
6,7
8,4
5,9
0
0
1,7
36,1
1,7
1,7
variazione di P
tra 1° e 2° controllo
-89,0%
-86,1%
-63,2%
-100%
-100%
-77,8%
+30,3%
0%
+100%
Tabella 1-Risultati degli esami qualitativi: prevalenze (P) al 1° ed al 2°controllo.
Parassita
Sgi
Nematodirus spp.
Trichuris spp.
Capillaria spp.
Cestodi
m
40
0,6
1
0,6
6,6
1° controllo
d.s.
min-max
72,0
0-300
3,6
0-20
6,3
0-60
5,5
0-60
30,0
0-240
m.
1,4
0
0
0
3,2
2° controllo
d. s.
min-max
6,8
0-40
0
0
0
0
0
0
34,8
0-380
variazione di m
tra 1° e 2° controllo
-96,5%
-100%
-100%
-100%
-51,5%
Tabella 2-Risultati degli esami quantitativi: media (m), deviazione standard (d.s.), minimo e massimo (min-max)
del numero di UPG al 1° ed al 2°controllo.
Al 1°controllo non sono state rilevate differenze significative (di prevalenze o di UPG) dovute a sesso, razza e tipo di
trattamento cui sono successivamente stati sottoposti gli animali, né alcuna correlazione significativa tra intensità di
emissione di uova ed età degli animali (p>0,05).
Tra 1° e 2°controllo sono state rilevati cali significativi di prevalenza per Coccidi (p<0,01), Sgi (p<0,01), Nematodirus
(p<0,05), Cestodi (p<0,05) e un calo di intensità di emissione di uova per Sgi (p<0,01).
I risultati quali-quantitativi ottenuti considerando separatamente gli animali trattati con doramectina e con ivermectina
sono riportati in Tabella 3 ed in Tabella 4. Non è stata riscontrata nessuna differenza significativa al 2°controllo relativamente
al farmaco utilizzato (p>0,05). Il calo di intensità di emissione di uova di Sgi tra 1° e 2°controllo è risultato significativo
(p<0,01) anche considerando separatamente gli animali trattati con ivermectina e con doramectina. Nessuna correlazione
significativa è stata osservata tra intensità di emissione di uova al secondo prelievo ed età o intervallo trattamento-prelievo
(p>0,05)
124
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Parassita
P(%)
Ivermectina
variazione di P
tra 1° e 2° controllo
1°
2°
controllo controllo
P(%)
Doramectina
variazione di P
tra 1° e 2° controllo
1°
2°
controllo controllo
Coccidi
63,2
5,3
-91,6%
60,5
7,4
-87,8%
Sgi
60,5
10,5
-82,6%
60,5
7,4
-87,8%
Nematodirus spp.
7,9
0
-100%
19,7
0
-100%
Trichuris spp.
7,9
0
-100%
4,9
8,6
+75,5%
Capillaria spp.
5,3
0
-100%
2,5
0
-100%
Cestodi
5,3
0
-100%
8,6
2,5
-70,9%
Paramphistomum spp.
21,1
36,8
+74,4%
30,8
35,8
+16,2%
D.dendriticum
0
2,6
+100%
2,5
1,2
-52%
F.hepatica
0
0
/
0
2,5
+100%
Tabella 3–Confronto tra animali trattati con ivermectina e con doramectina. Prevalenze (P) al 1° ed al 2°controllo.
Parassita
m
Ivermectina
variazione di m
tra 1° e 2° controllo
1°
2°
controllo controllo
Sgi
Nematodirus spp.
Trichuris spp.
Capillaria spp.
Cestodi
30
0,6
0
1,6
3,2
2,2
0
0
0
0
m
Doramectina
variazione di m
tra 1° e 2° controllo
1°
2°
controllo controllo
-92,7%
-100%
/
-100%
-100%
44,6
0,8
1,4
0
8,2
1,0
0
0
0
4,6
-97,8%
-100%
-100%
/
-43,9%
Tabella 4– Confronto tra animali trattati con ivermectina e con doramectina. Medie del numero di UPG (m) al 1°
ed al 2°controllo.
Discussione
L’utilizzo di esami coprologici ha reso possibile seguire gli animali durante il ciclo produttivo senza interferire con il
management dell’allevamento. Queste analisi potrebbero non fornire una stima esatta dell’efficacia dei trattamenti, poiché
il numero di UPG non sempre si correla con il numero di parassiti presenti. In particolare l’efficacia di un antielmintico
potrebbe essere sovrastimata nel caso in cui il farmaco sopprima la fertilità dei parassiti. Poiché quest’ultima evenienza
si riscontra solitamente in occasione di trattamenti ravvicinati e nei giorni immediatamente successivi al trattamento
(Taylor et al., 2002) è improbabile che essa si sia verificata nel presente studio, considerato che l’antiparassitario è stato
somministrato una sola volta e che il controllo post-trattamento è stato effettuato circa 2 mesi dopo.
Sono state osservate diminuzioni significative di prevalenza per coccidi e cestodi malgrado ivermectina e doramectina non
siano efficaci nei confronti di questi parassiti. La drastica diminuzione di coccidi è da mettere in relazione sia allo sviluppo
di immunità nell’ospite all’aumentare dell’età, sia all’allontanamento delle feci, grazie alla stabulazione su grigliato, che
minimizza il rischio di sporulazione e assunzione di oocisti. Per quanto riguarda i cestodi, le condizioni ambientali e
l’alimentazione, prevalentemente a base di insilati e mangime, determinerebbero l’assenza di acari oribatidi, ospiti intermedi,
quindi della fonte di nuove infezioni; si assiste di conseguenza ad un calo di prevalenza dovuto alla mortalità naturale di
questi parassiti negli ospiti, mediata anche dalla resistenza che si instaura negli animali più adulti.
Per quanto riguarda l’efficacia del trattamento nei confronti dei nematodi, ed in particolare degli Sgi, il confronto con i dati
riportati da altri autori non è semplice, in quanto tali dati si riferiscono a situazioni sperimentali che differiscono in molti
aspetti da quelle del presente studio.
Genchi et al. (1995) riportano un’efficacia della doramectina iniettabile, in bovini infettati sperimentalmente con Sgi, del
99,8-99,9%, sia sulle forme adulte sia sulle forme larvali, al 14° giorno dal trattamento. L’efficacia inferiore riscontrata
nel presente lavoro potrebbe essere dovuta alla resistenza di alcuni strongili (adulti o larve) al trattamento, oppure ad una
minima fonte di reinfezione nel periodo successivo al trattamento.
Eddi et al. (1997) riportano in bovini al pascolo un’efficacia, a 56 giorni dal trattamento, del 98% per doramectina e del
77% per ivermectina, sempre riferita al numero effettivo di Sgi (larve e adulti). Tale differenza non veniva rilevata dagli
esami coprologici che risultavano analoghi per entrambi i trattamenti fino al termine dello studio (84° giorno).
Ranjan et al. (1997) riportano un analogo numero di UPG in vitelli al pascolo trattati con ivermectina e con doramectina,
almeno fino al 63° giorno dal trattamento. Essi rilevano, comunque, un aumento del numero di UPG a partire dal 28°
giorno dal trattamento con ivermectina e dal 42° per doramectina e segnalano una migliore efficacia della doramectina,
seppure con una significatività piuttosto bassa, sulla conta dei nematodi totali (adulti e larve) 65 giorni post-trattamento.
Addirittura gli animali trattati con ivermectina risultavano infestati con un numero di nematodi totali paragonabile al
gruppo di controllo non trattato. Gli stessi autori non segnalano alcuna differenza significativa tra i due trattamenti né tra
questi ed il gruppo di controllo per quanto riguarda il genere Nematodirus; tale risultato è in accordo con la minore efficacia
da noi osservata, almeno relativamente alle prevalenze, nei confronti di questi strongili.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
125
Williams et al. (1997), sempre in bovini al pascolo, riportano un’emissione di UPG significativamente inferiore in animali
trattati con doramectina rispetto a quelli trattati con ivermectina tra il 28° ed il 56° giorno dal trattamento. Tale effetto
sarebbe da imputarsi ad una maggiore durata del periodo protettivo nei confronti delle reinfezioni. Non vi sono dati relativi
al periodo successivo.
Ballweber et al. (1997) in bovini da carne al pascolo osservano differenze significative di UPG tra le due molecole dal 42°
all’84° giorno post-trattamento, dovute ad un aumento più graduale nel gruppo trattato con doramectina.
Nel presente studio non si sono riscontrate differenze tra gli animali trattati con ivermectina e con doramectina, né
correlazioni tra numero di UPG e intervallo trattamento-controllo. Ciò fa supporre che in condizioni di allevamento su
grigliato, nelle quali il rischio di infezione è estremamente scarso, la maggiore durata dell’azione antielmintica riportata
per la doramectina non sortirebbe alcun vantaggio rispetto all’ivermectina. Occorre tenere in considerazione, inoltre, che
gli animali importati risultano infestati da strongili gastrointestinali con medie di emissione piuttosto basse (40 UPG)
all’arrivo in allevamento, il che è probabilmente da imputarsi ad una certa immunità acquisita (Gasbarre et al. 2001), anche
in relazione all’età piuttosto elevata di Introduzione in allevamento.
E’ probabile che, anche in assenza di trattamento, si sarebbe potuto assistere ad una diminuzione delle infezioni da nematodi,
analogamente a quanto rilevato per coccidi e per cestodi, come osservato anche da Eddi et al. (1997) in un gruppo di bovini
non trattato. A tale proposito, segnaliamo che indagini ancora in corso, effettuate sugli stessi animali al momento della
macellazione, hanno rilevato una totale assenza di uova di Sgi.
Conclusioni
I trattamenti effettuati di routine sembrano sufficientemente efficaci nei confronti dei nematodi, verso i quali sono attivi,
seppure non al 100%.
La maggiore durata dell’azione antiparassitaria riportata in letteratura per doramectina rispetto ad ivermectina non sembra
comportare una diversa efficacia dei due trattamenti, in vitelloni importati ed allevati intensivamente su grigliato nelle
condizioni descritte nel presente lavoro. Ciò è probabilmente imputabile al fatto che le migliori performances riportate per
la doramectina sono relative ad una prolungata protezione nei confronti delle reinfezioni, le quali non si verificherebbero
in un contesto ambientale sfavorevole al ciclo dei parassiti. In tale contesto, è consigliabile l’uso del farmaco meno costoso,
indipendentemente dall’efficacia rilevata in diverse situazioni sperimentali. Sarebbe inoltre interessante, alla luce dei
risultati ottenuti e di quanto reperito in letteratura, valutare con successivi studi l’effettiva opportunità di un trattamento
antiparassitario negli allevamenti intensivi da carne, anche in termini di costi e di benefici.
Bibliografia
Armitage P. (1971). Statistical methods in medical research. Blackwell Scientific Publications, Oxford.
Ballweber L.R., Smith L.L., Stuedemann J.A.; Yazwinski T.A., Skogerboe T.L. (1997). The effectivness of a single treatment with
doramectin or ivermectin in the control of gastrointestinal nematodes in grazing yearling stocker cattle. Veterinary Parasitology. 72: 5368.
Battelli G., Poglayen G., Martini M. (1989). Indagini sulle parassitosi dei vitelli importati. Il nuovo Progresso Veterinario. 2: 3-5.
Eddi C., Muniz R.A., Caracostantologo J., Errecalde J.O., Rew R.S., Michener S.L., McKenzie M.E. (1997). Comparative persistent
efficacy of doramectin, ivermectin and fenbendazole against natural nematode infections in cattle. Veterinary Parasitology. 72: 33-41.
Epperson W.B., Kenzy B.D., Mertz K., Hildreth M.B. (2001). A single pasture limited treatment approach to estimate production loss
from gastrointestinal nematodes in grazing stocker cattle. Veterinary Parasitology. 97: 269-276.
Gasbarre L.C., Leighton E.A., Sonstegard T. (2001). Role of the bovine immune system and genome in resistance to gastrointestinal
nematodes. Veterinary Parasitology. 98: 51-64.
Genchi C., Traldi G., Solari Basano F., Bossi P., Mennella P. (1995). Efficacia della doramectina nel bovino infestato sperimentalmente
con nematodi gastrointestinali. Atti della Società Italiana di Buiatria. 27:333-343.
Genchi C., Montagner A., Ceccato C., Florian E., Tondello L., Luppi A., Frigeri V., Vanini G., Frizzi M., Balottin A., Vagheggini M.
(1997). La distomatosi epatica del bovino da carne importato: un problema ormai superato o un rischio reale per la resa zootecnica degli
animali? Atti della Società Italiana di Buiatria. 29: 199-213.
Ismea-Osservatorio latte (2002). Il mercato della carne bovina: rapporto 2002. Franco Angeli, Milano.
Ranjan S, Trudeau C., Prichard R.K., Daigneault J., Rew R.S. (1997) Nematode reinfection following treatment of cattle with doramectin
and ivermectin. Veterinary Parasitology. 72: 25-31.
Siegel S. (1980). Statistica non parametrica per le scienze del comportamento. Organizzazioni Speciali, Firenze.
Taylor M.A., Hunt K.R., Goodyear K.L. (2002). Anthelmintic resistance detection methods. Veterinary Parasitology. 103: 183-194.
Williams J.C., Loyacano A.F., DeRosa A., Gurie J., Coombs D.F., Skogerboe T.L. (1997). A comparison of the efficacy of two treatments
of doramectin injectable, ivermectin injectable and ivermectin pour-on against naturally acquired gastrointestinal nematodes infections
of cattle during a winter-spring grazing season. Veterinary Parasitology. 72: 69-77.
126
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ATTI
VENERDÌ 23 MAGGIO 2003
VALUTAZIONE DEL SEME DI CAPRONI AFFETTI DA CALICOSI TESTICOLARE
SEMEN EVALUATION IN BUCKS AFFECTED BY TESTICULAR CALICOSIS
Cristarella S., Scirpo A., Cinone M., Gimbo A., Cassata R. B.
FUNZIONALITÅ TESTICOLARE E PARAMETRI SEMINALI I IN ARIETI
IN CONTROSTAGIONE STIMOLATI CON NALOXONE, CALCIO E GnRH
Binetti F., Aiudi G., Giannoccaro A., *Cinone M., Quaranta A., Lacalandra G.M,
GLYCOCONJUGATES HISTOCHEMISTRY OF DUODENAL GLANDS AND DUODENAL
GOBLET CELLS IN BUBALUS BUBALI
Verdiglione R., Sarullo V., Gargano M., Mammola C.L.
RILIEVI ISTOPATOLOGICI ED IMMUNOISTOCHIMICI SU TESSUTI FISSATI
I FORMALINA E INCLUSI IN PARAFFINA DI PECORE INFETTATE
SPERIMENTALMENTE CON MYCOPLASMA AGALACTIAE
Rocca S., Pirino S., Antuofermo E,. Chiarolini A., Tola S., Leori G.
IL CARCINOMA MAMMARIO A CELLULE SQUAMOSE DELL’OVINO SARDO
Antuofermo E., Pirino S., Rocca S., Idili S., Leoni A., Nieddu A.M..
BLUE TONGUE: UN’EMERGENZA ANCHE A LIVELLO LEGISLATIVO
Passantino A., Fenga C., Di Pietro C., Venza M., Passantino M.
NEW DISPOSITIONS ON IDENTIFICATION AND REGISTRATION OF CATTLE IN ITALY
Di Pietro C., Passantino A., Fenga C., Passantino M.
NORMATIVA VIGENTE IN MATERIA DI TUTELA DELLA BUFALA MEDITERRANEA ITALIANA
Passantino A., Fenga C., Di Pietro C., Passantino M.
XI Congresso
Internazionale
della Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
127
128
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
VALUTAZIONE DEL SEME DI CAPRONI AFFETTI DA CALICOSI TESTICOLARE
Cristarella S., Scirpo A., Cinone M., Cassata R. B., Gimbo A.
Dipartimento di Chirurgia, Fisiopatologia e Clinica della Riproduzione degli animali domestici - Facoltà di Medicina
Veterinaria – Università degli Studi di Messina
Riassunto
La calicosi è una delle più comuni forme distrofico-degenerative testicolari della specie caprina, con limitazione dell’efficienza
riproduttiva. Essa colpisce soggetti d’ogni età con un’incidenza variabile ed un’evoluzione progressiva. Scopo del nostro
lavoro è stato quello di valutare in caproni con differenti stadi di calicosi il liquido seminale, prima e dopo capacitazione
in vitro, al fine di verificarne la potenziale fertilità. La sperimentazione è stata condotta durante la stagione riproduttiva
su sei caproni; quattro soggetti hanno presentato livelli differenti di calicosi testicolare, valutata tramite ecografia, ed altri
due, esenti da patologia, hanno rappresentato il gruppo controllo. Il seme prelevato mediante elettroeiaculazione è stato
esaminato dal punto di vista macroscopico, microscopico e capacitato mediante metodica di swim-up. Gli elementi relativi
alle caratteristiche morfo-funzionali dei nemaspermi, il grado d’estensione della lesione, confermano un residuo valore di
fertilità dei caproni con calicosi testicolare.
Introduzione
La calicosi o mineralizzazione è una lesione degenerativa, aflogistica delle strutture testicolari, caratteristica dei ruminanti
domestici (Smith, 1986; McEntee, 1990;). Generalmente si osserva con maggiore incidenza in età avanzata, può interessare
uno od entrambi i testicoli con una frequenza fino al 50% nei caproni (Gimbo et al., 1982). Nell’uomo è stata segnalata
sporadicamente associata a neoplasie o ad altre patologie testicolari quali criptorchidismo, orchite e torsione testicolare (Sato
et al., 2002). L’eziologia negli animali, anche se non ancora del tutto chiarita, viene riferita ad un eccesso di provitamine del
gruppo D nella razione alimentare ricca di alcune graminacee (Gimbo et al., 1986). La degenerazione insorge inizialmente
sotto forma di focolai isolati, successivamente diffusi, raggiati secondo l’andamento tubulare ed è caratterizzata da
un’infiltrazione di sali calcarei (idrossiapatite o calciofosfato idrato). La patogenesi ha esordio in una lesione vascolare di
tipo arteriosclerotico che interessa le arterie dell’albuginea, le arteriole e i precapillari parenchimali cui segue un progressivo
addensamento nel lume, di materiale basofilo PAS-negativo. La conseguente deposizione di sali di calcio si estende dalle
pareti vascolari al parenchima, ivi comprese le membrane peritubulari e l’interno dei tubuli, determinando lesioni di diversa
entità a carico del parenchima testicolare (Gimbo et al., 1982; 1986).
Oggetto del nostro studio è stata la valutazione del liquido seminale, prima e dopo capacitazione in vitro degli spermatozoi,
in caproni affetti da diversi gradi di calicosi testicolare, al fine di verificare la fertilità in rapporto all’estensione della lesione
e alle caratteristiche morfologiche nemaspermatiche.
Materiale e metodi
La ricerca è stata condotta su sei caproni di differente razza e provenienza con età compresa tra 2-8 anni utilizzati come
riproduttori. Lo stadio evolutivo della calicosi è stato valutato mediante esame ecografico dell’apparato scroto-testicolare
( Logic α Samsung GE Medical System-Korea con sonda convex 6.5 MHz e lineare 7,5 MHz), evidenziando focolai da
1.1-9.8 mm. Quattro soggetti presentavano percentuali progressive di calicosi in entrambi i testicoli: stadio iniziale 20%,
40%, 60% e 80% rispettivamente per i caproni n°1, 2, 3 e 4. Nei soggetti con gravi lesioni, i focolai apparivano fra loro
in vicinanza o anche in contatto per una progressiva confluenza. Il gruppo di controllo era rappresentato da due soggetti
n°5 e 6 privi di lesioni calicotiche. La raccolta del seme è stata praticata da febbraio ad ottobre 2001 con prelievi ogni
due settimane realizzati mediante elettroeiaculazione (Electrojac G. Nichols, New Zealand) con elettrodo rettale, 4-5
stimolazioni di 40 volts e 160 mA. Dopo il prelievo, il seme è stato mantenuto a temperatura di 38,5°C per effettuare i
controlli macroscopici (volume, aspetto, colore, odore, pH) secondo i parametri di Refsal (1986). Nell’esame microscopico
è stata valutata, la mobilità di massa secondo la classificazione di Evans e Maxwell (1987); la vitalità con metodo di Blom
(colorazione sopravitale); la concentrazione con camera di Makler previa immobilizzazione nemaspermatica; la morfologia
nemaspermatica con colorazione di Williams e arancio di acridina. La capacitazione nemaspermatica in vitro è stata
ottenuta separando dal liquido seminale la frazione spermatica a più alta mobilità tramite metodica di swim-up, incubando
il seme per 2 ore a 38.5°C in 5% CO2 in Earle Balanced Solution (Sigma E-2888) supplementato con 0.5% di albumina
bovina (Sigma A-2153) e gentamicina (Sigma G-1264). La capacitazione è stata ottenuta con l’aggiunta di eparina (Sigma
H-3393) al medium di capacitazione. (Larsson and Rodriguez-Martinez,2000). I valori ottenuti dall’analisi del liquido
seminale sono stati analizzati mediante test del Chi-quadro, con correzione di Yates, confrontando i soggetti del gruppo
con differenti gradi di calicosi e il gruppo controllo.
Risultati e discussione
Nei soggetti affetti da calicosi testicolare, le caratteristiche macroscopiche seminali non presentano modificazioni.
La motilità degli spermatozoi decresce in rapporto alla percentuale di patologia testicolare con differenze altamente
significative (p<0.001) anche in confronto al gruppo di controllo (Tab. 1). Le percentuali di vitalità dei soggetti con
calicosi tendono a decrescere nei caproni con maggiore grado della patologia (caprone n°3, 4) con differenze altamente
significative (p<0.001) anche in confronto al gruppo di controllo. Tutti i prelievi di seme da febbraio ad ottobre hanno
presentato crescenti percentuali di spermatozoi anomali in relazione al grado di calicosi testicolare con differenze altamente
significative (p<0.001) (Tab. 2). Le alterazioni primarie della spermatogenesi hanno generato evidenti forme anomale
(testa vacuolizzata, irregolare ispessimento del tratto intermedio, coda sottile) soprattutto nei soggetti con elevato grado di
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
129
calicosi (caprone n°3, 4) con compromissione della capacità fecondante. Le alterazioni secondarie della morfologia (tratto
intermedio attorcigliato e ripiegato, coda nodosa e ripiegata) potrebbero derivare da manipolazioni del seme prelevato
tramite elettrostimolazione. La concentrazione nemaspermatica prima e dopo capacitazione segue in maniera inversamente
proporzionale il grado di calicosi, pur non presentando differenze statisticamente rilevabili in rapporto all’esiguo numero
di soggetti esaminati (Tab. 3-4).
In conclusione la motilità, la morfologia e la concentrazione degli spermatozoi sono in rapporto all’evoluzione della lesione
testicolare evidentemente espressione di un disturbo trofico nel processo di maturazione nemaspermica. In questa direzione,
altre indagini ultrastrutturali ed ormonali sono tuttora in corso su altri caproni per ampliare ulteriormente la casistica.
Sebbene i parametri seminali sono risultati accettabili è verosimile che la lesione testicolare ha generato una ridotta fertilità
dei soggetti negli allevamenti di provenienza. Le porzioni di tessuto testicolare non danneggiate dalle lesioni calicotiche
riescono ugualmente a produrre, in concentrazione differente, nemaspermi potenzialmente attivi in rapporto al grado di
calicosi. I caproni con calicosi conservano quindi un “valore residuo di fertilità” proporzionato al grado d’estensione della
lesione che in allevamento dovrà essere commisurato al regime di monta naturale (Cristarella et al., 2003).
Bibliografia -
Cristarella S., Scirpo A., Gimbo A. (2003) Ultrasonographic diagnosis of the testicular calicosis in buck. Turkish Journal of Veterinary
and Animal Sciences. In press.
Evans G., Maxwell W.M.C. (1987) Salamon’s Artificial Insemination of Sheep and Goats. Butterworts Pty Limited. Sydney.
Gimbo A., Giannetto S., Zanghì A. (1982) Osservazioni preliminari sulla degenerazione testicolare (calcinosi) nella specie caprina. Atti
Soc. It. Sci. Vet. XXXVI, 319-322.
Gimbo A., Zanghì A., Giannetto S. (1986) Calicosi e arteriosclerosi testicolare nella specie caprina. Fisiopat. Riprod. IV, 1.
Larson B., Rodriguez-Martinez H. (2000) Cam we use in vitro fertilitazation tests to predict semen fertility ?. Anim. Reprod. Science
60-61, 327-336.
McEntee K. (1990) Reproductive pathology of domestic mammals. Academic Press., Inc. N.Y.
Refsal K.R. (1986) Collection and evaluation of caprine semen. In Morrow D.A.: Current Therapy in Theriogenology. WB Saunders,
Philadelphia.
Sato K., Komatsu K., Maeda Y., Ueno S., Koshida K., Namiki M. (2002) Case of mediastinal seminoma with testicular microlithiasis.
Int. J. Urol. 9, 2, 114-6.
Smith M.C. (1986) Infertility in the buck. In Morrow D.A.: Current Therapy in Theriogenology. WB Saunders, Philadelphia.
Tab. 1 Confronto fra la motilità degli spermatozoi di caproni con differenti gradi di calicosi e gruppo
controllo.
MOTILITA’ (%)
Data
Caprone
21-feb
n° 1
n° 2
n° 3
n° 4
n° 5
n° 6
70
20
50
75
50
70
07-mar
20-mar
03-apr
19-apr
02-mag
16-mag
80 c
60 c
50 c
70 c
80 c
50 c
40 d
50
75 d
50 d
20 d
75 d
30 d
20 d
70 d
60
50
40
10 d
60 c
50 c
30 d
20 d
10 d
d
70 c
80 c
80 d
80 c
80 c
80 c
75
80 c
80 d
80 c
80 c
80 c
Test chi-quadro con correzione di Yates per colonne: c,d = p<0,001
c
d
d
05-giu
70
50
50
20
80
80
03-ott
80
60
75
30
80
80
c
d
d
d
c
c
c
d
d
c
c
Tab.2 Confronto fra la morfologia nemaspermatica di caproni con differenti gradi di calicosi e gruppo
controllo.
MORFOLOGIA (%)
Soggetto
n° 1
n° 2
n° 3
n° 4
n° 5
n° 6
130
Data
21-feb
15
35
60
50
45
30
07-mar
20-mar
03-apr
19-apr
02-mag
16-mag
15 c
25 c
25 c
20 c
20 c
40 c
25
35
40
35
40 d
40 c
70 d
55 d
45 d
60 d
60 d
60 d
45 d
40
55 d
50 d
50 d
70 d
40 d
15
20
10
15
20 d
25
15
20
10
15
20 d
Test chi-quadro con correzione di Yates per colonne: c,d = p<0,001
c
d
d
d
d
05-giu
20
20
85
50
15
15
c
c
d
d
03-ott
20 c
30
80 d
60 d
10
10
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Tab. 3 Concentrazione degli spermatozoi di caproni con differenti gradi di calicosi e gruppo controllo.
CONCENTRAZIONE
(109/ml)
Data
Soggetto
21-feb
n° 1
n° 2
n° 3
n° 4
n° 5
n° 6
07-mar
2,5
1
0,5
0,6
2,4
1,2
0,5
0,4
0,6
0,76
0,65
1
20-mar
1,8
0,8
0,4
0,8
2,4
2,4
03-apr
19-apr
1,6
0,8
0,9
0,1
2,3
2,4
1
0,8
1,1
0,6
2,4
2,2
02-mag
1,1
0,4
0,9
0,25
2,4
2,4
16-mag
0,9
0,9
0,8
0,3
2,5
2,4
05-giu
0,7
0,6
1,5
0,4
2,4
2,4
03-ott
2,2
0,4
0,9
0,3
2,5
2,5
Tab. 4 Concentrazione dopo capacitazione degli spermatozoi di caproni con calicosi e gruppo controllo.
CONC. DOPO CAPAC.
(109/ml)
Data
Soggetto
21-feb
n° 1
n° 2
n° 3
n° 4
n° 5
n° 6
0,25
0,08
0,15
0,1
0,2
0,25
07-mar
0,3
0,2
0,03
0,1
0,5
0,4
20-mar
0,4
0,02
0,02
0,1
0,6
0,4
03-apr
0,5
0,4
0,6
0,1
0,5
0,4
19-apr
0,7
0,3
0,6
0,1
0,5
0,5
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
02-mag
0,7
0,3
0,5
0,1
0,5
0,6
16-mag
0,5
0,4
0,5
0,1
0,6
0,5
05-giu
0,5
0,3
0,6
0,2
0,5
0,5
03-ott
0,6
0,2
0,2
0,1
0,4
0,4
131
FUNZIONALITA’ TESTICOLARE E PARAMETRI SEMINALI I IN ARIETI IN CONTROSTAGIONE
STIMOLATI CON NALOXONE, CALCIO E GnRH
Binetti F., Aiudi G., Giannoccaro A., *Cinone M., Quaranta A., Lacalandra G.M.
Dipartimento di Produzione Animale, Facoltà di Medicina Veterinaria, Università degli Studi di Bari, Strada Provinciale
per Casamassima, Km 3, 70010 Valenzano (Bari), tel.: 0804679879, fax: 080/4679883, [email protected]
uniba.it¸ *Dipartimento di Chirurgia, Fisiopatologia e Clinica della Riproduzione degli Animali Domestici, Facoltà di
Medicina Veterinaria, Università degli Studi di Messina.
Riassunto
Negli ovini in controstagione riproduttiva è nota l’esistenza di una attività inibitoria degli oppioidi endogeni sull’asse
ipotalamo-ipofisi-gonadi. Nel presente lavoro è stata stimolata la libido e la funzionalità testicolare in arieti in controstagione,
utilizzando GnRH associato a Naloxone (Nx), antagonista degli oppiodi endogeni, e Calcio (Ca). La sperimentazione è
stata condotta su 20 arieti meticci, su cui sono stati valutati libido, circonferenza testicolare e parametri seminali. Gli arieti
sono stati divisi in 5 gruppi sottoposti a differenti trattamenti farmacologici: Gruppo A: GnRH (40 µg/capo im) ogni 8 h
per 2 gg., ogni 12 h per altri 2 gg., e ogni 24 h per ultimi 2 gg.; B: protocollo del gruppo A + 5 ml/capo im di Ca/Nx ogni
24 h per 6 gg.; C: 5 ml/capo di Ca/Nx ogni 24 h per 6 gg.; D: 5 ml/capo im di NaCl (0,9%) ogni 24 h per 6 gg.; E: 5
ml/capo di Ca++ ogni 24 h per 6 gg.
Il trattamento farmacologico ha indotto incrementi significativi della circonferenza scrotale e della
libido nei Gruppi A e B. I migliori parametri seminali sono stati ottenuti nel gruppo B. La stimolazione
con GnRH/Ca-Nx è risultata la più valida nell’indurre la ripresa dell’attività riproduttiva negli arieti
in controstagione.
Introduzione
Nell’ariete la maturità sessuale si raggiunge intorno ai 100-150 giorni di età. La spermatogenesi ha inizio verso gli 80-100
giorni, benché la produzione di spermatozoi dotati di buona vitalità non si realizzi prima dei 150 giorni (Corteel, 1985).
L’attività riproduttiva è sotto il controllo del sistema endocrino e del S.N.C., ma è anche fortemente influenzata da fattori
ambientali quali razza, sistema di allevamento, temperatura, alimentazione, eventuali forme patologiche intercorrenti e
fotoperiodo. L’inizio della stagione riproduttiva nell’ariete è preceduto da una stimolazione dell’asse ipotalamo-ipofisario
che porta ad un incremento nella sintesi di GnRH, e dunque nella secrezione pulsatile di LH e di FSH, ed alla riduzione
dell’increzione di prolattina. Questi cambiamenti ormonali regolano la steroidogenesi e la spermatogenesi; infatti è stata
osservata una variazione stagionale nel numero di recettori di LH ed FSH in sede testicolare (Barenton et al, 1983).
Il GnRH è un decapeptide secreto in modo pulsatile dall’ipotalamo; la sua attività è fortemente legata al ruolo di secondo
messaggero giocato dal calcio. Il recettore per il GnRH è strettamente interconnesso ai canali del calcio sulla membrana
cellulare, per cui la sua attivazione comporta l’apertura dei canali e l’ingresso del calcio extracellulare (Zorn et al., 1992). Il
calcio endocellulare mobilizzato, si lega ad una proteina di legame la calmodulina, la quale funge da vero e proprio recettore
intracellulare del calcio. Il legame del calcio con la calmodulina è a sua volta responsabile dell’attivazione di enzimi calciodipendenti (proteinchinasi, adenilciclasi e fosfodiesterasi) che determinano secrezione e liberazione delle gonadotropine.
Tra i principali inibitori della secrezione di gonadotropine ricordiamo i peptidi oppioidi endogeni (Evans et al., 1997).
Sono neuropeptidi appartenenti a tre categorie: le enkefaline, le dinorfine e le endorfine (Julius, 1997). La loro azione più
nota è quella di tipo antalgico conseguente ad un loro aumento in risposta ad una condizione di stress di qualsiasi natura ed
entità. Tuttavia tali sostanze inducono negli animali una vasta serie di effetti sul sistema endocrino; in particolare, ricerche
in vivo ed in vitro su testicoli di ratto, hanno dimostrato che le β-endorfine determinano un effetto inibente la sintesi di
testosterone, probabilmente alterando la risposta delle cellule interstiziali all’LH (Kant et al., 1995). Alti livelli di oppioidi
endogeni, provocando il blocco dei canali del calcio a livello di membrana e alterandone gli scambi (Attali et al., 1991;
Wang et al., 1992; Minoia et al., 1994), inibiscono produzione (Speroff et al., 1980), rilascio (Larakis et al., 1986) ed azione
del GnRH (Page, 1997; Minoia et al., 1997); inoltre modificano, agendo sui recettori μ presenti negli spermatozoi di
ariete, i caratteri quali-quantitativi del materiale seminale (Guaricci et al., 2002). Gli antagonisti degli oppiodi, fra i quali il
Naloxone, si legano con alta affinità ai recettori per gli oppioidi (Hardingam et al., 1997). Il Naloxone, in particolare, agisce
soprattutto a livello di recettori μ e rimuove rapidamente gli oppioidi dai recettori specifici (Minoia et al., 1997). L’azione
del Naloxone, favorendo l’ingresso del calcio nella cellula e nei tessuti attraverso una riattivazione dei canali L del calcio,
consente la riattivazione intracellulare del pacemaker per il calcio, con il raggiungimento dell’equilibrio dinamico (Lograno
et al., 1996) e la riattivazione del normale turnover di funzioni fisiologiche regolari (Casavola et al., 1996).
Precedenti studi hanno dimostrato l’efficacia del GnRH di sintesi e dell’associazione Calcio/Naloxone nell’aumentare la
libido nei becchi (Minoia et al., 1988; Lacalandra et al., 1994; Lacalandra et al., 1997). Scopo della nostra ricerca è stato
quello di valutare la possibilità di indurre un aumento della libido ed un miglioramento dei parametri seminali negli arieti
in controstagione, dopo stimolazione farmacologia con GnRH e Calcio/Naloxone, al fine di neutralizzare gli effetti negativi
degli oppioidi endogeni sull’asse gonadotropo-ipotalamo-ipofisario.
Materiale e metodi
La sperimentazione è stata condotta nel mese di Maggio 2002 presso l’azienda agricola “L. Ricchioni”, dell’Università
degli Studi di Bari. Sono stati utilizzati venti arieti, meticci di Sopravvisana x Gentile di Puglia, di età compresa fra due e
cinque anni, preventivamente sottoposti a visita clinica generale ed esame obiettivo particolare dell’apparato riproduttore.
Durante la sperimentazione tutti gli arieti hanno ricevuto una razione alimentare giornaliera equilibrata ed acqua a volontà.
In precedenza maschi e femmine sono stati separati per trenta giorni, al fine di evitare qualunque reciproca influenza
132
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
sessuale relativa a fattori di tipo olfattivo, visivo e sonoro. Il giorno prima dell’inizio dei trattamenti sono state effettuate
valutazioni del comportamento, misurazioni della circonferenza mediana testicolare, rilievi ecografici (Scan Vet 480, 5Mhz,
Pie Medical) della distanza biparietale testicolare e della distanza tra mediastino e parete. Gli arieti sono stati divisi in cinque
gruppi, ciascuno costituito da quattro soggetti scelti a random.
GRUPPO A: Somministrazione di GnRH (Fertagyl, Intervet Italia), 40 μg/capo i.m., ogni 8 ore il 1° e 2° giorno, ogni 12
ore il 3° e 4° giorno e ogni 24 ore il 5° e 6° giorno.
GRUPPO B: Somministrazione di GnRH (Fertagyl, Intervet Italia), secondo le modalità indicate nel gruppo
precedente, e di una soluzione di Calcio Gluconato al 20%, contenente 0,2 mg/ml di Naloxone cloridrato alla dose
di 5 ml/capo die i.m. per 6 giorni.
GRUPPO C: Somministrazione di una soluzione di Calcio Gluconato al 20%, contenente 0,2 mg/ml di Naloxone
cloridrato, alla dose di 5 ml/capo die i.m. per 6 giorni.
GRUPPO D: Somministrazione di Soluzione Fisiologica alla dose di 5 ml/capo die i.m. per 6 giorni.
GRUPPO E: Somministrazione di Calcio Borogluconato (Fatro, Italia) al 20%, alla dose di 5 ml/capo die i.m. per
6 giorni.
Il giorno successivo alla fine del trattamento, ogni ariete è stato posto in un box con una pecora in calore indotto con
estrogeni, al fine di valutarne la libido. Due giorni alla settimana, per due settimane successive alla fine del trattamento, si
è proceduto a prelievi e a valutazioni macro-microscopiche del materiale seminale. La motilità di massa è stata classificata
secondo il metodo Bonadonna (1980), mentre la concentrazione spermatica è stata calcolata mediante fotometro
ACCUCEL (I.M.V., France).
I dati sono stati sottoposti ad analisi statistica della varianza fra medie (ANOVA).
Risultati
Alla fine del trattamento, soprattutto negli arieti appartenenti ai gruppi A e B, sono stati osservati irrequietezza, tentativi
reciproci di monta e interesse verso la femmina in calore indotto, con tentativi di monta della stessa. È stato possibile
effettuare due prelievi di seme, a distanza di sette giorni l’uno dall’altro, da un ariete per ciascun gruppo. La circonferenza
scrotale (Tab. 1), è risultata aumentata in tutti i gruppi. Gli incrementi più significativi sono stati però ottenuti nei gruppi
A, da 31,5±1,3 a 34,4±0,7 cm (P≤0,01), e B, da 30±1,6 a 35±4,1 cm (P≤0,05).
Tab. 1: Circonferenza (cm; X±D.S.) testicolare nei vari gruppi sperimentali.
Giorni
GRUPPI
GnRH
Pre
trattamento
0
1
2
31,5±1,3A
31,8±0,8
32,5±1
33±0,8
3
4
Post
trattamento
33,6±0,5 34,3±0,6 34,4±0,7B
GnRH+Ca/Nx
30±1,6a
31,63±1,7 32,88±1,7 33,33±1,9 33,4±2,1 34,4±2,8
35±4,1b
Ca/Nx
32,5±2,1
32,75±2,2 33,38±1,9 33,63±1,5 34±1,5 34,3±1,3
35,3±2,1
NaCl
31,8±1,7
31,75±1,7 31,88±1,7 32,25±1,5 32,5±1,3 33±1,6
33,1±1,7
Ca
31,5±1,3
32±2,2
32,25±1,7 33,75±2,2 33,8±2,2 35,4±2
35,4±2
Sulla stessa riga: A≠B per P≤0,01; a≠b per P≤0,05, significatività intragruppo.
Al rilievo ecografico della distanza tra le pareti testicolari, è stato riscontrato un incremento in tutti i gruppi (Tab. 2).
Incrementi significativi (P≤0,01) sono stati registrati nei gruppi A e B, come anche nel gruppo C (P≤0,05).
Tab. 2: Rilievi ecografici della distanza (cm; X±D.S.) tra le pareti testicolarinei vari gruppi sperimentali.
Giorni
GRUPPI
Pre
trattamento
0
3
4
Post
trattamento
GnRH
5,74±0,1A 5,88±0,2 6,07±0,2 6,17±0,2 6,32±0,2B
GnRH+Ca/Nx
5,36±0,1A 5,66±0,2 5,9±0,2 6,09±0,5 6,27±0,4B
Ca/Nx
5,54±0,4a 5,66±0,3 6,06±0,2 6,24±0,2 6,51±0,3b
NaCl
5,82±0,7
5,97±0,6 6,37±0,5 6,52±0,4
6,59±0,4
Ca
5,44±0,7
5,49±0,6 5,77±0,4 5,98±0,3
6,07±0,3
Sulla stessa riga: A≠B per P≤0,01; a≠b per P≤0,05, significatività intragruppo.
Il rilievo ecografico della distanza tra parete e mediastino testicolare (Tab. 3) ha permesso di registrare e confermare i
risultati ottenuti con i due metodi di valutazione prima descritti, con incremento significativo (P≤0,05) solo nei Gruppi
trattati con GnRH.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
133
Tab. 3: Rilievi ecografici della distanza (cm; X±D.S.) tra parete mediastino testicolare nei vari gruppi sperimentali.
Giorni
GRUPPI
Pre
trattamento
0
3
4
Post
trattamento
GnRH
3,04±0,4a 3,39±0,2 3,38±0,2 3,53±0,1 3,71±0,2b
GnRH+Ca/Nx
3,12±0,2
3,26±0,2 3,37±0,3 3,49±0,3
3,55±0,3
Ca/Nx
3,61±0,9
3,71±0,9 3,97±1 4,04±0,9
4,32±0,9
NaCl
3,29±0,4
3,32±0,5 3,5±0,5 3,53±0,5
3,66±0,5
Ca
2,97±0,3a 3,04±0,3 3,11±0,3 3,39±0,4 3,54±0,2b
Sulla stessa riga: a≠b per P≤0,05, significatività intragruppo.
Il rilievo dei parametri seminali (Tab. 4) dopo trattamento, ha evidenziato che il volume dell’eiaculato e la concentrazione
degli spermatozoi, tranne che nel gruppo A, sono da considerarsi buoni e nella media della specie (vol. 0,7 ml; concentrazione
2,5-3x109).
Tab. 4: Variazioni nei parametri seminali dopo trattamento nei vari gruppi sperimentali.
Gruppi
GnRH
N.
Ariete
4
1° prelievo
2° prelievo
Volume
(ml)
Concentrazione
(Nx109/ml)
Motilità
Volume
(ml)
Concentrazione
(Nx109/ml)
Motilità
0,3
1,853
Onde
lente
0,35
1,868
Vortici
rapidi
GnRH
+Ca/Nx
6
0,55
2,655
Assenza
di onde
Ca/Nx
11
0,7
5,503
NaCl
13
0,62
3,903
Ca
17
0,67
5,419
Assenza
di onde
Vortici
rapidi
Onde
lente
1,2
3,243
Onde e
vortici
rapidi
Mancato
salto
0,5
1,194
0,4
4,187
Vortici
rapidi
Vortici
rapidi
Nel gruppo B (GnRH + Ca/Nx) il volume dell’eiaculato è più che raddoppiato dal primo al secondo prelievo (da 0,55
a 1,2 ml) e la concentrazione è passata da 2,655x109 a 3,243x109 con spermatozoi di ottima motilità. Negli altri gruppi
(C, D ed E) i volumi e le concentrazioni di spermatozoi nel primo prelievo sono risultati buoni, ma la motilità è stata
caratterizzata da onde lente e deboli. Nel gruppo D il II° prelievo è stato caratterizzato da una notevole riduzione di volume
e concentrazione degli spermatozoi rispetto al I°. Nel gruppo E, infine, si è rilevata una riduzione del volume dell’eiaculato
accompagnata da un aumento notevole della motilità degli spermatozoi.
Discussione
La valutazione globale dei dati ed il confronto tra i vari trattamenti effettuati conferma che il GnRH è l’ormone d’elezione
ed indispensabile da utilizzarsi in controstagione per indurre modificazioni morfofunzionali delle gonadi maschili per una
ottimale attività seminale. Tuttavia il nostro studio ha permesso di evidenziare come il trattamento combinato GnRH+Ca/
Nx abbia fornito i migliori risultati. Ciò è sicuramente da riferirsi all’azione di antagonizzazione delle ß-endorfine sia
a livello ipotalamo-ipofisario che a livello gonadico che consente una più efficace attività di stimolazione del GnRH
sull’adenoipofisi, una migliore azione delle gonadotropine ipofisarie endogene sulle cellule bersaglio testicolari, un’ottimale
attività cellulare ai diversi livelli per la maggiore disponibilità endocellulare di ioni calcio. L’aggiunta del calcio, da solo o in
associazione con il Naloxone, estrinseca la sua azione prevalentemente a livello metabolico. Si dimostra quindi che in questa
specie la minore attività sessuale degli arieti in controstagione vede coinvolto il sistema opioidergico come causa di minore
attività cellulare al livello dell’asse ipotalamo-ipofisi-gonadi.
Il rilievo clinico più evidente, registrato in maniera significativa nel gruppo A (GnRH; P≤0,01), e nel gruppo B (GnRH+Ca/
Nx; P≤0,05), è stato l’aumento di volume dei testicoli che rappresenta il parametro fortemente legato ed indicativo della
produzione di spermatozoi. Tale correlazione, già dimostrata negli arieti (Lindsay et al., 1984; Cameron et al., 1984)
e nei becchi (Minoia et al., 1988; Lacalandra et al. 1994), nella pratica viene utilizzata per valutare indirettamente la
capacità e l’attitudine del maschio alla produzione di elevate quantità di spermatozoi e quindi la possibilità di utilizzarlo
in maniera efficace nei programmi riproduttivi. Va segnalato che l’utilizzo degli ultrasuoni ai fini della determinazione
dell’accrescimento testicolare, ha rappresentato un valido e preciso ausilio diagnostico rispetto alla misurazione manuale.
In conclusione, l’aumento di volume dei testicoli ed il miglioramento dei parametri seminali dopo trattamento, conferma
134
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ed avvalora la validità di un protocollo terapeutico che prevede l’utilizzazione del GnRH + l’associazione farmacologica
Naloxone e Calcio nella induzione della libido in arieti in controstagione, rivelando una efficacia superiore rispetto alla pur
valida somministrazione del solo GnRH esogeno.
Bibliografia -
Attali, B., Nah, S.Y., Vogel, Z. (1991). Phorbol ester pretreatment desensizes the inhibition of Ca++ channels induced by Kappa opiate,
alpha 2-adrenergich and muscarinic receptor agonist. J. Neurochem. 57 (5): 1803. Barenton, B., Pelletier, J. (1983). Seasonal changes in
testicular gonadotropin receptors and steroid content in the ram. Endocr. 112 (4):1441-1446. Cameron, A.W.N., Farnie, I.J., Curnow,
D.H., Keogh, E.J., Lindsay, D.R. (1984). The output of spermatozoa of naturally mated rams. Proc. 10th Int. Congr. On Anim.
Reprod. And A.I. Urbana –Champaign, USA, 266.Casavola, V., Guerra, L., Reshkin, S.J., Carmosino, M., Di Sole, F., Sciorsci,
R.L., Minoia P. (1996). The effect of Naloxone on intracellular calcium in epithelial cell systems. 1st World Congress on calcium and
Vitamin D in Human life. Roma, P11. Corteel, J.M. (1985). Le funzioni riproduttive del maschio. Atti S.I.S.Vet. 39 (II): 71-84. Evans,
W.S., Sollemberger, M.J., Vance, M.L. (1997). Ormoni ipotalamo-ipofisari. In: Brody, T.R. et al., (Eds) Farmacologia umana. Ed.
SES, Napoli. 41:544-555. Guaricci A.C., Albrizio M., Conte A., Maritato F., Dell’Aquila M.E., Zarrilli A., Sciorsci R.L., Minoia
P. (2002). Immunofluorescence detection of mu-opioid receptor on ram and buck spermatozoa. Reproduction in domestic animals, 37
(4): 235. Hardingam, G.E., Chawla, S., Johnson, C.M., Bading, H. (1997). Distinct functions of nuclear and cytoplasmatic calcium
in the control of gene expression. Nature 385: 260. Julius, D. (1997). Another opiate for the masses?. Nature, 386: 442. Kant, P.A.,
saxena, R.N. (1995). Effect of β-endorphin and naloxone on rat testicular steroidogenesis. Indian J. Exp. Biol. 33 (3): 165. Lacalandra,
G.M., Minoia, P., Ben Saad, A. (1994). Stimolazione con GnRH della libido dei becchi e conseguente comparsa dei calori in capre in
anestro stagionale. Atti S.I.P.A.O.C. XI, 342-346. Lacalandra, G.M., Sciorsci, R.L., Ricci, L., Minoia, P. (1997). Management de la
reproduccion de la capra Hircus. XXII Jornadas de la Societad Espanola de oviotecnica y caprinotecnica (S.E.O.C.), Tenerife-Canarie,
301-306. Larakis, K.E., Al Media, O.F.X., Hertz, A. (1986). Corticotropini-releasing factor (CRF) inhibits gonadotropin-releasinghormone (GnRH) release from superinfused rat hypothalamic cells in vitro. Brain Res. 377: 388-389. Lindsay, D.R., Pellettier, J.,
Pisselet, C., Courot, M. (1984). Changes in photoperiod and nutrition and effect on testicular growth of rams. J Reprod. Fert. 71: 351356. Lograno, M.D., Daniele, E., Sciorsci, R.L., Minoia, P. (1996). The opioid antagonist Naloxone controls L-type calcium channel
activity. 1st World Congress on calcium and Vitamin D in Human life. Roma, P12. Minoia, P., Ben Saad A., Lacalandra, G., Ismail,
M., Zarrilli, A. (1988). Stimolazione della libido nei becchi mediante la somministrazione di GnRH. Modificazioni comportamentali,
testicolari, seminali. In “Problematiche di Biologia, Fisiopatologia e Clinica della Riproduzione Animale. Quadrifoglio, Bari. 167-189.
Minoia, P., Sciorsci, R.L. (1994). Il ruolo del calcio nelle patologie endorfino-mediate. Meccanismi biologici, possibilità diagnostiche.
Orientamenti terapeutici. Atti Accademia Pugliese delle Scienze. Grafischena ed. Minoia, P., Sciorsci, R., Guerra, L., Di Sole, F.,
Rshkin, S.J., Casavola, V. (1997). Effetto del naloxone sul calcio e pH intracellulari in linee cellulari di origine renale. Atti S.I.S. Vet.
LI: 233-34. Page, C.P. (1997). In Integrated Pharmacology, Mosby, London. Speroff, L., Glass, R., Kase, N. (1980). Endocrinologia
ginecologica clinica e infertilità. Ermes. Milano. 28. Wang, J., Ren, M., Han, J. (1992). Mobilization of calcium from intracellular
stores as one of the mechanisms underlying the antiopioid effect of Cholecystokinin octapeptide. Peptides 13 (5): 947-51. Zorn, J.R.,
Bouchar, P., Fanizza, G., D’Amato, G. (1992). Induzione dell’ovulazione con triptolerina e gonadotropine. Monografia IPSEN,
Milano.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
135
INDAGINI ISTOCHIMICHE SUI GLICOCONIUGATI ELABORATI DALLE GHIANDOLE
DUODENALI E DALLE CELLULE MUCIPARE CALICIFORMI DUODENALI IN BUBALUS BUBALI
GLYCOCONJUGATES HISTOCHEMISTRY OF DUODENAL GLANDS AND DUODENAL GOBLET
CELLS IN BUBALUS BUBALI
*Verdiglione R., **Sarullo V., ***Gargano M., **Mammola C.L.
*Department of Animal Science, University of Padua, Italy; **Department STAFA
University of Reggio Calabria, Italy; ***Professional man
Riassunto
Lo scopo principale di questo lavoro è stato quello di studiare la natura dei glicoconiugati elaborati dalle ghiandole duodenali
e dalle cellule mucipare caliciformi nel bufalo. Campioni di mucosa intestinale, prelevati da 10 bufali maschi di circa 13
mesi d’età, sono stati fissati ed inclusi in paraffina. Sezioni seriate sono state sottoposte a metodiche d’istochimica classica
per lo studio dei glicoconiugati (PAS, Alcian blu, HID), mentre i residui glucidici presenti sulle catene oligosaccaridiche
laterali sono stati studiati con l’ausilio di alcune lectine biotinilate (GS-I-B4, RCA-I, PNA, WGA, UEA-I, ConA, GNA,
LPA). Le metodiche impiegate hanno messo in luce che sia le ghiandole duodenali sia le cellule caliciformi elaborano
glicoconiugati di natura neutra. Le cellule caliciformi tuttavia appaiono particolarmente ricche anche di glicoconiugati
acidi per la presenza di gruppi carbossilici e solforici. Anche nelle ghiandole duodenali è presente una componente acida,
ma in quantità limitata e localizzata nelle parti terminali dei corpi ghiandolari. L’istochimica delle lectine ha dimostrato
che il secreto delle cellule caliciformi e quello delle ghiandole duodenali contiengono glicoproteine di tipo O-legato ed Nlegato; in particolare nelle ghiandole duodenali il maggior contributo nella produzione di glicoproteine del tipo O-legato
è imputabile alle cellule localizzate nei tratti terminali. In conclusione il secreto elaborato dalle ghiandole duodenali del
bufalo consiste in un muco viscoso, simile per vari aspetti a quello elaborato dalle cellule caliciformi, che svolge un ruolo
importante nella protezione della mucosa duodenale dall’acidità del chimo gastrico. La complessità della composizione
chimica del secreto, inoltre, suggerisce, anche in questa specie, una possibile funzione delle ghiandole duodenali nell’ambito
dei processi digestivi (Skutelsky et al., 1989; Takehana et al., 1989; Antonov et al., 1992; Zamolodchikova et al., 1997).
Introduzione
I contenuti di questa nota congressuale, rappresentano una selezione dei numerosi dati da noi ottenuti nello studio
morfologico ed istochimico delle ghiandole intraparietali dell’apparato digerente. L’intento è quello di mettere a
confronto, nel bufalo, come già fatto da alcuni autori in altri animali (Burkl, 1950; Sheahan et al., 1976; Poddar and
Jacob, 1979; Ohwada e Susuki, 1992; Verdiglione et al., 2000), la natura del secreto elaborato dalle ghiandole duodenali
con quello prodotto dalle cellule mucipare caliciformi. Le ghiandole duodenali del bufalo si presentano, da un punto
di vista morfologico, simili a quelle del bovino (Takehana et al., 1991; Verdiglione et al., 2002). Trattasi, anche per
il bufalo, di ghiandole tubulari ramificate a prevalente localizzazione sottomucosa; negli adenomeri tubulari, la cui
estremità si presenta talora dilatata a forma di alveolo, si possono distinguere due porzioni: una corrispondente al fondo
dell’adenomero e collocata nell’area periferica del lobulo -parte terminale- ed una immediatamente precedente -parte
preterminale- rivolta verso la porzione centrale del lobulo e terminante nel condotto escretore.
Materiali e metodi
Sono stati utilizzati 10 bufali maschi di circa 13 mesi di età provenienti dal pubblico macello. Campioni di parete
duodenale sono stati prelevati, immediatamente dopo l’abbattimento degli animali, a livello del tratto craniale del duodeno
a distanza di circa 50 cm dal piloro , fissati nei liquidi B4G (bicloruro di mercurio 6% in sodio acetato 1% contenente
glutaraldeide allo 0.1%) e formolo calcio acetato (formalina al 10% contenente calcio acetato al 2%) e successivamente
inclusi in paraffina. Sulle sezioni seriate di 4-5 μm di spessore sono state eseguite le tecniche istochimiche per lo studio
dei glicoconiugati (PAS, Alcian blu a pH 1 e 2.5, Alcian blu/PAS, High Iron Diamine (Spicer, 1965) e HID/Alcian blu).
Per l’identificazione dei residui glucidici delle catene laterali oligosaccaridiche sono state utilizzate le lectine biotinilate:
GS-I-B4 => Α-D-Gal; RCA-I => �-Gal; PNA=> D-Gal β-(1-3)-D-GalNac, WGA=> β-(1-4)-D-GlcNac> NeuAc; WGA
succinilata=> β-(1-4)-D-GlcNac; UEA-I=>α-L-Fuc, ConA=>α-D-Man> α-D-Glc >α-D-GlcNac; GNA=> Man α(13)-Man, LPA=> NeuAc> D-GlcNac. Per alcune lectine (RCA-I, PNA) la reazione è stata preceduta da digestione degli
eventuali residui di acido sialico mediante incubazione a t° ambiente per 18 ore in tampone acetato pH 5.5 contenente 0,1
U/ml di neuraminidasi (tipo X della Sigma, estratta da Clostridium perfrigens). Sono stati, infine, eseguiti controlli della
specificità di legame delle lectine mediante l’impiego di zuccheri inibitori.
Risultati - Morfologia
Le ghiandole del Brunner, particolarmente abbondanti nella parte craniale del duodeno, si estendono lungo tutto questo
segmento dell’intestino e si possono rinvenire, in forma di piccoli ammassi isolati, anche nella prima metà del digiuno.
Trattasi di ghiandole tubulari ramificate solitamente allogate nello spessore della sottomucosa e solo alcune appaiono
collocate nella parte profonda della mucosa. I loro condotti escretori attraversano solitamente la muscularis mucosae e si
aprono in una ghiandola intestinale oppure in una fossetta superficiale. Appaiono organizzate in lobuli separati da una ben
definita trama connettivale. Presentano una membrana basale sulla quale poggia un singolo strato di cellule prismatiche.
Nel corpo ghiandolare è possibile distinguere un tratto terminale (t), collocato alla periferia del lobulo, costituito da
cellule alte con citoplasma granulare e nucleo sferico in posizione basale; in tali tratti spesso è possibile osservare elementi
con citoplasma chiaro e nucleo schiacciato in posizione basale. A questo fa seguito un tratto preterminale (pt) che si
continua nel dotto escretore (ce): entrambi risultano localizzati nella porzione centrale del lobulo e sono formati da
cellule più basse delle precedenti e caratterizzate da citoplasma finemente granulare e nucleo sferico basale.
Istochimica classica
Tutto il corpo ghiandolare mostra una forte affinità per la PAS: una colorazione rosso magenta marca l’area golgiana
136
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
e una stretta fascia apicale. In alcune cellule dei tratti t risulta marcato tutto il citoplasma sovranucleare. Le cellule
caliciformi appaiono intensamente colorate mentre nella parte apicale degli enterociti una colorazione rosata è appena
apprezzabile. I quadri ottenuti con l’Alcian blu mostrano una netta differenza nella risposta tra i due tratti: l’alcianofilia
risulta assente nei tratti preterminali e nelle cellule dei dotti escretori mentre compare, seppur in maniera discontinua, in
t, in prevalenza nelle parti più profonde del lobulo. Le cellule mucipare caliciformi si colorano intensamente. La risposta
alle diammine risulta decisamente negativa nelle aree centrali dei lobuli mentre varia da negativa ad intensa nella zona
periferica degli stessi, nei quali pochi gruppetti di cellule, tutte appartenenti ai tratti terminali e localizzate in profondità,
hanno assunto il bruno delle diammine. La risposta all’HID/AB riassume il quadro osservato singolarmente ed evidenzia
che solo alcune delle cellule alcianofile sono anche HID-positive.
Istochimica delle lectine.
Tutte le lectine biotinilate utilizzate hanno mostrano affinità per le ghiandole del Brunner. GS-I-B4 - La risposta è estesa a
tutto il corpo ghiandolare (Fig. 1). La teca delle cellule caliciformi non sembra interessata dalla colorazione, mentre minuti
granuli sono sparsi nel citoplasma degli enterociti che appaiono inoltre fortemente marcati nella parte apicale. RCA-I
- Nel citoplasma delle cellule sono sparsi uniformemente minuscoli granuli più intensamente colorati a livello delle aree
periferiche; cellule caliciformi ed enterociti rispondono vivacemente alla lectina. Il pretrattamento con neuraminidasi
sembra non aver modificato la risposta. PNA – In tutta la ghiandola si evidenzia una risposta positiva (Fig. 2). Le
cellule caliciformi assumono una colorazione da moderata ad intensa: rispondono maggiormente quelle adluminali; negli
enterociti appare marcata l’area golgiana. Il pretrattamento con neuraminidasi sembra non aver modificato la risposta.
WGA - La colorazione interessa tutto il corpo ghiandolare; le cellule caliciformi appaiono intensamente positive mentre
è minore l’affinità degli enterociti. WGAsucc – L’intero corpo ghiandolare risponde positivamente (Fig. 3). Le cellule
caliciformi si colorano molto intensamente, mentre negli enterociti appaiono marcati l’area golgiana ed il plasmalemma
apicale. UEA-I – Si evidenzia una colorazione estesa a tutto il corpo ghiandolare (Fig. 4). Le cellule caliciformi si colorano
molto vivacemente; negli enterociti minuti granuli sono sparsi nel citoplasma sopranucleare mentre il plasmalemma
apicale appare fortemente marcato. ConA - In pt è marcata l’area basale perinucleare, i tratti t talvolta presentano una
colorazione più intensa e diffusa. Le cellule caliciformi sono interessate da una colorazione di intensità variabile; minuti
granuli interessano anche gli enterociti. GNA - La risposta appare positiva sotto forma di granuli diffusi ma maggiormente
concentrati nell’area perinucleare; appaiono marcati i contorni cellulari basali e laterali. Le cellule caliciformi sembrano
non legare questa lectina, mentre negli enterociti minuti granuli appaiono sparsi nel citoplasma. LPA - La risposta è molto
lieve, sottoforma di minuti granuli diffusi; la concentrazione è maggiore nei tratti t. Le cellule caliciformi appaiono non
colorate, una colorazione bruna appena percettibile caratterizza gli enterociti.
Tabella 1. Risposta alle lectine nelle ghiandole duodenali e nelle cellule caliciformi duodenali
Lectine
Tratti terminali
Tratti preterminali
e dotti escretori
Cellule mucipare
caliciformi
Enterociti
GS-I-B4
+/++
+
-/-+
++++ ap
RCAI
++
+
++++
++/+++ ag
PNA
+++
++
++/+++
+ag
WGA
++/+++
++/+++
++++
++/+++ag
WGAsucc
+++
++b
++++
++/+++ag
UEA-I
+++/++++
-/+++
++++
+
Con A
+++
++pn
++/+++
++/+++
GNA
++pn
++pn b
-/-+
+
Intensità: - = negativa; -+ = molto lieve; + = lieve; ++ = moderata; +++ = intensa; ++++ molto intensa
Localizzazione: ap= apicale; b= basale; pn= perinucleare; ep= epinucleare; ag= area golgiana; quando non indicato la colorazione è estesa
a tutto il citoplasma.
Discussione e conclusioni
Le ghiandole duodenali sono state generalmente classificate come ghiandole mucose, e ciò, soprattutto a causa del loro
secreto viscoso, particolarmente ricco di glicoconiugati, riportato come del tutto privo di enzimi digestivi. Le numerose
ricerche di ordine istologico, istochimico e ultrastrututturale, hanno consentito di scoprire, soprattutto con le tecniche
istochimiche e ultrastrututturali, notevoli e significative differenze tra le varie specie. I dati della letteratura segnalano la
presenza di elementi tipicamente mucosi nella cavia e nell’Uomo (Cochrane, 1964; Leeson e Leeson, 1968); di tipo sieroso
nel coniglio e nel cavallo (Leeson e Leeson, 1967; Takehana et al., 1991). Le cellule hanno le caratteristiche ultrastrutturali
dei citotipi mucoso e sieroso, nel gatto, nel topo e nell’echidna (Oduor-Okelo, 1976; Friend, 1965; Leeson e Leeson, 1966;
Krause, 1970, 1971). Nelle ghiandole del maiale, la porzione terminale dei tubuli appare costituita da cellule sieromucose
con granuli di secreto contenenti un “core” elettrondenso, reattivi alle tecniche istochimiche per i mucopolisaccaridi neutri
e acidi, per radicali solforici e carbossilici (Takehana et al., 1994). Le ghiandole del bovino, infine, sono caratterizzate
dalla presenza di due distinti citotipi: cellule sierose, che elaborano glicoconiugati neutri e occupano i tratti pt, e cellule a
prevalente natura mucosa, che elaborano glicoconiugati neutri e acidi per radicali carbossilici e solforici, localizzate nei tratti
t (Verdiglione et al., 2002). Da un punto di vista morfologico le ghiandole duodenali del bufalo presentano alcune analogie
con quelle del bovino. Le metodiche morfologiche non ci hanno permesso di osservare una netta distinzione tra tratti pt
e t come nel bovino, tuttavia nei fondi delle ghiandole, diversamente che nel resto della ghiandola, sono stati individuati
degli elementi con l’aspetto tipicamente mucoso. L’analisi istochimica del secreto elaborato dalle ghiandole duodenali del
bufalo ha indicato che esse elaborano glicoconiugati di natura prevalentemente neutra; solo alcuni elementi dei fondi delle
ghiandole, soprattutto quelli posti più in profondità, producono glicoconiugati acidi per la presenza di gruppi carbossilici
mentre sparuti elementi producono anche glicoconiugati acidi per gruppi solforici. L’istochimica delle lectine ha permesso
di identificare alcuni residui glucidici terminali e/o interni alle catene oligosaccaridiche. Sotto questo aspetto i tratti t
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
137
presentano una particolare eterogeneità essendo risultati ricchi in residui terminali di �-L-Fuc, D-Gal β-(1-3)-D-GalNac, ΑD-Gal, β-Gal, NeuAc; sono stati anche individuati residui di β-(1-4)-D-GlcNac in posizione terminale e interni alla catena
e residui di α-D-Man e mannosio ramificato [Man α(1-3)-Man]. Le catene oligosaccaridiche dei glicoconiugati delle cellule
dei tratti pt presentano una minore eterogeneità, differenziandosi dai precedenti per la minor presenza di residui di Gal,
per la discontinua presenza di residui di Fuc e per l’assenza di residui di NeuAc. In conclusione le ghiandole duodenali del
bufalo elaborano glicoproteine del tipo N-legato ed O-legato, quest’ultima componente appare maggiormente elaborata dai
tratti t. Le cellule mucipare caliciformi elaborano glicoconiugati neutri e acidi per gruppi carbossilici e solforici; esse sono
risultate particolarmente ricche di tutti i residui glucidici indagati con l’esclusione dei residui di α-D-Gal e di mannosio
ramificato. Il secreto delle cellule caliciformi quindi, presenta delle differenze rispetto a quello delle ghiandole duodenali
probabilmente in relazione ad un possibile ruolo di queste ultime nei processi digestivi intestinali. A questo riguardo va
ricordato che nei fondi delle ghiandole duodenali del cavallo è stata isolata una lipasi mentre nei tratti t delle ghiandole del
bovino è stata identificata la duodenasi, enzima che agirebbe svolgendo un ruolo funzionale attivando la proenteropeptidasi
in enteropeptidasi e quindi dando il via alla cascata di enzimi proteolitici pancreatici (Zamolodchikova et al., 1997).
Fig.1 – GS-I-B4 335X- Una risposta positiva, variabile da lieve a moderata, interessa tutto il corpo ghiandolare. Minuti granuli
di precipitato sono sparsi in tutto il citoplasma sopranucleare e, in alcuni casi, concentrati a livello dell’area golgiana. In diversi
adenomeri la colorazione nelle cellule dei tratti pt appare meno estesa.
Fig.1 – PNA 225X- La risposta a questa lectina è positiva in tutto il corpo ghiandolare, ma appare variabile tanto per intensità
quanto per estensione: risulta più concentrata nei tratti terminali.
Fig.1 – WGAsuccinilata 225X- Tutto il corpo ghiandolare è interessato da una colorazione intensa, localizzata nell’area basale
delle cellule, più concentrata in t.
138
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Fig.1 – UEA-I 88X- La risposta è positiva in tutto il corpo ghiandolare ma in pt la positività appare discontinua: generalmente
l’intensità e l’estensione della colorazione sono maggiori in t.
Bibliografia
Antonov VK, Vorotyntseva TI and Zamolodchikova TS (1992) Duodenase – a new serine proteinase of unusual specificity. Dokl Acad
Nauk 324: 1328-1322
Burkl W (1950) Untersuchungen über die Pylorus-und Duodenaldrüsen. Z mikr-anat Forsch 56: 327-414
Cochrane W, Davies DV, Palfrey AJ and Stochwell RA (1964) The histochemistry and electron microscopy of Brunner’s glands in the
Guinea pig. J Anat 98: 1-10
Friend DS (1965) The fine structure of Brunner’s glands in the mouse. J Cell Biol 25: 563-576
Krause WJ (1970) Brunner’s glands of Echidna. Anat Rec 167: 473-488
Krause WJ (1971) Brunner’s glands of duckbilled platypus (Ornithorhyncus anatinus). Am J Anat 132: 147-166
Leeson CR and Leeson TS (1966) The fine structure of Brunner’s glands in the rat. Anat Rec 156: 253-267
Leeson CR and Leeson TS (1967) The fine structure of Brunner’s glands in the rabbit. Anat Rec 159: 409-420
Leeson CR and Leeson TS (1968) The fine structure of Brunner’s glands in the man. J Anat 103: 263-276
Oduor-Okelo D (1976) Histochemistry of the duodenal glands of the cat and horse. Acta Anat 94: 449-456
Ohwada S and Suzuki H (1992) Lectin Histochemistry on the Brunner’s Glands of Domestic Ruminants. Tohoku J Agricultural
Research 42: 55-66
Poddar S and Jacob S (1979) Mucosubstances histochemistry of Brunner’s glands, pyloric glands and duodenal goblet cells in the ferret.
Histochemistry 65: 67-81
Sheahan DG and Jervis HR (1976) Comparative histochemistry of gastrointestinal mucosubstances. Am J Anat 146: 103-132
Skutelsky E, Moore RP and Alroy J (1989) Lectin histochemistry of mammalian Brunner’s glands. Histochemistry 90: 383-390
Spicer SS (1965) Diamine methods for differentiating mucopolysaccharides histochemically. J Histochem Cytochem 13: 211-234
Takehana K, Abe M, Iwasa K, Hiraga T and (1989) Histochemistry of complex carbohydrates in the horse duodenal glands. Jpn J Vet
Sci 51 (5):909-915
Takehana K, Abe M, Iwasa K, Hiraga T and Miyata H (1991) Carbohydrate Histochemistry of Bovine Duodenal Glands. J Veterinary
Medical Science 53 (4): 699-706
Takehana K, Abe M, Yamaguchi M, Iwasa K, Hiraga T, Mastj J, Miyata H and Yamada O (1994) Ultrafytochemistry of glycoconjugates
in pig duodenal gland. Ann Anat 176: 565-570
Verdiglione R, Mammola CL, Salpietro L and Filotto U (2000) Osservazioni comparative sul secreto delle ghiandole piloriche e duodenali
e delle cellule mucipare caliciformi. Indagini istochimiche nel bovino. Atti LVII Congr S.I.S.Vet. 28-30 settembre 2000
Verdiglione R, Mammola CL and Filotto U (2002) Glycoconjugates histochemistry of bovine Brunner glands. Annals of Anatomy 184:
61-69
Zamolodchikova TS, Vorotyntseva TI and Antonov VK (1995) Duodenase: a serine proteinase of unusual specificity from bovine
duodenal mucose. Purification and properties. Eur J Biochem 227: 866-872.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
139
RILIEVI ISTOPATOLOGICI ED IMMUNOISTOCHIMICI SU TESSUTI FISSATI I FORMALINA
E INCLUSI IN PARAFFINA DI PECORE INFETTATE SPERIMENTALMENTE CON
MYCOPLASMA AGALACTIAE
Rocca S., Pirino S., Antuofermo E,. Chiarolini A., *Tola S., *Leori G..
-Istituto di Patologia Generale Anatomia Patologica e Clinica Ostetrico-Chirurgica Veterinaria
07100 Sassari Tel: 079-229515 Fax: 079 229415, e mail: [email protected]
*Istituto Zooprofilatto Sperimentale della Sardegna “G. Pegreffi”,
07100 Sassari. Tel: 079-216914, Fax:079-219477, e-mail: [email protected]
Riassunto
In questo lavoro abbiamo esaminato dei campioni di tessuto provenienti da un gruppo di sette pecore sottoposte ad infezione
sperimentale. Dopo un periodo di acclimatamento di due settimane, due soggetti sono stati sottoposti ad infezione per
via intracanalicolare con un pool di Mycoplasma agalactiae. I controlli si sono ammalati naturalmente dopo circa 10gg
dall’infezione strumentale.
L’infezione è stata confermata dalla sintomatologia clinica mentre l’identificazione del batterio è stata effettuata mediante
PCR. Dopo aver monitorato la sintomatologia per circa due mesi si è proceduto sui soggetti all’esame autoptico previa
eutanasia. Sono stati eseguiti prelievi per esami isto-patologici dai diversi organi bersaglio della malattia. I tessuti sono
stati fissati in formolo, inclusi in paraffina, sezionati e colorati con ematossilina-eosina. L’osservazione, oltre che mirata
ad accertare la presenza dell’infezione e a chiarirne i quadri patologici eventualmente presenti, è stata condotta con lo
scopo di valutarne anche l’entità. Parallelamente si procedeva all’indagine immunoistochimica; come anticorpo primario
si è utilizzato un siero iperimmune ottenuto da pecore infettate naturalmente ed un antisiero specifico contro la proteina
immunodominante p80 del M. agalactiae prodotto in agnello.
Con tali metodiche è stato possibile mettere in evidenza la presenza del M. agalactiae in vari tessuti e correlarla ai processi
infiammatori-degenerativi riscontrati
Introduzione
L’agalassia contagiosa (A.C.) è una delle malattie più gravi tra quelle che colpiscono i piccoli ruminanti, considerata
endemica nella maggior parte dei paesi mediterranei. L’agente eziologico è il M. agalactiae.
L’A.C. ha fatto la sua comparsa in Sardegna nel 1980 nella provincia di Cagliari, presumibilmente in seguito all’Introduzione
di ovini portatori-eliminatori provenienti dalla Sicilia (Leori, 1985).
Purtroppo una serie di fattori concomitanti (pascolo in comune, scambio incontrollato di animali e un’insufficiente
adozione di misure di polizia veterinaria) ha permesso una diffusione pressoché incontrollata dell’infezione, con un danno
economico enorme per l’economia isolana.
Nei primi anni la malattia si è manifestata con una sintomatologia iperacuta e acuta (agalassia, mastite, cheratite, artrite)
mentre negli ultimi anni si è osservata una progressiva attenuazione, e in alcuni casi la scomparsa di sintomi quali la
cheratite e l’artrite a significare che la malattia, anche in Sardegna, va assumendo i caratteri della forma enzootica.
In questo lavoro, abbiamo voluto intraprendere uno studio sugli attuali ceppi batterici isolati nei focolai, verificare la validità
di un test immunoistochimico, con lo scopo di evidenziare l’agente eziologico sui tessuti e la sua precisa localizzazione.
In assenza di anticorpi specifici contro il M. agalactiae distribuiti commercialmente, abbiamo voluto utilizzare dei sieri
monospecifici policlonali prodotti in agnello, sviluppati appositamente per lo studio di due delle principali proteine
immnunodominanti del M. agalactiae, la P80 e la P55 (Tola at al, 2001).
Tale metodica permette l’evidenziazione selettiva delle strutture coinvolte nelle lesioni e delle varie tipologie cellulari
coinvolte.
Materiali e metodi
Ceppi utilizzati e condizioni di crescita. Sono stati utilizzati dei ceppi di M. agalactiae isolati da alcuni focolai di malattia
presenti dell’isola con i quali è stato costituito un pool. I micoplasmi sono stati messi a crescere in terreno di Hayflick
modificato fino alla fase logaritmica di crescita e successivamente sottoposti a centrifugazione e lavaggio con un buffer
salino (PBS, 0.1 M phosphate, 0.33 M NaCl, pH 7.4). Dopodiché sono stati preparati gli inoculi da somministrare per via
intracanalicolare, agli animali sottoposti all’esperimento, ad una concentrazione di 107 CCU.
Infezione sperimentale. Sette pecore di razza sarda di circa 3-4 anni di età, negative al M. agalactiae, sono state trasferite
nel paddock dell’Istituto di Patologia Generale e Anatomia Patologica della Facoltà di Medicina Veterinaria di Sassari. Il
paddock e le attrezzature ivi inserite rispondevano al DLgs 116 del 27 gennaio 92 riguardante “ Attuazione della direttiva
n° 86/609/CEE in materia di protezione degli animali utilizzati a fini sperimentali od altri fini scientifici”.
L’acclimatamento in stabulazione fissa è durato circa tre settimane. Durante tutta la sperimentazione, le pecore sono state
alimentate con mangime Unipellet della Martini Mangimi.
Due delle sette pecore sono state infettate con un pool di micoplasmi per via intracanalicolare con 107 CCU di micoplasmi,
dopo circa 4-5 giorni comparivano i primi sintomi della malattia e dopo circa 10 gg, anche le restanti cinque pecore
presentarono la classica sintomatologia. La diagnosi è stata confermata mediante PCR (Tola et al., 1996) e semina su
Agar Hayflick. A tutte le pecore infettate sono stati effettuati, quotidianamente, i rilievi termometrici e prelievi di sangue
e si è osservata la sintomatologia clinica per circa 60gg. Al termine dell’esperimento gli animali sono stati sottoposti ad
eutanasia.
Produzione degli anticorpi monospecifici. Per la produzione degli anticorpi monospecifici sono state isolate e purificate le
140
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
proteine P80 e P55 mediante SDS-Page. Le proteine sono state successivamente concentrate mediante elettroeluizione. Gli
inoculi contenenti le proteine furono preparati su un volume di 200μl addizionati con adiuvante completo di Freund.
I soggetti utilizzati per l’immunizzazione erano agnelli di razza sarda di circa 45 gg di età precedentemente controllati per
verificarne la loro sieronegatività. Si sono effettuate due inoculazioni a distanza di 10gg l’una dall’altra e una volta verificata
la produzione degli anticorpi si proceduto al salasso degli animali e la conservazione del siero.
Processazione dei tessuti e colorazione istochimica. Dopo l’abbattimento degli animali e la successiva indagine autoptica, si
è proceduto al prelievo di campioni provenienti da diversi organi. Abbiamo quindi preso in considerazione il parenchima
mammario, la cisterna del latte, i linfonodi sopramammari, le capsule articolari e le guaine, il fegato, la milza, il polmone,
il cervello e infine l’intestino.
Tutti campioni sono stati fissati in formalina al 10% tamponata, inclusi in paraffina e tagliati ad uno spessore di 3 μm. Le
sezioni sono state colorate con Ematossilina ed Eosina.
Reazione immunoistochimica. Per la reazione d’immunoistochimica sono state utilizzate sezioni di spessore di 3 μm,
sparaffinate e reidratate, quindi sottoposte allo smascheramento degli antigeni mediante forno a microonde, in tampone
citrato pH 6, con 2 cicli di 7 e 4 minuti rispettivamente a 700 e 900 Watt; si è proceduto quindi all’inibizione delle
perossidasi endogene con un trattamento in H2O2 al 3%.
I lavaggi venivano effettuati con PBS addizionato con siero-albumina bovina allo 0.1% per eliminare eventuale segnale
aspecifico. Dopo la fase di saturazione si è proceduto all’incubazione delle sezioni con l’anticorpo primario (pool costituito
dal siero anti-P80 e anti-P55) alla diluizione 1: 800. In seguito, sono state incubate con l’anticorpo secondario monoclonale
(anti-sheep) biotinilato ad una diluizione di 1: 200.
Lo sviluppo della reazione è stato effettuato con l’utilizzo del cromogeno diaminobenzidina (DAB). I vetrini venivano
quindi contrastati con Emallume di Harris.
Risultati e conclusioni
Dopo circa 10 gg dall’infezione sperimentale tutti gli animali hanno presentato sintomi della malattia, con calo della
produzione lattea, edema della mammella ed ingrossamento linfonodale. Il latte si presentava sieroso con precipitazione
delle caseine in fiocchi biancastri. In taluni soggetti si è riscontrato anche del secreto siero-emorragico.
In due soggetti si è potuto osservare, durante il periodo finale dell’esperimento, anche la comparsa dei primi segni di artrite
con edema delle articolazioni cruro-tarsica e radio-carpica
La diagnosi di A.C. è stata poi confermata mediante identificazione del M. agalactiae mediante PCR e semina su terreno di
Hayflick. Dopo un periodo complessivo di circa 60 gg, si è proceduto con l’abbattimento degli animali mediante eutanasia.
All’esame anatomo-patologico si é riscontrato a carico della mammella le lesioni tipiche di una mastite cronica con aree di
necrosi e di ectasia acino-duttale. Il secreto latteo appariva sieroso e a tratti coagulato all’interno dei lumi ghiandolari. In
stadi più avanzati l’organo appariva consistente per una incipiente fibrosi e sequestro delle aree necrotiche. La cisterna e i
grossi dotti presentavano una superficie deformata da rilievi nodulari di colore bianco-giallastro con contenuto di secreto
latteo frammisti a floculi biancastri. A carico dei linfonodi si è riscontrato una marcata linfadenite. Istologicamente abbiamo
potuto osservare, un essudato alveolo-duttale con caratteristiche siero-fibrinosa con tendenza alla disepitelizzazione degli
alveoli con una massiccia presenza di elementi epiteliali frammisti a neutrofili e macrofagi. Inoltre abbiamo osservato
un rilevante infiltrato linfoplasmocitario lungo gli interstizi, negli spazi e nei setti interlobulari; nonché fenomeni di
degenerazione e necrosi e numerosi macrofagi. A carico dei linfonodi abbiamo osservato edema, congestione e iperreatività
follicolare e presenza di un cospicuo contingente macrofagico. Per ciò che concerne le osservazioni effettuate sui preparati
sottoposti ad immunoistochimica si è osservata una spiccata positività lungo tutti gli epiteli con particolare riferimento
alle cellule degli alveoli e dei dotti galattofori. Una intensa positività citoplasmatica è stata osservata a carico dei neutrofili
e macrofagi presenti nei dotti e negli interstizi, anche il secreto nei lumi alveolari presentava una segnale evidente, segno di
una massiccia presenza di micoplasmi.
A carico dei linfonodi si è potuta osservare un’interessante positività citoplasmatica a carico dei macrofagi presenti nei seni,
segno questo di un’intensa attività immunitaria impegnata nel riconoscimento dell’agente patogeno.
Dalle osservazioni da noi effettuate, si può affermare, che il micoplasma è un’agente di malattia che coinvolge totalmente
sia il parenchima mammario determinando lesioni a carico delle strutture funzionali dell’organo, sia il sistema immunitario
nelle fasi precoci e tardive della malattia.
E’ stato possibile verificare la validità del test immnunoistochimico per meglio comprendere la patogenesi che coinvolge
la mammella durante le fasi della malattia. Così pure gli anticorpi utilizzati si sono rivelati essere un valido strumento per
diagnostica istopatologica nelle infezioni da M. agalactiae.
Bibliografia
Ausubel F. et al., (1993) Current protocols in molecular biology. Wiley Interscience – Laemmli, UK. (1970) Nature 227: 680-685.Leori et al., (1998) Mycoplasmas of ruminants:pathogenicity, diagnostics, epidemiology and molecular genetics. EUR 18018/COST,
pp 98-101.- Sambrook J. et al. (1989) Cold Spring Harbor Lab.,N.Y.- Tola S. et al., (1997) FEMS Microbiol. Letters 154: 355-362.
- Tola et al., (2001) FEMS Microbiol. Letters 202: 45-50. – F. Rodriguez et al. (2002) Immunohistochemical dectection of Mycoplasma
agalactiae in formalin-fixed, paraffin-embedded tissues from naturaly and experimentaly infected goats J. Vet. Med. B 49, 226-229 Rodriguez F et al. (2000) Immunohistochemical characterization of lung lesions induced experimentally by Mycoplasma agalactiae and
Mycoplasma bovis in goats. J Comp Pathol. Nov;123(4):285-93.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
141
DOCUMENTAZIONE FOTOGRAFICA
1
2
3
4
5
6
7
8
9
10
11
12
13
142
14
15
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
DIDASCALIE FOTO
Foto 1 Istochimica - Mastite da M. agalactiae, diffuso infiltrato linfo-plasmocellulare. E.E. 4 X.
Foto 2 Istochimica - Mastite da M. agalactiae, degenerazione e desquamazione dell’epitelio ghiandolare, infiltrato linfoplasmocellulare. E.E. 10 X.
Foto 3 Istochimica - Mastite da M. agalactiae, ingrandimento della precedente. E.E. 40 X.
Foto 4 Istochimica - Mastite da M. agalactiae, desquamazione dell’epitelio ghiandolare. E.E. 40 X.
Foto 5 IHC - Mastite da M. agalactiae, positività alveolo-duttale all’anticorpo policlonale (anti P80 e anti P55) 4 X.
Foto 6 IHC - Mastite da M. agalactiae, espressione dell’anticorpo policlonale (anti P80 e anti P55) sulla superficie delle
cellule epiteliali di un grosso dotto galattoforo. 20 X.
Foto 7 IHC - Mastite da M. agalactiae, ingrandimento della precedente 40 X.
Foto 8 IHC - Mastite da M. agalactiae, strutture alveolo-duttali ripiene di secreto ricco di M. agalactiae 40 X
Foto 9 IHC - Mastite da M. agalactiae grosso dotto galattoforo con positività all’anticorpo policlonale (anti P80 e anti P55)
ben evidente 4 X.
Foto 10 IHC - Mastite da M. agalactiae, particolare della precedente 40 X
Foto 11 Istochimica - linfonodo sopra mammario, iperreattività follicolare. E.E. 4 X.
Foto 12 Istochimica - linfonodo sopra mammario, presenza di un cospicuo contingente macrofagico E.E. 10 X.
Foto 13, 14 IHC - linfonodo sopra mammario, numerosi macrofagi positivi all’anticorpo policlonale (anti P80 e anti P55)
40 X
Foto 15 IHC - linfonodo sopra mammario, particolare della precedente 100 X
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
143
IL CARCINOMA MAMMARIO A CELLULE SQUAMOSE DELL’OVINO SARDO
Antuofermo E., Pirino S., Rocca S., Idili S., Leoni A., Nieddu A.M..
(Istituto di Patologia Generale Anatomia Patologica e Clinica Ostetrico-Chirurgica Veterinaria,
07100 Sassari -Tel: 079-229515 -Fax: 079 229415, -e mail: [email protected] )
Riassunto
Il carcinoma squamo-cellulare si presenta nell’ovino in varie aree cutanee, solitamente rappresentate da regione nasale,
orecchio, occhio, vulva e cute della mammella.
I contributi casistici risultano tuttavia scarsi soprattutto per quanto attiene la regione mammaria. Abbiamo pertanto
condotto un’indagine sistematica volta a caratterizzarne gli aspetti patomorfologici, utilizzando, allo scopo, reperti di
macellazione provenienti dal Nord-Sardegna. I prelievi sono stati processati con tecniche generali e speciali e sottoposti
a tests immunoistochimici e ultrastrutturali. In tutti i casi osservati, il carcinoma non è mai giunto a coinvolgere il
parenchima mammario, manifestando tuttavia aspetti di differente invasività. In alcuni casi, il tumore si presentava, infatti,
relativamente ben differenziato, con presenza di perle cornee e limitata estensione sottocutanea; in altri, si apprezzavano
invece cordoni solidi di cheratinociti atipici e comportamento marcatamente infiltrante. Lo studio della progressione del
carcinoma squamocellulare in sede mammaria, è tuttavia limitato, in condizioni naturali, dalla breve vita produttiva e dalla
rapida eliminazione dall’allevamento dei soggetti colpiti.
Introduzione:
Nell’ambito di uno studio volto ad evidenziare, descrivere e classificare la patologia mammaria negli ovini della Sardegna,
venivano controllate 361 mammelle di soggetti regolarmente macellati presso il pubblico macello di Chilivani (Sassari).
Gli organi, sottoposti ad un primo esame in loco, allorché riscontrati in preda ad alterazioni patologiche, venivano
condotti presso il nostro Istituto per ulteriori accertamenti di tipo macroscopico e per l’eventuale successiva processazione
istologica.
Il riscontro di lesioni cutanee è stato relativamente infrequente: solo n° otto organi presentavano alterazioni di vario grado
ed estensione; in cinque casi, i soggetti erano stati sottoposti a caudectomia. Poiché l’aspetto macroscopico richiamava
patologie di tipo neoplastico, abbiamo ritenuto utile effettuare, sui predetti campioni, una serie di accertamenti volti a
inquadrarne le caratteristiche istopatomorfologiche, immunoistochimiche ed elettromicroscopiche, che saranno oggetto
del presente lavoro.
Materiali e metodi:
Dalle otto mammelle che presentavano lesioni cutanee, sono stati eseguiti prelievi bioptici. Il materiale biologico è stato
fissato in formalina al 10% tamponata, incluso in paraffina, successivamente sezionato a 4 μ di spessore, infine colorato
con Ematossilina Eosina, P.A.S., Azan Mallory e Polycrom.
Il materiale inoltre è stato sottoposto a processazione immunoistochimica mediante l’impiego della tecnica dell’
immunoperossidasi. Allo scopo le sezioni sparaffinate sono state incubate overnight a temperatura ambiente con l’anticorpo
primario monoclonale anti-Pan citocheratina, clone (AE1\AE3), alla diluizione 1:300, con lo scopo di evidenziare tutte le
cellule epiteliali.
Al fine di render liberi i determinanti antigenici presenti sulle cellule, mascherati dai ponti creati dal formolo, prima di
procedere alla processazione con l’anticorpo anti Pan citocheratina i campioni sono stati preincubati, previa digestione
enzimatica con Pepsina all’1%, in HCl 0,01 N per trenta minuti a temperatura ambiente.
Contemporaneamente una parte del materiale biologico è stata fissata in Glutaraldeide al 2,5 %, post-fissata in Osmio
Tetrossido ed infine, previa disidratazione, inclusa in Epon Araldiste. Dalle piramidi sono state allestite le sezioni semifini
di 1μ di spessore, colorate con Blu di Toluidina a caldo. In seguito, previa mappatura del campione sono state allestite le
ultrafini su retino, che, colorate con Piombo Citrato e Acetato di Uranile, sono state esaminate al microscopio elettronico
a trasmissione ZEISS EM 109 Turbo del Centro di Microscopia Elettronica di Sassari.
Risultati:
La nostra indagine ha portato all’evidenziazione di otto carcinomi squamo cellulari a sede mammaria. Questi si presentavano
macroscopicamente differenti per dimensione, morfologia e grado di sviluppo.
•
La più piccola delle lesioni, di 1-2 cm di diametro,per 2-3 cm di altezza, era localizzata in un’emi mammella, si
presentava singola, parzialmente rilevata, pigmentata e non ulcerata.
•
In sei casi il tumore aveva dimensioni medie di 7-8 cm di diametro per 4-5 di altezza e risultava circondato da
numerose piccole formazioni rotondeggianti e prominenti. Le neoplasie presentavano superficie irregolare, colore grigioverdastro per la presenza di fenomeni necrotico-purulenti, ulcerazioni e fenomeni infiammatori.
•
In un caso la lesione interessava entrambe le mammelle; essa presentava una superficie di aspetto crostoso, odore
nauseabondo, fenomeni necrotico-emorragici.
Al taglio, tutte le lesioni si mostravano scarsamente consistenti, di colorito grigio-rosato, ma non era apprezzabile il
coinvolgimento del sottostante parenchima mammario.
Istochimica: Istologicamente è stato possibile osservare due differenti tipologie del carcinoma squamo cellulare.
1. Carcinoma ben differenziato:
Il quadro principale era rappresentato da cordoni o nidi di cellule carcinomatose in fase di cheratinizzazione, proliferanti
nel derma sottostante. I cheratinociti assumevano una disposizione lamellare-concentrica conferente l’aspetto tipico delle
144
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
“perle cornee”. Intorno a queste ultime è stato riscontrato sovente un infiltrato infiammatorio di tipo linfoplasmocitario
macrofagico; l’indice mitotico appariva poco elevato.
2.
Carcinoma scarsamente differenziato:
Si osservava la proliferazione di voluminose cellule epiteliali squamose, con citoplasma chiaro e nucleo ipercromatico,
organizzate in cordoni e nidi, che sovente si approfondivano nel derma, circondate da un abbondante tessuto connettivo.
A differenza della tipologia precedente l’indice mitotico appariva più elevato e le perle cornee rare.
Le piccole formazioni che circondavano il tumore principale, erano caratterizzate da marcata acantosi e ipercheratosi
dell’epidermide e sostenute da uno stroma connettivale di tipo embrionale al cui interno si apprezzava il fascio vascolare.
Dette caratteristiche consentivano di formulare diagnosi di papilloma, neoplasia ad eziologia virale che, come riportato da
vari Autori, precede spesso lo sviluppo del carcinoma squamo cellulare.
Immunoistochimica (IHC):
I risultati delle prove anti pan citocheratina hanno evidenziato una reazione positiva per le cellule epiteliali squamose.
Tale reazione consentiva inoltre di evidenziare piccoli gruppi di cellule carcinomatose, costituite da non più di 2-3 elementi,
scarsamente tendenti alla cheratinizzazione. In entrambi i citotipi di carcinoma a cellule squamose osservati non é stato
evidenziato alcun coinvolgimento del parenchima mammario né dei linfonodi regionali.
Microscopia Elettronica a Trasmissione (T.E.M.):
L’osservazione delle sezioni ultrafini ci ha permesso di constatare che le cellule neoplastiche avevano forma rotondeggiante
ovoidale, nucleo a cromatina dispersa, citoplasma ricco di mitocondri e ribosomi; inoltre si apprezzava un aumento
significativo di tonofilamenti e desmosomi, caratteristica questa tipica del carcinoma squamo cellulare. Non veniva rilevata
presenza di virioni.
Considerazioni conclusive:
Nel corso della nostra indagine, tendente- come riferito in Premessa- ad uno studio generale della patologia mammaria,
è stato possibile studiare il carcinoma a cellule squamose, già osservato e descritto dal nostro istituto in altre sedi e in altre
specie animali (bovino).
Le nostre osservazioni - ancorché limitate da un punto di vista numerico - riteniamo siano interessanti in quanto evidenziano
le prime fasi di sviluppo del tumore e una serie di lesioni probabilmente anticipanti l’evoluzione della neoplasia.
Va riferito che il tumore in fase iniziale di sviluppo si presenta con aspetti anatomopatologici affatto caratteristici (forma
nodulare, superficie regolare) e che quindi solo l’esame istopatologico ne consente il riconoscimento. Detta situazione
cambia radicalmente per le forme più avanzate, del tutto sovrapponibili a quelle già osservate a livello oculare, auricolare e
perineale (marcato accrescimento esofitico, colore brunastro, superficie irregolare, necrosi ed emorragie).
Proprio in merito al comportamento biologico del tumore, il presente studio fornisce dati apparentemente in contrasto con
precedenti nostre osservazioni. Infatti anche nei casi di maggiore sviluppo del tumore, non si è apprezzato l’interessamento
del parenchima mammario; in altre esperienze si era invece visto che le cellule proliferanti avevano caratteristiche invasive,
riuscendo a colonizzare e distruggere tessuti circostanti anche molto consistenti (vedi demolizione del tessuto osseo della
regione oculare in corso di tumore della terza palpebra).
Tuttavia detta differenza nel comportamento biologico potrebbe essere solo un falso problema. L’allevatore infatti, constatata
la presenza di tali lesioni a livello mammario, decide solitamente la riforma del capo e pertanto la neoplasia non va incontro
al suo massimo accrescimento e tanto meno invade i tessuti circostanti.
Il presente studio sembrerebbe confermare l’importanza di alcuni fattori nell’induzione della trasformazione neoplastica. Va
infatti rilevato che cinque degli otto soggetti colpiti dal tumore erano stati sottoposti ad asportazione chirurgica della coda.
Come noto la “tecnica di Mules” è ritenuta da vari studiosi uno dei fattori predisponesti più importanti per l’insorgenza
del tumore, inducendo una maggiore azione dei raggi solari, particolarmente U.V., nella regione perineale e in quelle
circostanti.
Le osservazioni al microscopio elettronico non hanno invece consentito di accertare la presenza di particelle virali nelle
cellule neoplastiche. Va peraltro rilevato che esse sono state condotte solo su un limitato numero di campioni e, in ogni
caso, mai nelle forme di iniziale sviluppo del tumore e tanto meno in lesioni di tipo papillomatoso da cui il carcinoma
sembra derivare.
In conclusione quanto esposto deve essere considerato come l’approccio a iniziative di ricerca più ampie, coinvolgenti un
numero senz’altro più significativo di animali.
Nell’ambito di tale studio avranno sicuramente parte di rilievo prove immunoistochimiche tendenti a verificare la
presenza nelle cellule neoplastiche di antigeni virali, particolarmente di papillomavirus, come d’altra parte viene oramai
routinariamente fatto in medicina umana.
Bibliografia
AL-Yaman F.M. Willenborg D.O. – Mixed lymphocyte reaction suppression by tumour cell lines from naturally occurring squamous
cell carcinomata. Aust. J. Exp. Biol. Med. Sci., 63 (2), 183-193, 1985. AL-Yaman F.M., Willenborg D.O. – The immune reactivity of
regional and distant lymph nodes to autochthonous ovine squamous cell carcinomata. Vet. Immunol. Immunopathol., 9 (3), 261-272,
1985. Bastianello S.S. – A susvery on neoplasia in domestic species over 40-years period from 1935 to 1974 in the Republic of South
Africa. II: tumors occurring in the sheep. Onderspoort Journ. Vet. Res., 49 (4), 205-209, 1982. Daniels P.W.,Johnson R.H. – Studies
on squamous cell Carcinoma in sheep. Atti XXII World Vet. Congr., August 1983. Jun M. H. et coll. – In vitro growth of ovine sqamous
cell. Carcinoma. Vet. Bull., 49, 121, 1979. Jun M.H., Johnson R. H. – Effect of cyclophosphamide on tumor growth and cell-mediated
immunity in sheep with ovine squamous cell carcinoma. Res. Vet. Sc., 27 (2), 155-160, 1979. Jun M.H., Johnson R. H.,Maguire D.J.,
Hopkins P.S. – Enhancement and metastasis after immunotheraphy of ovine squamous cell carcinoma. Br. J. Cancer., 38 (3), 382-391,
1978. Lagadic M.A. – Contribution to ovine epithelioma: outbreak of vulvar neoplasm among ewes. Vet. Bull., 51, 743, 1981. Lagadic
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
145
M.A., Wyers M., Mialot J.P., Parodi A.L. – Observation d’une enzootie de cancers de la vulve chez le brebis. Zentralbl. Vet. Med.,
29 (2), 123-135, 1982. Leoni A., Nieddu A.M., – Sull’insorgenza di epiteliomi spinocellulari in ovini da carne. Atti S.I.S.VET., 37,
536-537, 1983. Leoni A., Muzzetto P., Lepori S. – Carcinoma oculare a cellule squamose del bovino. Osservazioni cliniche e anatomoistopatologiche. SUMMA, 5 (3), 223-227, 1988. Nuttal W.O., Daniels P.W., Ladds P.W. – Non-effect of Regional Lymph Node
Removal on Growth of Ovine Aural Squamous Cell Carcinoma. J. Comp. Path., 103, 215-219, 1990. Ramadan R.O. Gameel A.A., El
Hassan A.M. – Squamous cell carcinoma in sheep in Saudi Arabia. Med. Vet. Pays Trop., 44 (1), 23-26, 1991. Swan R.A., Chapman
H.M., Hawkins C.D., MC Howell J., Spaldingt V.T. – The epidemiology of squamous cell carcinoma of the perinealregion of sheep:
abattoir and flock studies. Austr. Vet. Journ., 61, 146-151, 1984. Tustin R.C., Thorton D.J., MC Naughton H. – High incidence of
squamous cell carcinoma of the vulva in Merino ewes on a South Africa farm. Journ. South Afr. Vet. Ass., 53, 141-143, 1982. Vanselow
B.A., Spradbrow P.B. – Papilloma viruses, pappilomas and squamous cell carcinoma in sheep. Vet. Rec., 110, 561-562, 1982. Vanselow
B.A., Spradbrow P.B. – Squamous cell carcinoma of the vulva, hyperkeratosis and papillomaviruses in a ewe. Austr. Vet. Journ., 60,
194-195, 1983. Yeruham I., Perl S., Nyska A. – Skin tumours in cattle and sheep after freeze - or heat-branding. J. Comp. Pathol.,
114 (1), 101-106, 1996
.
DOCUMENTAZIONE FOTOGRAFICA
1
2
3
4
5
6
7
8
9
10
11
12
146
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
13
14
15
Didascalie Foto
FOTO 1 -macro Carcinoma Squamo Cellulare (C.S.C.) piccola neoformazione cutanea rilevata e pigmentata.
FOTO 2 -macro C.S.C. massa neoplastica di 8 cm ∅ circondata da numerose piccole neoformazioni pigmentate
FOTO 3 -macro C.S.C. massa neoplastica ulcerata
FOTO 4 -macro C.S.C. masse neoplastiche di dimensioni differenti con superficie crostosa e ulcerata
FOTO 5 -macro C.S.C. sezione di taglio della precedente
FOTO 6 -macro C.S.C. ampia e voluminosa neoformazione, estesa su l’intera superficie cutanea della mammella.
FOTO 7 –Istochimica. C.S.C. ben differenziato. In evidenza numerose ʺperle corneeʺ. E.E. 4 X
FOTO 8 –Istochimica. C.S.C. ben differenziato. In evidenza numerose ʺperle corneeʺ. P.A.S. 4 X
FOTO 9 –immunoistochimica. C.S.C. ben differenziato. Pan Citocheratina, evidente positività per le cellule epiteliali. 4
X
FOTO 10 –istochimica. C.S.C. scarsamente differenziato. Voluminose cellule epiteliali squamose. E.E. 10 X
FOTO 11 –Istochimica. C.S.C. scarsamente differenziato. Piccoli gruppi cellulari in attiva replicazione mitotica. P.A.S..
20 X
FOTO 12 –immunoistochimica. C.S.C. scarsamente differenziato. Pan Citocheratina, evidente positività per le cellule
epiteliali. 10 X
FOTO 13 –T.E.M. C.S.C. piccolo gruppo di cellule carcinomatose.
FOTO 14 -15 –T.E.M. tonofilamenti e desmosomi in un cellula neoplastica.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
147
BLUE TONGUE IS ALSO A LEGISLATIVE EMERGENCY
BLUE TONGUE: UN’EMERGENZA ANCHE A LIVELLO LEGISLATIVO
Passantino A., Fenga C., Venza M., Di Pietro C., Passantino M.
(Dipartimento di Scienze Mediche Veterinarie - Università degli Studi di Messina – Polo Universitario, Annunziata - 98168
Messina - [email protected])
Summary
Blue tongue is a non-contagious infectious disease, caused by an orbivirus, whose vector is a haematophagous arthropod,
“Culicoides imicola” which affects ovines and other domestic and wild ruminants.
The actual path of entry into Italy is not know. The disease occurred initially in some provinces of Sardinia, generating
significant health concern. It then spread to southern Italy and, in particular, to some provinces of Sicily and Calabria,
where the health authorities were informed so as to limit the phenomenon.
The problem has been addressed by creating and continually improving a surveillance net work, within national health
structures, throughout the country. Despite this, recent event show that the surveillance systems to guard against the arrival
of tropical diseases are not sufficiently efficient in Italy.
The Authors make a detailed evaluation of the most recent steps taken with the aim of wiping out the disease. They then
demonstrate that, in spite of regional and national rulings based on E.U. guide-lines, which make vaccination obligatory
for all stock present in Italy together with a series of preventive measures.
Key words: blue tongue, emergency, Sicily, law.
Riassunto
La “blue tongue”, o febbre catarrale degli ovini, è una malattia infettiva, non contagiosa, sostenuta da un orbivirus, trasmessa
attraverso un artropode vettore ematofago, il “Culicoides imicola”, che colpisce gli ovini e altri ruminanti domestici e
selvatici.
Non è stata individuata con certezza la via d’ingresso di tale virosi nel Paese. Comparsa inizialmente in varie province
sarde provocando considerevoli preoccupazioni di ordine sanitario, soltanto successivamente si è diffusa nell’Italia
meridionale, in particolare in talune province siciliane e calabresi, ove sono state allertate le autorità sanitarie al fine di
contenere il fenomeno.
Questo problema è stato affrontato mediante la creazione e il continuo miglioramento di una rete di sorveglianza su tutto
il territorio nazionale, integrata nelle strutture del sistema sanitario nazionale. Tuttavia, i recenti accadimenti testimoniano
come il sistema preposto alla vigilanza dell’ingresso di malattie tropicali sul territorio nazionale presenti smagliature tali da
consentire il realizzarsi di condizioni idonee alla loro comparsa e diffusione.
Gli AA. effettuano un attento esame critico dei più recenti provvedimenti emanati nella regione Sicilia al fine di debellare
la malattia, evidenziando taluni aspetti legati agli interventi effettuati a livello regionale e nazionale, in recepimento
di disposizioni comunitarie, con particolare riferimento all’obbligo di vaccinare i capi bovini e ovicaprini presenti sul
territorio italiano ed alla serie di misure di profilassi attuate.
Parole chiave: blue tongue, emergenza, Sicilia, normativa.
Introduzione
La “Blue Tongue”, o febbre catarrale degli ovini, è una malattia infettiva, non contagiosa, di origine virale, trasmessa da insetti
ematofagi che effettuano il proprio pasto di sangue su ovini e altri ruminanti domestici e selvatici. Pur essendo la puntura
del Culicoides imicola, artropode attivo nelle ore notturne, la principale via di contagio, eccezionalmente la trasmissione può
realizzarsi attraverso il seme di animali malati, sia con la monta naturale sia con la fecondazione artificiale.
A tutt’oggi non è stata individuata con certezza la via d’ingresso di tale virosi nel territorio italiano. Comparsa
inizialmente in varie province sarde provocando considerevoli preoccupazioni di ordine sanitario, soltanto
successivamente la Blue Tongue (B.T.) si è diffusa nell’Italia meridionale, in particolare in talune province siciliane e
calabresi, ove sono state allertate le autorità sanitarie al fine di contenere il fenomeno.
Questo problema è stato affrontato mediante la creazione ed il continuo miglioramento di una rete di sorveglianza su tutto
il territorio italiano, integrata nelle strutture del sistema sanitario nazionale. Tali recenti accadimenti, tuttavia, testimoniano
come il sistema, preposto alla vigilanza dell’ingresso di malattie esotiche sul nostro territorio, presenti smagliature tali da
consentire il realizzarsi di condizioni idonee alla loro comparsa e diffusione.
STATO DELL’ARTE
Il virus della B.T. appartiene alla famiglia Reoviridae, genere Orbivirus. La malattia ad esso correlata ha andamento stagionale
e compare solitamente in estate avanzata.
Il Culicoides imicola è un piccolo insetto (la grandezza da adulto varia da 1 a 3 mm) appartenente alla famiglia delle
Ceratopogonidae che, per riprodursi, deve disporre di acqua dolce; depone, infatti, le uova nelle zone umide e più precisamente
in quel tratto di terreno che segna il confine tra la terra e l’acqua. In questo stesso luogo si compiono tutti i diversi stadi
della crescita, passa cioè dalla condizione di larva a quello di pupa ed infine ad insetto adulto. Generalmente ha una vita di
10-20 giorni e, solo in casi particolari, può sopravvivere anche per 60-90 giorni; non ama le basse temperature e pertanto
la sua vitalità decresce con temperature inferiori ai 12°C.
La B.T. negli ovini ha un periodo di incubazione che varia dai 5 ai 20 giorni (in media intorno ai 7 giorni). In questa
specie la mortalità può variare dal 2% al 30% in relazione alle condizioni generali degli animali, alla razza, all’età,
148
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
all’alimentazione ed al corretto management aziendale. Altre variabili sono legate al ceppo virale chiamato in causa,
nonché alle condizioni epidemiologiche delle aree interessate.
Sintomatologia
Il primo sintomo, in ordine di frequenza, è la comparsa di febbre molto alta, fino a 42°C, che si protrae per 6-7 giorni,
accompagnata da rapida perdita di peso, inappetenza e depressione.
In seguito possono manifestarsi edema delle labbra, della lingua, del retrobocca e della punta del petto. In particolare
la mucosa orale si arrossa, diventa cianotica e può presentare erosioni su tutta la sua superficie. Contestualmente è,
in genere, apprezzabile quel corteo sintomatologico caratteristico, da cui deriva la denominazione di “Lingua blu”,
contraddistinto dal rinvenimento di una lingua tumefatta e cianotica, unitamente ad una evidente tumefazione della
testa dell’animale (similmente a quanto può osservarsi in corso di reazioni da fotosensibilizzazione) e dalla fuoriuscita di
scolo nasale muco-purulento. Infine possono manifestarsi anche lesioni podali sottoforma di erosioni ed arrossamenti
della cute localizzati in prossimità del cercine coronario, alterazioni muscolari responsabili di vari gradi di rigidità nella
locomozione.
In considerazione del fatto che nei bovini l’infezione decorre, generalmente, in forma asintomatica e che in
questa specie animale la presenza del virus nel sangue circolante e, quindi, la possibilità di infettare i Culicoides
permane a lungo, tali animali possono rappresentare un importante serbatoio per l’infezione. La B.T. è diffusa
in America, Australia, in alcuni paesi del sud-est Asiatico e dell’Oceania, ed in Africa. Fra i Paesi del bacino
del Mediterraneo, nel biennio 1999-2000, sono stati segnalati focolai in Grecia, Bulgaria, Tunisia, Turchia.
Profilassi
Ai sensi degli artt. 1 e 2 del Regolamento di Polizia Veterinaria (R.P.V.), qualunque caso, anche sospetto, di B.T. “deve
essere immediatamente denunciato al sindaco che ne dà subito conoscenza al veterinario comunale”.
Il veterinario della competente Azienda USL, in osservanza dell’art. 9 del R.P.V., provvede all’accertamento della diagnosi
e propone per iscritto al sindaco, con la massima urgenza, tutte le misure di profilassi e controllo della malattia atte ad
impedire la diffusione della stessa, disponendo l’immediato blocco della movimentazione degli animali vivi dalle aree
infette ad attuando campagne di vaccinazione.
Interventi legislativi
L’Unione Europea con la direttiva 2000/75/CE ha fissato le norme di controllo e le misure di eradicazione contro la
febbre catarrale degli ovini con l’istituzione, a livello nazionale, di una “cellula di crisi” incaricata del coordinamento di
tutte le misure di urgenza nello Stato Membro ed introducendo il ricorso ai piani di vaccinazione che possono essere
praticati solo ai sensi delle disposizioni della suddetta direttiva. Successivamente, anche con la Decisione 18 gennaio
2001, la Commissione Europea ha ritenuto efficace l’utilizzo di vaccini contro l’afta epizootica e la febbre catarrale
degli ovini, valutando che i rischi connessi all’utilizzazione del vaccino della B.T. sono assimilabili a quelli derivati
dall’utilizzazione di qualsiasi vaccino vivo attenuato. Inoltre la stessa ha bandito una gara che è stata vinta, relativamente
alla preparazione del vaccino per la B.T., dal Centro Nazionale di Referenza per le Malattie Esotiche-Istituto
Zooprofilattico Sperimentale di Teramo, il quale ha utilizzato i ceppi dell’Istituto di Ondersteport.
Infine, con la recente Decisione del 23 marzo 2003, la Commissione delle Comunità Europee ha istituito zone soggette a
restrizioni, indicate nell’allegato I (allegato IA, IB, IC), comprendenti zone di protezione e di sorveglianza definite tali ai
sensi dell’art.8 della direttiva 2000/75/CE, ed ha ulteriormente stabilito norme sui movimenti in entrata ed in uscita da
tali zone degli animali di specie sensibili alla B.T..
In Italia nei primi mesi del 2001, a seguito di un vivace dibattito sull’uso dei vaccini, l’allora Ministero della Sanità richiese
il parere del Consiglio Superiore di Sanità prima di rendere obbligatoria la profilassi attuata attraverso la vaccinazione. Il
Consiglio, in data 24 aprile 2001, ha espresso parere favorevole per la vaccinazione dei ruminanti nelle zone di protezione
(parte del territorio comunitario avente un raggio minimo di 100 km intorno all’azienda infetta ai sensi dell’art. 8 direttiva
2000/75/CE). L’eventualità di effetti indesiderati secondari alla vaccinazione è stata contemplata nel programma di
vaccinazione allegato all’Ordinanza Ministeriale (O.M.) 11 maggio 2001. In tale programma è prevista la compilazione di
una scheda (SBT10) per individuare gli effetti indesiderati potenzialmente riconducibili all’utilizzazione del vaccino.
In Sicilia, stante il verificarsi di numerosi casi di B.T., già con Decreto Assessoriale (D.A.) n.32938 del 13 ottobre 2000, è
stata istituita un’unità di crisi locale per il monitoraggio della situazione epidemiologica territoriale e per il coordinamento
delle misure sia amministrative che sanitarie di emergenza da adottarsi per fronteggiarne la diffusione. Nell’isola si sono
succeduti nel tempo diversi provvedimenti legislativi al fine di predisporre ed attuare misure di prevenzione e profilassi. Di
seguito vengono elencati quelli più significativi:
1)
Il D.A. n. 35694 del 10 agosto 2001, con cui sono state rese obbligatorie, nel territorio della Regione Siciliana, le
misure urgenti di profilassi vaccinale obbligatoria contro la B.T., previste dall’O.M. 11 maggio 2001;
2)
il Decreto dell’Ispettore Generale (D.I.G.) n.01804 del 3 ottobre 2002, con cui tutti i territori dei comuni delle
province di Palermo e Trapani sono stati dichiarati, in via cautelativa, territori con infezione in atto da B.T., in attesa degli
accertamenti e delle verifiche in merito agli spostamenti di animali sensibili provenienti da territori con infezione in atto;
3)
la nota protocollo n. 551 del 9 ottobre 2002 con cui l’Azienda U.S.L. n.1 di Agrigento ha trasmesso le
comunicazioni, protocollo n. 1388 del 7 ottobre 2002 del distretto di Licata e protocollo n. 2165 del 7 ottobre 2002 del
distretto di Canicattì, dalle quali si evince che i territori dei comuni di Favara, Aragona, Comitini e Grotte, non compresi
tra i comuni con infezione in atto, sono stati oggetto di transito di animali sensibili alla BT provenienti da territori con
infezione in atto;
4)
la nota protocollo n. 3888 del 14 ottobre 2002 con cui l’Azienda U.S.L. n.9 di Trapani, a seguito delle verifiche
effettuate sulle movimentazioni avvenute e sui relativi percorsi di animali sensibili alla B.T. provenienti da zone con
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
149
infezione in atto verso il territorio della provincia di Trapani, chiedeva che lo status di territorio con infezione in atto venisse
mantenuto solo per i territori dei comuni di Gibellina, Alcamo, Castellammare del Golfo e Calatafimi;
5)
il D.I.G. n.01875 del 17 ottobre 2002 dispone che i territori dei comuni della provincia di Palermo, alcuni
della provincia di Trapani (Gibellina, Alcamo, Castellammare del Golfo e Catalafimi) e di Agrigento (Favara, Aragona,
Comitini e Grotte) sono da considerarsi a rischio per la diffusione della BT ed in via cautelativa sono dichiarati “territori
con infezione in atto da B.T.”
In Italia, con Decreto del Ministero della Salute (D.M.) emanato in data 6 marzo 2003, è stata istituita, presso il M.d.S.,
una Commissione d’inchiesta con il compito di valutare i problemi connessi ad eventuali effetti indesiderati conseguenti
alla campagna di vaccinazione per il controllo e l’eradicazione della B.T..
Considerazioni e Conclusioni
Al fine di impedire la diffusione del Culicoides Imicola sarebbe opportuno:
1)
Intervenire in tutte le zone umide in prossimità delle aziende, zone scelte dall’insetto per la sua riproduzione.
Occorrerebbe bonificare, inoltre, eventuali pozzanghere e raccolte d’acqua, curare con la massima diligenza l’igiene
dell’azienda evitando che si formino raccolte di liquami.
2)
Disinfestare i luoghi dove normalmente sostano gli animali utilizzando insetticidi a base di derivati del piretro ed
infine, ove la presenza di strutture aziendali lo consente, sarebbe opportuno ricoverare gli animali durante la notte, tenuto
conto che in tali ore l’imicola è attivo e non ama i locali chiusi.
Le linee d’intervento da seguire per il controllo della B.T. sono rappresentate oltre che dal pieno rispetto delle più elementari
norme di igiene zootecnica, dal controllo dell’ambiente in cui si muove il vettore responsabile della trasmissione del virus,
sia nella forma larvale che adulta, e dalla protezione dei singoli animali recettivi dalla puntura dell’insetto adulto.
Il legislatore, comunitario, nazionale e regionale si è attivato in tempi brevi attraverso l’emanazione di provvedimenti
a volte assai restrittivi, disponendo l’Introduzione di misure di profilassi spesso drastiche. Tuttavia, soltanto attraverso
l’osservanza di tali misure e con la fattiva collaborazione degli addetti ai lavori (veterinari ed allevatori) sarà possibile
debellare definitivamente la malattia.
TESTI CONSULTATI
1.
Ann. Ist. Super. Sanità 1994, 30 (2): 237-242.
2.
Battelli G.: Aspetti socio-economici delle malattie degli ovi-caprini. X Congresso Internazionale della Società Italiana di
Patologia e Allevamento degli ovini e dei caprini. 4/7 giugno 1992 Pizzomunno – Viete (Foggia). 73-78
3.
D.I.G. n.01875 del 17.10.2002.
4.
Decisione della Commissione del 24 luglio 2000 pubblicata in G.U. dell’Unione Europea n.L187 del 26/07/2000, 56.
5.
Decisione della Commissione del 18 gennaio 2001 pubblicata in G.U. dell’Unione Europea n. L 026 del 27/01/2001, pag.
0038 - 0039
6.
Decisione della Commissione del 15 novembre 2002 pubblicata in G.U. dell’Unione Europea n.L 313 del 16/11/2002, 3031.
7.
Decisione della Commissione del 10 gennaio 2003 pubblicata in G.U. dell’Unione Europea n. L 7 dell’11/01/2003, 87-89.
8.
Decisione della Commissione del 27 marzo 2003 pubblicata in G.U. dell’Unione Europea n. L 82 del 29.03.2003, 35-39.
9.
D.P.R. 08.02.1954 n.320 – Vigente alla G.U. 06.04.2002 n.81.
10.
Direttiva 2000/75/CE del Consiglio del 20 novembre 2000 pubblicata in G.U. dell’Unione Europea n. L 327 del 22/12/2000,
74-83.
11.
J. Med. Entomol. 1997 May, 34 (3):263-271.
12.
Notiziario dell’Istituto Superiore di Sanità, vol. 11, n 6, giugno 1998.
13.
O.I.E.- Organizzazione Internazionale delle Epizoozie: Blue tongue in Italy. Epidemiologic Bulletin, 1 September 2000.
14.
Ordinanza Ministeriale 11 maggio 2001 pubblicata in G.U. del 05.06.2001 n.128, 43-44.
15.
Romi R., Majori G. - Commercio di copertoni usati e importazione di zanzare: un aggiornamento della distribuzione di Aedes
albopictus e Aedes atropalpus in Italia. Notiziario dell’Istituto Superiore di Sanità, vol. 11, n 6, giugno 1998.
SITI CONSULTATI
1.
http://europa.eu.int/eur-lex
2.
http://www.parlamento.it
3.
http://www.regione.sicilia.it/sanita/blue%20tongue.htm
4.
http://www.pa.izs.it/BLUE%20TONGUE/Blue_tongue.htm
150
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
NEW DISPOSITIONS ON IDENTIFICATION AND REGISTRATION OF CATTLE IN ITALY
NUOVE DISPOSIZIONI IN MATERIA DI IDENTIFICAZIONE E REGISTRAZIONE DEI
BOVINI IN ITALIA
Di Pietro C., Passantino A., Fenga C., Passantino M.
(Dipartimento di Scienze Mediche Veterinarie - Università degli Studi di Messina – Polo Universitario, Annunziata - 98168
Messina - [email protected])
Summary
Cattle registration, that is, the system of identification and registration of cattle, has acquired a role of fundamental
importance from a medical, economical and juridical point of view. The innovations brought about by the Ministry of
Health on 31st January 2002, together with previous norms on the same subject, have radically changed breeders’ habits
and have induced breeders to adopt new methods. .
Some cultural and procedural obstacles have had to be overcome, allowing the introduction of a clearer and more accurate
system of identification (of every single head of cattle and, as a consequence, of the foodstuffs derived from it) which
meets the requirement, felt more and more nowadays, for a well organized and more efficient veterinary health system.
In the light of such considerations the Authors have examined both European and Italian legislation on this matter, and
in particular on the new dispositions on cattle identification, brought about by Ministerial Decree of 31st January 2002
(G.U. no. 72, 26/03/2002).
Key words: identification, registration, cattle, legislation
Riassunto
L’anagrafe bovina, ossia il sistema di identificazione e registrazione degli animali della specie bovina, assume un ruolo di
fondamentale importanza dal punto di vista sanitario, economico e giuridico. Le innovazioni apportate dal Decreto del
Ministero della Salute del 31 gennaio 2002, unitamente alla normativa precedente sull’argomento, hanno cambiato in
modo radicale le abitudini degli allevatori ed hanno spinto i servizi veterinari ad adottare nuove metodologie.
Ciò ha richiesto il superamento di ostacoli culturali e procedurali, ma ha introdotto un sistema di identificazione (dei singoli
capi e, di conseguenza, delle derrate alimentari da essi derivate) più perfezionato e trasparente, che risponde all’esigenza,
oggi sempre più avvertita, di pianificazione ed ottimizzazione della sanità pubblica veterinaria.
Gli A.A., alla luce di tali considerazioni, effettuano una breve disamina della normativa nazionale e comunitaria
sull’argomento soffermandosi, in particolare, sulle nuove disposizioni in materia di funzionamento dell’anagrafe bovina,
introdotte dal Decreto del Ministero della Salute del 31 gennaio 2002 (G.U. n.72 del 26/03/2002).
Parole chiave: identificazione, registrazione, bovini, legislazione
Introduzione
L’identificazione dei bovini rappresenta un presupposto indispensabile per la conoscenza capillare della consistenza ed
ubicazione di tale specie e, di conseguenza, per effettuare un controllo efficace delle malattie infettive.
Grazie alle garanzie fornite dal miglioramento di tale sistema, potranno essere soddisfatte talune esigenze di interesse
generale, così individuate nell’art.2 del Decreto del Ministero della Salute del 31 gennaio 2002:
a) tutela della salute pubblica e tutela del patrimonio zootecnico (costituzione e funzionalità della rete di
epidemiosorveglianza);
b) fornire il basilare supporto per trasmettere informazioni al consumatore di carni bovine e consentire un’etichettatura
adeguata e chiara del prodotto;
c) assicurare efficienza ed efficacia nella gestione, nell’erogazione e nel controllo dei regimi di aiuto comunitari.
Infatti, se da un lato è indispensabile istituire un sistema comunitario specifico di etichettatura nel settore delle carni bovine,
al fine di informare e garantire i consumatori, dall’altro si rende necessario individuare un sistema valido di identificazione
e registrazione dei bovini nella fase di produzione.
Alla luce di tali considerazioni, si ritiene interessante soffermarsi sulla normativa vigente in materia di funzionamento
dell’anagrafe bovina ed, in particolare, sulle nuove disposizioni introdotte in Italia dal Decreto del Ministero della Salute
del 31 gennaio 2002
SINTESI DELLE PRINCIPALI DISPOSIZIONI LEGISLATIVE ATTUALMENTE IN VIGORE
La regolamentazione attuale della materia inerente l’identificazione e la registrazione dei bovini consta di una ricca
legislazione:
- la Direttiva n.92/102/CEE, che prevede la registrazione e l’identificazione dei singoli capi, al fine di poter risalire
all’azienda d’origine, di favorire lo scambio fra i diversi Stati membri e di meglio gestire i fondi europei;
la Direttiva n.97/12/CE, che si occupa degli scambi di animali della specie bovina effettuati all’interno della
comunità;
il Regolamento n.1760/2000/CE, relativo all’etichettatura delle carni bovine e dei prodotti da esse derivati, che
abroga il Regolamento n.820/97/CE e che è stato integrato dal Regolamento CE del 25 agosto 2000 n.1825, e meglio
specificato dal successivo Decreto del Ministero delle Politiche Agricole e Forestali del 13 dicembre 2001. Il primo
provvedimento prevede che gli operatori e le organizzazioni che commercializzano carni bovine devono provvedere
ad etichettarle in tutte le fasi, indicando sull’etichetta le informazioni inerenti la macellazione, l’allevamento e le altre
ritenute utili per il consumatore, mentre il secondo specifica che gli organismi indipendenti autorizzati ai controlli
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
151
devono comunicare le eventuali violazioni alla vigente normativa e relazionare sull’attività di controllo svolta;
il D.P.R. n.437 del 19/04/2000, recante le modalità per l’identificazione e la registrazione dei bovini, che abroga il
D.P.R. n.317/96;
- il Regolamento n.494/98/CE, che concerne l’applicazione di sanzioni amministrative nell’ambito dell’anagrafe
bovina;
- il Decreto del Ministero della Salute del 31/01/2002, che tratta il tema specifico del funzionamento dell’anagrafe
bovina, il quale stabilisce (art.2, comma 2) che tutti i bovini nati successivamente all’1 gennaio 1998 debbano essere
muniti di:
1) due marchi auricolari, apposti su ciascun orecchio entro 20 giorni dalla nascita e, comunque, prima che lascino l’azienda
in cui sono nati, contenenti un codice identificativo;
2) il passaporto, che deve accompagnare gli animali in ogni loro spostamento;
3) il registro aziendale;
e debbano, altresì, essere inseriti in:
1) una banca dati informatizzata.
Il decreto in oggetto individua, come soggetti responsabili del sistema, i detentori degli animali, i titolari degli stabilimenti
di macellazione, i produttori di marchi auricolari, i servizi veterinari delle A.S.L., l’AGEA, le regioni e le province autonome
e il Ministero della salute (art.2, comma 3), attribuendo a ciascuno di essi, in base alle rispettive competenze, i compiti
specificati negli artt.7-12. Più precisamente, il detentore di bovini è responsabile della tenuta dei passaporti, delle cedole
identificative, dei marchi auricolari e del registro aziendale. Su quest’ultimo deve annotare tutti i dati identificativi del
bovino, la data del decesso con l’indicazione della causa di morte e, per gli animali che lasciano l’azienda, la data di
partenza e gli estremi dell’azienda di destinazione, mentre per quelli che giungono in azienda, la data di ingresso in stalla,
l’indicazione dei certificati sanitari e dei documenti di accompagnamento e il codice di identificazione dell’azienda di
provenienza.
Egli, ancora, deve notificare o registrare alla Banca Nazionale Dati (BDN) la nascita e le importazioni da Paesi Terzi, entro
7 giorni dall’apposizione dei marchi auricolari, nonché ogni movimentazione in entrata e in uscita dall’azienda, compresa
l’uscita per la macellazione, entro 7 giorni dall’evento.
Il titolare dello stabilimento di macellazione ha, invece, il compito di comunicare alla Banca dati nazionale e regionale,
entro sette giorni dalla macellazione, le informazioni relative ai capi macellati e di provvedere alla distruzione dei marchi
auricolari degli animali macellati.
Al fornitore spetta produrre e distribuire marchi conformi a quanto previsto dall’art. 3 del presente decreto e trasmettere
alla Banca dati l’elenco dei marchi forniti a ciascun allevamento.
Il servizio veterinario dell’A.S.L. si occupa del rilascio e della vidimazione dei passaporti, vigila sulla corretta applicazione
delle disposizioni previste per l’identificazione e la registrazione dei bovini, effettua i controlli presso le aziende zootecniche
e registra le relative informazioni nella Banca dati, unitamente alle notizie relative alle nascite, alle movimentazioni, alle
macellazioni, alle importazioni, ai furti e agli smarrimenti di animali o di documentazioni ad essi inerenti.
L’AGEA (ossia l’Agenzia per le Erogazioni in Agricoltura, ex AIMA) verifica l’idoneità delle domande di aiuto presentate
dagli allevatori che vogliono accedere ai contributi stanziati dalla Comunità a favore delle attività agricole e del settore
zootecnico.
Le regioni e le province autonome assicurano il corretto funzionamento dell’anagrafe sul territorio di propria competenza
ed, in particolare, coordinano l’attività dei servizi veterinari delle AA.SS.LL. e organizzano le fasi gestionali di afflusso dei
dati garantendo, così, l’aggiornamento delle BDN.
Il Ministero della Salute, infine, ha il compito di detenere la Banca dati e di garantirne la consultazione a chiunque ne
abbia interesse, il che dovrebbe assicurare la c.d. “trasparenza” del sistema, quello di assegnare il certificato elettronico di
identità, di redigere l’elenco dei fornitori di marchi auricolari e di comunicarlo alle regioni e alle province autonome e,
principalmente, di verificare la corretta applicazione della disciplina prevista dal presente decreto.
Tutti i suddetti adempimenti devono essere attuati in maniera tale da consentire, a far data dal 01/luglio/2002, la piena
operatività dell’anagrafe bovina, la quale costituisce condizione indispensabile per potere conoscere, in tempo reale,
attraverso il ricorso a procedure automatizzate interattive, tutte le informazioni occorrenti per garantire la rintracciabilità
dei prodotti zootecnici e la sanità della filiera alimentare.
-
Conclusioni
I meccanismi informatici introdotti dal Decreto del Ministero della Salute del 31 gennaio 2002, unitamente alle innovazioni
apportate dalla normativa precedente sull’argomento, hanno radicalmente modificato gli adempimenti degli allevatori e le
metodologie dei servizi veterinari in tema di funzionamento dell’anagrafe bovina.
Ciò ha comportato il superamento di ostacoli culturali e procedurali, ma ha introdotto un sistema di identificazione
(dei singoli capi e, di conseguenza, delle derrate alimentari da essi derivate) più perfezionato e trasparente, che risponde
all’esigenza, oggi sempre più avvertita, di pianificazione ed ottimizzazione della sanità pubblica veterinaria.
Concludendo, è auspicabile che, anche dal punto di vista pratico-attuativo, attraverso l’espletamento di controlli più
serrati e l’acquisizione di una maggiore responsabilità, si riesca a debellare il pericoloso fenomeno dei macelli clandestini e
dell’interscambio di bovini tra i Paesi d’Europa, affinché i consumatori, ancora disorientati a causa della triste vicenda della
BSE, possano avere delle certezze in merito alla sicurezza e alla salubrità dei prodotti.
TESTI CONSULTATI
−
−
−
152
Decreto del Presidente della Repubblica n. 317 del 30 aprile 1996 - pubblicato in GURI n. 138 del 14 giugno 1996.
Decreto del Presidente della Repubblica n. 437 del 19 ottobre 2000 - pubblicato in GURI n.30 del 6 febbraio 2001.
Decreto del Ministero delle Politiche Agricole e Forestali del 13 dicembre 2001 - pubblicato in G.U. n.23 del 28 gennaio 2002.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
−
−
−
−
−
−
−
−
−
−
Decreto del Ministero della Salute 31 gennaio 2002 - pubblicato in GURI n.72 del 26 marzo 2002.
Direttiva CEE n. 425 del 26 giugno 1990 - pubblicata in GUCE n. L 224 del 18 agosto 1990.
Direttiva CEE n. 102 del 27 novembre 1992 - pubblicata in GUCE n. L 355 del 5 dicembre 1992.
Direttiva CE n. 12 del 17 marzo 1997 - pubblicata in GUCE n. L 109 del 25 aprile 1997.
Regolamento CE n. 820 del 21 aprile 1997 - pubblicato in GUCE n. L 117 del 7 maggio 1997.
Regolamento CE n. 494 del 27 febbraio 1998 - pubblicato in GUCE n. L 060 del 28 febbraio 1998.
Regolamento CE n. 132 del 21 gennaio 1999 - pubblicato in GUCE n. L 017 del 22 gennaio 1999.
Regolamento CE n. 1663 del 28 luglio 1999 - pubblicato in GUCE n. L 197 del 29 luglio 1999.
Regolamento CE n. 1760 del 17 luglio 2000 - pubblicato in GUCE n. L 024 del 11 agosto 2000.
Regolamento CE n. 1825 del 25 agosto 2000 - pubblicato in GUCE n. L216 del 26 agosto 2000.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
153
PRESENT LEGISLATION CONCERNING PROTECTION OF THE
ITALIAN MEDITERRANEAN BUFFALO COW
NORMATIVA VIGENTE IN MATERIA DI TUTELA DELLA BUFALA MEDITERRANEA
ITALIANA
Passantino A., Fenga C., Di Pietro C., Passantino M.
(Dipartimento di Scienze Mediche Veterinarie - Università degli Studi di Messina – Polo Universitario, Annunziata - 98168
Messina - [email protected])
Summary
In view of the need to safeguard the Italian Mediterranean Buffalo Cow, legislation has recently been approved. Specifically,
this comprises a ruling of nation-wide validity, contained in law n.292, of 27th December 2002, which was published in the
“Gazzetta Ufficiale” n. 1, of 02th January 2003. The ruling contemplates urgent measures for protection of the indigenous
breed of buffalo. It derives from the pressing need to protect the breed from the uncontrolled introduction of foreign stock
as well as from the spread of infectious diseases. Comma 1 of article 1 expressly provides for regional planning concerning
prevention and eradication of infectious diseases and infestations with the aim of protecting food products (especially
buffalo mozzarella) and consumer health.
The law requires the state to allocate euro 1.000,00 to the regions concerned to put the ruling into effect.
The Mediterranean buffalo cow’s unique genetic characteristics and the distinctive nature of its food products make this
animal a special national livestock resource, the authors therefore think it useful to analyse these new measures to shed light
on the importance of protection for this species.
Key words: Mediterranean Buffalo Cow, infectious diseases, animal protection, regulation.
Riassunto
Stante la necessità di salvaguardare la Bufala Mediterranea Italiana e le sue produzioni, il Legislatore ha disciplinato la
materia attraverso l’emanazione di una recente normativa a livelli nazionale contenuta nella Legge 27 dicembre 2002,
n.292, pubblicata nella Gazzetta Ufficiale n. 1 del 02/01/2003, disposizione legislativa questa che prevede misure urgenti
volte a tutelare la razza bufalina nostrana.
La legge in questione trova il proprio fondamento, pertanto, nell’urgenza di intervenire con una serie di misure finalizzate
a proteggere tale razza dall’immissione incontrollata dall’estero di capi, nonché dalle malattie infettive a carattere diffusivo.
Infatti, l’art. 1 al comma 1 prevede espressamente il ricorso a piani regionali di profilassi ed eradicazione di malattie infettive
ed infestive, allo scopo di garantire la salvaguardia delle produzioni di filiera (tipicamente la mozzarella di bufala) e la salute
del consumatore.
Per il raggiungimento degli obiettivi suddetti, la Legge di cui sopra prevede che lo Stato stanzi la somma di 1 milione di
euro, da ripartire tra le regioni interessate.
Considerato che la Bufala Mediterranea costituisce un patrimonio zootecnico nazionale, sia per l’unicità delle sue
caratteristiche genetiche, sia per la specificità delle sue produzioni agroalimentari, gli AA. ritengono opportuno soffermarsi
ad analizzare queste nuove disposizioni sull’argomento al fine di evidenziare l’importanza della salvaguardia di tale specie
Parole chiave: Bufala Mediterranea, malattie infettive, protezione animale, normativa.
Premessa
L’allevamento dei bufali è un settore in grande espansione che, nel tempo, ha assunto caratteristiche tali da rappresentare una
fonte di ricchezza, basti pensare che in Italia sono allevati 181.951 capi bufalini, di cui il 71,85% solo in Campania (tabella
1). Pertanto, la salvaguardia della presenza nella nostra penisola della bufala mediterranea e delle caratteristiche della razza
rappresenta un obiettivo importante per il patrimonio zootecnico nazionale sia dal punto di vista del mantenimento delle
risorse genetiche che da quello produttivo per la destinazione del latte alla trasformazione nella famosa e celebre mozzarella
di bufala campana a denominazione di origine protetta (DOP) in ambito europeo (Regolamento CE n. 1107/96 della
Commissione del 12 giugno 1996 relativo alla registrazione delle indicazioni geografiche e delle denominazioni di origine
nel quadro della procedura di cui all’articolo 17 del Regolamento CEE n. 2081/92 del Consiglio) (4).
Lo sviluppo razionale di questo settore, nonché il miglioramento della produttività possono essere ottenuti avviando misure
veterinarie intese ad una sempre maggiore tutela della salute dell’uomo e degli animali.
Nel contesto di un’iniziativa di salvaguardia di produzioni tipiche e di valorizzazione dei c.d. prodotti di nicchia, la Legge
n. 292/02 (3) detta disposizioni precise per il riconoscimento e la tutela della bufala mediterranea, nonché misure sanitarie
volte a prevenire ed eradicare malattie a carattere diffusivo attraverso la realizzazione di piani regionali di profilassi, al fine
di garantire la salvaguardia delle produzioni di filiera (tipicamente la mozzarella di bufala) e la salute del consumatore.
Si tratta di norme che rispondono ad una duplice esigenza: 1) creare le premesse per un’adeguata tutela del produttore/
consumatore garantendo elevati livelli qualitativi del prodotto da immettere sul mercato; 2) assicurare il benessere
animale.
Le questioni legate al benessere animale sono integrate nella politica alimentare. Infatti, la salute ed il benessere degli
animali da cui derivano prodotti alimentari è essenziale per la salute pubblica e la protezione dei consumatori.
Alla luce di tali considerazioni, gli AA. analizzano le nuove disposizioni emanate in merito alla tutela della bufala
mediterranea italiana e sottolineano che nella legislazione si deve tener conto dell’impatto sulla qualità e sicurezza dei
prodotti di origine animale destinati al consumo umano.
154
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
DISPOSIZIONI LEGISLATIVE
La Legge n. 292/02 trova il proprio fondamento nella necessità di intervenire con una serie di misure finalizzate a tutelare
“le caratteristiche genetiche della bufala mediterranea italiana dall’immissione incontrollata di capi esteri” che, per
l’unicità del suo patrimonio genetico e per la specificità delle produzioni agroalimentari che ne derivano, è considerata, ai
sensi dell’art. 1, comma 1, “patrimonio zootecnico nazionale”.
A tal riguardo, va osservato che il principio di libera circolazione all’interno dell’Unione Europea non appare in alcun
modo pregiudicato e l’esigenza della salvaguardia di tale specie animale è stata pienamente considerata dal Governo nella
predisposizione del provvedimento, così come l’opportunità di comunicare preventivamente alla Commissione europea i
piani straordinari di intervento previsti dall’articolo 1, comma 2.
Il comma 1 dell’art. 1 prosegue affermando che il patrimonio bufalino italiano deve essere tutelato nei confronti di tutte
le patologie infettive ed infestive, attraverso la predisposizione di piani di profilassi per la prevenzione e l’eradicazione delle
malattie a carattere diffusivo
.Il comma 2 consente alle regioni, per un periodo di sei anni, di elaborare, d’intesa con il Ministero della Salute ed anche
in deroga alle normative sanitarie vigenti, piani straordinari di intervento per il risanamento delle malattie infettive del
patrimonio bufalino. Detti piani possono includere le vaccinazioni come metodo profilattico.
A tal riguardo, una disciplina temporanea, posta in deroga alla normativa sul risanamento obbligatorio dalla brucellosi
degli allevamenti bovini e bufalini, adottata con il decreto interministeriale (Ministeri Sanità ed Agricoltura) 5 febbraio
1991, n. 84, predisponeva uno specifico piano di risanamento per gli allevamenti bufalini, in virtù del quale la macellazione
obbligatoria degli animali riconosciuti sierologicamente positivi poteva essere eseguita gradualmente, secondo piani
aziendali concordati con l’autorità sanitaria locale. La macellazione degli animali infetti si doveva concludere entro i sei
anni dal primo controllo sierologico.
Ulteriori disposizioni prevedevano la possibilità, per le sole vitelle tra i quattro e i sei mesi di età, di fare ricorso alla
vaccinazione, da eseguirsi sotto controllo ufficiale ed a completamento di altre misure profilattiche.
Oggi, gli allevamenti bufalini sono sottoposti alla disciplina concernente il piano nazionale per l’eradicazione della
brucellosi negli allevamenti bovini, prevista dal Decreto Ministeriale 27 agosto 1994 n. 651, (2), in base alla quale i bovini
in cui la brucellosi è stata constatata devono essere immediatamente isolati e macellati sotto controllo ufficiale non oltre
trenta giorni dalla notifica al proprietario o al detentore (articolo 8). Il piano, inoltre, vieta (articolo 25) in via generale la
vaccinazione, consentendola, tuttavia, in particolari situazioni epidemiologiche, nelle quali deve essere però assoggettata
a specifiche autorizzazioni rilasciate dall’autorità regionale, previo parere conforme della Direzione Generale dei Servizi
Veterinari del Ministero della Sanità.
Il comma 3 specifica che la selezione genetica deve essere garantita a tutti gli allevamenti bufalini che ne fanno richiesta,
anche nel caso in cui gli stessi siano interessati dall’applicazione di piani di intervento straordinari per l’eradicazione delle
malattie infettive ed infestive.
I commi 4, 5 e 6 stabiliscono norme di carattere finanziario derivanti dall’applicazione della legge stessa. In particolare,
il comma 4 prevede un contributo dello Stato per l’attuazione dei piani straordinari di intervento da parte delle regioni,
pari ad 1 milione di euro per l’anno 2002, da ripartire tra le regioni interessate, secondo i criteri stabiliti dalla Conferenza
permanente per i rapporti tra lo Stato, le regioni e le province autonome di Trento e di Bolzano.
Il comma 5 statuisce che le disponibilità, pari ad 1 milione di euro, necessarie alla copertura finanziaria degli oneri recati dal
provvedimento, saranno rinvenute nel “Fondo speciale” per l’anno 2002, utilizzando allo scopo l’accantonamento relativo
al Ministero dell’Economia e delle Finanze.
Considerazioni e Conclusioni
Attraverso questa legge si vogliono mettere in evidenza due aspetti.
In primo luogo, si vuole salvaguardare il patrimonio zootecnico e genetico della bufala mediterranea, soprattutto
dall’immissione - a volte indiscriminata - di capi provenienti dall’estero e geneticamente non conformi alla razza mediterranea
bufalina che, naturalmente, può comportare conseguenze negative dal punto di vista della produzione dei prodotti tipici.
Pertanto, il riconoscimento della bufala mediterranea italiana quale patrimonio zootecnico rappresenta un passo avanti
nella tutela dei prodotti tipici e delle razze autoctone.
L’altro aspetto che emerge è rappresentato dal risanamento della popolazione bufalina. Infatti, l’importanza strategica della
sanità animale è indispensabile per consentire all’Italia il conseguimento dello standard sanitario richiesto dall’U.E. per
qualificare le produzioni ed assicurare la salute pubblica.
Premesso che l’allevamento bufalino è tipico della Campania e del basso Lazio ed è presente marginalmente anche in
Puglia, Basilicata e Sicilia (tabella 1), va segnalata una maggiore presenza di brucellosi umana nelle regioni meridionali
(5,7), sicché, uno degli obiettivi primari è quello di eradicare questa malattia. In passato, uno dei metodi più utilizzati era
il c.d. stamping out, cioè l’eliminazione dei capi infetti per arrivare ad ottenere che l’intera nazione fosse indenne da quella
patologia.
L’urgenza della promulgazione della Legge n.292/02 è derivata dal fatto che, oltre la Campania, che ha già messo in atto un
piano per l’eradicazione della brucellosi bufalina (approvato con provvedimento della giunta regionale n.3527 del 20 luglio
2001), e le Marche (Decreto del P.G.R. n. 42 del 14 aprile 1999 – Attuazione del piano di risanamento della brucellosi
bufalina per l’anno 1999 e successivi in esecuzione del D.M. 5 febbraio 1991 n.84 - pubblicato BUR Marche n.44 del 29
aprile 1999) anche le altre regioni in cui è presente un patrimonio zootecnico di bufale dovranno dotarsi di idonei piani
per le finalità previste dalla presente legge.
La Commissione Europea, con Decisione n. 598 del 15 luglio 2002 (1), che consente l’utilizzo di vaccini contro la
brucellosi bovina nel quadro della Direttiva 64/432/CEE del Consiglio, autorizza gli Stati membri ad effettuare una serie
di vaccinazioni per un intervento di risanamento dalle malattie infettive ed infestive anche per quanto riguarda la bufala
mediterranea.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
155
In conclusione, alla luce di quanto sopra esaminato e ribadendo la rilevanza sanitaria, sociale ed economica della L. n.
292/02, ci si augura che vengano posti in essere sempre più efficaci sistemi di monitoraggio e di controllo sull’attuazione
della stessa.
TESTI CONSULTATI
1) Decisione n. 598 del 15 luglio 2002, pubblicata nella Gazzetta Ufficiale n. L 194 del 23/07/2002 pag. 0045 – 0046.
2) Decreto Ministeriale 27 agosto 1994 n. 651, pubblicato nella Gazzetta Ufficiale n. 277 del 26 novembre 1994.
3) Legge 27 dicembre 2002, n. 292, pubblicata nella Gazzetta Ufficiale n. 1 del 02/01/2003.
4) Regolamento CE n. 1107/96 della Commissione del 12 giugno 1996, pubblicata nella Gazzetta Ufficiale n. L 148 del
21/06/1996 pag. 0001 - 0010.
5) Twisselmann B., 2002: “A patient with prolonged fever in Germany”. Eurosurveillance Weekly, Vol. 4, Issue 34.
6) www.istat.it
7) www.simi.iss.it
T
abella 1 - Numero di animali presenti nel territorio italiano
(da www.istat.it, modificata)
REGIONI
Italia nord-occidentale
Piemonte
Lombardia
Liguria
598 (0.33%)
4393 (2.41%)
20 (0.01%)
ITALIA NORD-ORIENTALE
Trentino Alto Adige
Veneto
Friuli Venezia Giulia
Emilia Romagna
24 (0.01%)
1364 (0.74%)
569 (0.31%)
1179 (0.65%)
ITALIA CENTRALE
Toscana
Umbria
Marche
Lazio
521 (0.29%)
126 (0.07%)
493 (0.27%)
33518 (18.42%)
ITALIA MERIDIONALE
Abruzzo
Molise
Campania
Puglia
Basilicata
Calabria
58 (0.03%)
489 (0.26%)
130732 (71.85%)
5604 (3.08%)
547 (0.30%)
169 (0.09%)
ITALIA INSULARE
Sardegna
Sicilia
984 (0.54%)
563 (0.31%)
Totale
156
N° CAPI
181951
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ATTI
SABATO 24 MAGGIO 2003
I LIPOIDROPEROSSIDI NELLA TERAPIA DELLA MASTITE NELLA BOVINA DA LATTE
LIPOHYDROPEROXIDES IN THE TREATMENT OF MASTITIS IN DAIRY COWS
Marusi A., Ubaldi A., Fusari A., Marasi G.
ISOLAMENTO DI Streptococcuc canis IN LATTE DI BOVINE AFFETTE DA MASTITE
Scatassa M.L., Lo Verde V., Caruso S., Cascio M.A., Caracappa S.
SENSIBILITÀ NEI CONFRONTI DEGLI ANTIBIOTICI DI STAFILOCOCCHI ISOLATI
NEL LATTE DI CAPRE CON MASTITE SUBCLINICA
Virdis S., Mureddu A., Campus M.G., Mazzette R., De Santis E.P.L
CORRELATION AMONG THE CALIFORNIA MASTITIS TEST, THE SOMATIC CELLS
CONTENT AND THE HEALTH STATUS OF THE UDDER IN THE MEAT SHEEP
Aliberti A., Alessi A., Decaro N., Daidone A, Orlandella B.M., Fisichella V., Buonavoglia D.
XI Congresso
Internazionale
della Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
157
158
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
I LIPOIDROPEROSSIDI NELLA TERAPIA DELLA MASTITE NELLA BOVINA DA LATTE
LIPOHYDROPEROXIDES IN THE TREATMENT OF MASTITIS IN DAIRY COWS
Marusi A.*, Ubaldi A.*, Fusari A.*, Marasi G.
*Dipartimento di Salute Animale – Università degli Studi di Parma
Libero Professionista – Parma
Prof. Aurelio Marusi – Dipartimento di Salute Animale – 0521902658 – [email protected]
Riassunto
L’olio ozonizzato può essere utilizzato nella terapia delle mastiti acute,croniche e subcliniche in lattazione e anche nella
messa in asciutta, prima della profilassi con trattamento antibiotico in mammella. E’ stata utilizzata una miscela costituita
da olio ozonizzato in quantità di 1,8 ml diluito in 500ml di soluzione fisiologica.
Di questa miscela venivano usati 100 ml per ogni quarto mammario da trattare.La terapia era diversificata secondo la
gravità della patologia mammaria e precisamente:1) nelle bovine che non presentavano segni clinici di mastite, ma solo un
numero di cellule superiori alla norma (CMT+);
2) nei casi di mastite acuta con gonfiore mammario e febbre da agenti infettivi;3) nei casi in cui la mastite si presentava con
gonfiore mammario senza febbre;4) nelle bovine a fine lattazione con leucocitosi cronica o mastiti subcliniche da agenti
infettivi.
Sono state trattate n.400 bovine e precisamente 280 casi di mastiti acute e subacute e 120 a fine lattazione. L’uso degli oli
ozonizzati si è dimostrato vantaggioso sia nel trattamento che nella profilassi della mastite. Inoltre considerato che fino
a pochi anni fa l’ozono terapia era praticato solo con particolari macchine e con l’insufflazione di gas ozonizzato, oggi il
trattamento delle mastiti con olio ozonizzato è risultato molto più pratico ed economico.
Introduzione
L’ozono (O3) è la forma triatomica dell’ossigeno (O2).Dal punto di vista medico l’ozono è considerato nocivo in quanto
con l’inquinamento dell’aria può causare un effetto tossico sulle vie respiratorie.Ma a dosi molto basse e limitate nel tempo
l’ozono presenta un azione ossidante con una attività battericida e anche contro i virus (Burleson 1975; Mattassi 1985).
Pertanto l’ozono terapia viene praticata oltre che nella medicina umana anche nei vari campi della medicina veterinaria
(Scrollavezza et al. 1987).La somministrazione di ozono per essere efficace rende necessaria la sua produzione direttamente
dall’ossigeno puro;considerata la notevole instabilità dell’ozono pertanto è necessaria la sua produzione ed utilizzo al
momento della applicazione terapeutica mediante particolari apparecchi.
L’ozono ha una particolare affinità verso gli acidi grassi,in particolare insaturi; facendo assorbire e legando l’ozono a diversi
oli, si ottengono oli ozonizzati ricchi di lipoidroperossidi.Questi oli, se conservati in contenitori di vetro o plastica scuri e a
temperatura di 4-5° C, possono rimanere stabili per lungo tempo mantenendo la loro azione antisettica.
Vista la difficoltà ed il tempo necessario per l’applicazione dell’ozono terapia direttamente in azienda in campo buiatrico,
noi da qualche anno utilizziamo gli oli ozonizzati, già da tempo in commercio, oltre che nelle patologie uterine (Marusi et
al.1999-2000) anche nella terapia delle mastiti. Trattiamo mastiti acute, croniche e subcliniche in lattazione e anche nella
messa in asciutta, nelle bovine a fine lattazione, prima della profilassi con trattamento antibiotico in mammella.
.
Materiali e metodi
Normalmente utilizziamo una miscela costituita da olio ozonizzato in quantità di 1,8ml diluito in 500 ml di soluzione
fisiologica.
Di questa miscela vengono usati 100 ml per ogni quarto mammario da trattare. La terapia è diversificata secondo la gravità
della patologia mammaria e precisamente:
1) nelle bovine che non presentano segni clinici di mastite ma solo un numero di cellule superiori alla norma (CMT+)
vengono praticati 2 trattamenti post mungitura, a distanza di 24 ore;
2) nei casi di mastite acuta caratterizzata da gonfiore mammario e febbre da agenti infettivi, vengono effettuati sempre 2
trattamenti post mungitura, uno ogni 24 ore, con olio ozonizzato in mammella associati a una terapia antibiotica i.m.Se il
gonfiore mammario è elevato alla terapia antibiotica viene associata anche una terapia antinfiammatoria tipo FANS i.m.
3) Se la mastite si presenta con gonfiore mammario senza febbre, le bovine vengono trattate solo con la miscela di olio
ozonizzato una volta al giorno per due giorni; se l’edema mammario è notevole alla miscela di olio ozonizzato vengono
aggiunti anche 5 ml di desametasone.
4) Alle bovine al termine della lattazione con leucocitosi cronica o mastiti subcliniche da agenti infettivi tipo Streptococcus
Agalactiae o Staphylococcus Aureus, vengono iniettati 100 ml di miscela di olio ozonizzato per quarto per due volte,una
ogni 24 ore, quindi accertato che all’ultima mungitura non si presentassero alterazioni nel latte, viene praticata la profilassi
della mastite con l’utilizzo di tubetti di antibiotico a largo spettro.
Sono state trattate complessivamente n.400 bovine; precisamente n 280 casi di mastiti acute e subacute e n 120 a fine
lattazione
Risultati e considerazioni
Dei 280 casi di mastiti trattate in lattazione, 60 sono state considerate patologie acute; di queste 46 hanno presentato una
buona risposta alla terapia con completa guarigione dopo 2 trattamenti con olio ozonizzato; mentre nelle rimanenti 14
bovine trattate si è ottenuta solo una parziale guarigione,pur avendo ripetuto il trattamento.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
159
Nelle 220 bovine che presentavano mastiti subcliniche, caratterizzate da leucocitosi elevate,(CMT +++, oltre 1 milione di
leucociti nel latte), con 2 trattamenti con olio ozonizzato, abbiamo ottenuto buoni risultati: una notevole diminuizione
delle cellule con meno di 400.000 leucociti/ml. in 182 casi.
Nelle rimanenti 38 bovine che non hanno presentato risultati significativi nella mammella si rilevavano noduli e all’esame
batteriologico è risultata una infezione da Staphylococcus Aureus.
Delle 120 bovine trattate a fine lattazione con olio ozonizzato e successivamente con pomate di antibiotici in quanto
risultate affette da elevata leucocitosi o mastiti subliniche, 115 hanno presentato un regolare inizio di lattazione post
partum con una normale secrezione lattea. Solo 5 capi sono stati eliminati dopo il parto in quanto presentavano ancora
segni di mastite subclinica e scarsa produzione lattea.
Discussione
Sia nelle bovine affette da mastiti acute che in quelle con mastiti subcliniche abbiamo osservato una significativa reazione
mammaria al trattamento con olio ozonizzato; oltre alla diminuizione dell’indurimento edematoso della mammella ed un
ritorno alla sua normale elasticità, si evidenziava anche un ritorno alla buona qualità e produzione del latte senza la
presenza di fiocchi o masse filamentose. Il ritorno alla normalità della ghiandola mammaria è accelerato dagli oli ozonizzati in
quanto i lipoidroperossidi si legano ai lipidi del latte e aumentano così la loro efficacia diffondendosi nel tessuto mammario con
la secrezione lattea.
La terapia della mastite con miscela di olio ozonizzato ha dimostrato,pertanto, una buona efficacia essendo attiva contro una
buona parte degli agenti patogeni mammari.Con gli antibiotici non sempre si ha una terapia efficace, poiché possono crearsi
situazioni di antibiotico resistenza.
La terapia della mastite solo con oli ozonizzati nei casi in cui non si sia reso necessario l’uso associato di antibiotici consente
l’utilizzo del latte sia per uso industriale che per l’alimentazione umana subito dopo il ritorno alla normalità della produzione
lattea, senza il divieto di uso del latte per almeno 5 giorni dopo il trattamento.
Conclusioni
In conclusione possiamo affermare che nella gestione economica di un allevamento di bovine da latte si deve tener conto
anche dei costi dei trattamenti sanitari, pertanto l’uso di oli ozonizzati nel trattamento e nella profilassi delle mastiti è oggi
sicuramente vantaggioso. Non solo si ha una notevole diminuizione nel tempo di sospensione dell’utilizzo del latte con
il ritorno alla normalità della mammella rispetto agli antibiotici ma, cosa non ultima, si ha una diminuizione della spesa
sanitaria, in quanto gli oli ozonizzati hanno un costo inferiore agli antibiotici. Fino a pochi anni fa l’ozono terapia era
praticata con una particolare macchina (Ozone Generator-Output Range 0-150μg/ml) che consentiva la insufflazione
di gas ozonizzato a differente concentrazione secondo il tipo di mastite. Considerato il tempo occorrente per la terapia
ed il costo dell’apparecchio si capisce perché,nonostante i vantaggi sulla salute animale, l’ozono terapia è stata finora poco
praticata.Oggi, invece, il trattamento delle mastiti con l’uso di olio ozonizzato è molto più pratico ed economico.
Bibliografia
Burleson G.R., Murray T.M., Pollard M.(1975)-Inactivation of viruses and bacteria by ozone with and without sonication.
Appl.Microbiol.29,340.
Marusi A., Allegri M., Marasi G.,Orsi G., Ubaldi A.(1999)- I lipoidroperossidi nella profilassi e terapia della metrite e nel
miglioramento della fertilità nella bovina da latte. Atti Soc. It. Buiatria XXXI,219.
Marusi A., Ubaldi A., Fusari A., Marasi G., Islenghi F.(2000)- Haptoglobin response in dairy cow metritis treatment with
lipohydropexides.XXI Congress World Bujatrics. Uruguay.
Mattassi R.(1985)-Ozonoterapia. Org.Edit.Med.Ferm.Milano.
Scrollavezza P., Ablondi M., Pogliacomi B.,Guareschi D., Dall’Aglio R., Poldi R.,Pezzoli G.(1997)Ozone treatment
in mastitis, metritis and retention of fetal membranes in the dairy cow. Havana,Cuba. 1997
160
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ISOLAMENTO DI STREPTOCOCCUC CANIS IN LATTE DI BOVINE AFFETTE DA MASTITE
Scatassa M.L., Lo Verde V., Caruso S., Cascio M.A., Caracappa S.
Istituto Zooprofilattico Sperimentale della Sicilia “A Mirri”- Palermo
Riassunto
Gli Autori descrivono un caso di mastite con isolamento di Streptococcus canis in un allevamento di Frisone di circa
trenta capi.
Diverse bovine presentavano, da circa sei-otto mesi, casi di mastite resistente ai trattamenti antibiotici; le analisi del latte,
effettuate nel maggio 2002, hanno evidenziato circa il 60% di soggetti con elevato tenore in cellule somatiche (SCC) e
presenza di Streptococcus canis in cinque capi.
In vitro, lo Streptococcus canis si dimostrava resistente a diversi antibiotici e sensibile a tetraciclina, cefalexina e
amoxicillina + ac. clavulanico; è stato prescritto un rigoroso rispetto delle norme igienico-sanitarie e il trattamento
antibiotico di tutti gli animali che presentavano un aumento in SCC nonché un corretto trattamento antibiotico su tutti
gli animali a fine lattazione.
Si è proceduto ai trattamenti antibiotici e all’eliminazione della maggior parte delle bovine con mastite ricorrente, ma le
misure di profilassi sono state attuate parzialmente e con discontinuità. Per il ripresentarsi di nuovi casi clinici, quest’anno
sono stati effettuati ulteriori esami e, ancora una volta, in sette soggetti è stato isolato Streptococcus canis.
Quanto riscontrato sembra confermare il possibile ruolo eziologico di Streptococcus canis nelle mastiti bovine, che può
assumere carattere di persistenza e contagiosità, con conseguente difficile eradicazione. Non è stato possibile accertare
l’origine dell’infezione, ma verosimilmente, per il suo mantenimento, risulta rilevante l’insufficiente applicazione delle
misure profilattiche.
SummaryThe Authors describe a case of mastitis in which Streptococcus canis has been isolated in some lactating among a group
of thirty bovines raised in Sicily.
Several cows exhibited – in the last six to eight months – cases of mastitis that did not respond to antibiotics. Analysis of their
milk, in May 2002, showed that approximately 60 % of the bovines had a high count of somatic cells (SCC) while Streptococcus
canis was present in five cases.
In vitro, the Streptococcus canis was resistant to several antibiotics and showed sensitivity to tetracycline, cefalexine and amoxicilline
combined with clavulanic acid; the recommended treatment consisted in a strict hygienic regimen as well as the proper use of
antibiotics for all bovines that presented a high SCC at the end of lactation.
The cattle farmer did administer the antibiotics and proceeded to eliminate some of the affected bovines but the hygienic
procedures were applied partially only and without continuity. Because of the recurrence of more clinical cases, new tests
were completed in the first months of 2003. Again Streptococcus canis appeared in seven cases. These findings seem
to confirm the possible role of Streptococcus canis as pathogen for bovine mastitis both persistent and contagious and
therefore very hard to eradicate. It was not possible to ascertain the origin of the infection but an insufficient regimen of
prophylactic measures seems to have a big impact in the failure of eliminating mastitis.
Introduzione
La mastite bovina, dalle forme sub-cliniche a quelle croniche, rappresenta un problema significativo nell’ambito dei singoli allevamenti
con ripercussioni anche notevoli sull’economia aziendale.
Nell’ambito dell’attività di supporto tecnico e diagnostico agli allevamenti svolta dall’Istituto Zooprofilattico Sperimentale della Sicilia,
sono stati riscontrati, in un piccolo allevamento bovino in provincia di Caltanissetta, diversi casi di mastite clinica e sub clinica con
ripetuti isolamenti di Streptococcus canis, patogeno normalmente responsabile di infezioni su cani e gatti (Ling G.V. e Ruby A.M., 1978;
Biberstein E.L. et al., 1980; Clemetson L.L. e Ward A.C., 1990).
A fronte dell’estrema rarità delle segnalazioni bibliografiche a riguardo (Kamburov G. e Mekhandzhiiska L., 1979; Bergner-Rabinowitz
S. et al., 1981; Watts J.L. et al., 1984; Devriese L.A. et al., 1986; Devriese L.A. et al., 1989) gli autori hanno ritenuto interessante segnalare
il caso nella sua evoluzione dal maggio 2002 al maggio 2003.
Materiali e metodi
Lo studio, condotto in un’azienda cerealicolo-zootecnica della Sicilia centrale, ha interessato 33 bovine di razza Frisona,
allevate a stabulazione libera e alimentate a base di concentrati, fieno, insilato di sulla, e paglia prodotti in azienda; nel
periodo primaverile-estivo gli animali si alimentano su prati-pascoli aziendali e la razione giornaliera è integrata con
mangime. Il concentrato viene somministrato durante le due mungiture giornaliere sulla base della produzione di latte
di ciascuna bovina. L’azienda è dotata, dal dicembre 2001, di sala di mungitura a posta fissa mentre in precedenza veniva
utilizzato un impianto di mungitura mobile a secchio.
Le caratteristiche costruttive dell’azienda ed il tipo di allevamento e di alimentazione consentono possibili contatti delle
bovine con cani randagi, inoltre durante il periodo considerato sono stati accolti in allevamento due cuccioli che vivono a
stretto contatto con le bovine.
La ricerca ha avuto inizio nel maggio 2002 a seguito della segnalazione da parte dell’allevatore del manifestarsi, da circa 7-8
mesi, di frequenti e spesso persistenti casi di mastite, resistenti alle terapie effettuate (tetracicline, ampicillina + cloxacillina,
rifampicina, sulfamidico + trimetoprim, cefalexina).
Durante il corso dell’indagine, condotta sino al maggio 2003, sono stati effettuati ripetuti campionamenti di latte sui capi
in lattazione, in relazione alla stagione produttiva e all’insorgenza di nuovi casi. I campioni sono stati prelevati da tutti i
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
161
quarti, dopo aver lavato ed asciugato la mammella, eliminando i primi getti di latte. Tutti i campioni, sono stati trasportati
a + 4°C presso il Centro Latte dell’IZS di Palermo e, entro le 6 ore dal prelievo, sottoposti alla conta delle cellule somatiche
(SCC) in citometria di flusso. All’inizio della ricerca, nei campioni con valori superiori a 300.000 cellule/ml, si è proceduto
all’esame microbiologico per l’isolamento e la tipizzazione dei germi mastidogeni mediante semina su piastre di AS, MSA
e TKT; successivamente tale procedura è stata estesa a tutti i campioni. Sono stati effettuati, inoltre, alcuni campionamenti
di latte di massa sottoposti ai controlli quali-quantitativi di routine ed ai medesimi esami microbiologici. Nel febbraio
2003 è stato condotto un approfondimento delle indagini microbiologiche prelevando dai due cani presenti in stalla (età
circa 8-10 mesi) tamponi nasali, gengivali, auricolari e vaginali e campioni di urina. Sui patogeni isolati è stato condotto
l’antibiogramma secondo la tecnica di Kirby Bauer.
Risultati
Nella tabella 1 e 2 è riportata la valutazione dello stato sanitario delle bovine sulla base del contenuto in SCC prima
e dopo l’immissione dei nuovi capi. In particolare viene riportato nelle colonne 4 e 5 il numero dei capi e dei relativi
quarti che mostravano un valore in SCC elevato.
Dall’indagine microbiologica volta all’isolamento di agenti mastidogeni è stata ripetutamente riscontrata la presenza
di uno streptococco β-emolitico, appartenente al gruppo G di Lancefield ed identificato come Streptococcus canis
in base alle prove biochimico-enzimatiche (lattosio, ribosio, salicina, ADH e β-galattosidasi positivi; mannitolo,
raffinosio, sorbitolo, trealosio, ippurato, VP e β-glucuronidasi negativi).
Nelle tabelle 3 e 4 sono riportati rispettivamente i dati relativi agli isolamenti di Streptococcus canis e stafilococchi coagulasi
negativi dai singoli animali e dai quarti mammari.
Tab. 1 – Valutazione dello stato sanitario delle bovine in lattazione sulla base del contenuto in CSS del latte
Mese di
prelievo
Capi
presenti
Capi
saggiati
Capi con cellule
somatiche
>300.000/ml
N. totale di quarti
appartenenti a
bovine con CSS
>300.000/ml
N. di quarti con
cellule somatiche
>300.000/ml
Numero medio di
quarti con cellule
somatiche >300.000/
ml per capo
Maggio
2002
33
24
14 (58,3 %)
53
38
2-3
Luglio
2002
33
32
24 (75%)
92
32
1-2
Tab. 2 – Valutazione dello stato sanitario delle bovine in lattazione sulla base del contenuto in CSS del latte dopo
l’immissione dei nuovi capi.
Mese di
prelievo
Gennaio
2003
FebbraioMarzo
2003
Maggio 2003
N. totale
di quarti
appartenenti a
bovine con CSS
>300.000/ml
N. di quarti con
cellule somatiche
>300.000/ml
Numero medio
di quarti con
cellule somatiche
>300.000/ml per
capo
Capi
presenti
Capi
saggiati
Capi con
cellule
somatiche
>300.000/ml
27
24
13 (54,1 %)
48
25
2
27
26
17 (65,4 %)
63
31
2
30
21
13 (61.9 %)
50
20
1-2
Tabella 3 - Isolamento di Streptococcus canis
Mese di prelievo
Capi saggiati
Isolamento Streptococcus canis Capi
Isolamento Streptococcus canis Quarti
Maggio 2002
24
5
6
Luglio
2002
32
1
2
Gennaio 2003
24
3
3
Febbraio-Marzo
2003
26
7
10
Maggio
21
3
6
162
2003
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Tabella 4 – Isolamento di stafilococchi coagulasi negativi (SNC)
Mese di prelievo
Capi saggiati
Capi positivi SNC
Quarti positivi
SNC
Quarti positivi
SNC con SCC
> 300.000/ml
Quarti positivi
SNC con SCC
< 300.000/ml
Maggio 2002*
24
4*
6*
6*
--
Luglio
32
17*
32*
27*
5*
Gennaio 2003
24
24
56
23
33
Febbraio - Marzo
2003
26
18
47
17
30
Maggio
21
16
22
7
15
2002*
2003
* Nel mese di maggio le indagini microbiologiche sono state effettuate solo sui campioni di latte con SCC >300.000/
ml, nel mese di luglio sui capi in cui almeno un quarto presentava SCC >300.000/ml
Discussione e conclusioni
Dal complesso degli accertamenti svolti risulta un’alta percentuale di capi con SCC elevate, a testimonianza di condizioni
di generale sofferenza dell’apparato mammario. S. canis è stato ripetutamente isolato, a fronte di un’assenza di altri
streptococchi tipicamente mastidogeni (S. agalactiae e S. dysgalactiae) e di un unico isolamento di Staphylococcus aureus in
un singolo quarto. Discretamente presenti, inoltre, stafilococchi coagulasi negativi isolati sia in quarti con SCC >300.000/
ml sia inferiori.
Dopo i primi isolamenti, avvalendosi dei risultati forniti dall’antibiogramma, che evidenziava una sensibilità in vitro a
Tetraciclina, Cefalexina e Amoxicillina associata ad acido Clavulanico, è stato consigliato all’allevatore di effettuare
un’idonea terapia con Amoxicillina+Acido Clavulanico su tutti i soggetti con SCC elevate nonché un corretto trattamento
antibiotico su tutti gli animali a fine lattazione. Contemporaneamente venivano prescritte rigorose misure di profilassi
igienico-sanitaria al fine di limitare i rischi di infezione.
Nel prosieguo delle indagini è stato accertato che le misure profilattiche e terapeutiche consigliate non erano state eseguite
correttamente né su tutti gli animali con SCC elevate; in particolare due bovine sulle quali era stato isolato S. canis non
sono state sottoposte a terapia. Dagli esiti delle analisi effettuate nel mese di luglio si ha motivo di ritenere, comunque, che
anche per i pochi animali trattati la terapia non abbia dato esito soddisfacente.
A seguito dei deludenti risultati ottenuti, l’allevatore ha provveduto nel mese di agosto ad eliminare parte (50%) delle
bovine con tenore in SCC elevato, mantenendo però un soggetto sicuramente eliminatore di S. canis. Subito dopo il
gruppo delle bovine da latte veniva reintegrato con l’acquisto di 7 giovenche e l’immissione di due manze di rimonta
interna. Trascorsi circa 4 mesi, persistendo le medesime condizioni di allevamento, sono stati segnalati nuovi casi di mastite
e nei mesi di gennaio, febbraio e maggio è stato nuovamente isolato S. canis da 7 soggetti.
E’ da rilevare (come si evince in tabella 3) che la presenza di S. canis è stata ripetutamente riscontrata in più quarti appartenenti
a singole bovine, in particolare nel mese di maggio 2003 da una delle giovenche acquistate è stato isolato S. canis in tre singoli
quarti. La concentrazione del patogeno nel latte è risultata sempre elevata e gli isolamenti in purezza (solo in 4 casi si trovava in
associazione a stafilococchi coagulasi negativi); nei mesi di luglio 2002 e febbraio 2003 è stato isolato anche dal latte di massa.
I due cani presenti in allevamento, nonostante vivano a stretto contatto con le bovine e si alimentino anche con il latte
prodotto dalle stesse, non hanno ad oggi mostrato sintomi clinici di malattia e le indagine microbiologiche condotte nel
mese di febbraio non hanno consentito di dimostrare la presenza di S. canis nei vari campioni prelevati.
Le indagini svolte non hanno permesso di accertare l’origine della malattia e le evidenti carenze nel management sanitario
dell’allevamento non hanno consentito l’attuazione puntuale di protocolli terapeutici e di profilassi. Quanto riscontrato
sembra confermare il possibile ruolo eziologico di Streptococcus canis nelle mastiti bovine, che può assumere carattere
di persistenza e contagiosità con conseguente difficile eradicazione, in particolar modo in presenza di un management
dell’allevamento non rispondente a corretti principi igienico-sanitari.
Bibliografia
Ling G.V. e Ruby A.M. (1978) Aerobic bacterial flora of the prepuce, urethra and vagina of normal adult dogs. - Am.J.Vet.Res. 39:4,
695-698; Kamburov G. e Mekhandzhiiska L. (1979) Biochemical and serological studies of streptococci isolated from mastitic cows
Nauchni-Trudove, - Vissh-Institut-po-Zootekhnika-i-Vet. Med. 26: 2, 131-136; Biberstein E.L., Brown C., Smith T. (1980) Serogroups
and biotypes among beta-hemolytic streptococci of canine origin - J. Cl. Microbiol. 11:6, 558-561; Bergner-Rabinowitz S., Ferne M.,
Fleiderman S., Ziv G., Saran A.,Winkler M. (1981) Group G type X: a new antigenic combination in streptococci isolated from cases
of bovine mastitis in Israel - Vet. Microbiol. 6:4, 383-387; Watts J.L., Nikerson S.C., Pankey J.W. (1984) A case study of streptococcus
group G infection in a dairy herd - Vet. Microbiol. 9:6, 571-579; Devriese L.A., Hommez J., Clipper-Balz R., Schleifer K.H. (1986)
Streptococcus canis sp. Nov.: a species of group G streptococci from animals - Int. J. Systematic Bacteriology 36: 3, 422-425; Devriese
L., Ceyssens K., Hommez J., Vandermeersch R. (1989) Occurence of Streptococcus canis infection among dogs, and cats and cattle
Vlaams-Diergeneeskundig-Tijdschrift 58:1, 11-13; Clemetson L.L. e Ward A.C., (1990) Bacterial flora of the vagina and uterus of
healthy cats - J.A.V.M.A. 196: 6, 902-906.
Ringraziamenti – Si ringraziano I Sigg. Pippo Bono, Augelo Iuculano e Giulio Verro per la preziosa collaborazione tecnica.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
163
SENSIBILITÀ NEI CONFRONTI DEGLI ANTIBIOTICI DI STAFILOCOCCHI ISOLATI NEL
LATTE DI CAPRE CON MASTITE SUBCLINICA
Virdis S., Mureddu A., Campus M.G., Mazzette R., De Santis E.P.L.
Sezione Ispezione degli Alimenti di O.A., Dipartimento di Biologia Animale
Università degli Studi di Sassari
tel 079 229453, fax 079 229458
e-mail: [email protected]
KEY WORDS: Antibiotic Susceptibility, MIC, Staphylococcus spp, Subclinical Mastitis, Goats’ milk
Summary
Minimum inhibitory concentrations were determined on 126 staphylococci strains (n=30 Staphylococcus aureus and n=96
coagulase-negative staphylococci) isolated from half-udder goats’ milk samples with high somatic cell count (>3x105/ml)
and positive bacteriological analysis (>500 cfu/ml). In vitro antibiotic susceptibility of staphylococci was determined by
microdilution method (NCCLS, 1999a) and then compared to the breakpoints of ampicillin (AMP), cephalothin (KF),
cefoperazone (CFP), cloxacillin (OB), novobiocin (NV), ofloxacin (OFX), oxitetracycline (OT) and vancomycin (VA).
The MIC90 for these antimicrobial agents were 2.0, 0.25, 4.0, 1.0, 0.5, 1.0, 16 and 4 μg/ml, respectively. More than 96%
or over of the isolated strains were susceptible to all antimicrobial agents tested, with the exception of AMP (71.4%) and
OT (89.7%). Multiple resistance was detected on 10 strains. CNS displayed greater antibiotic resistance than Staphylococcus
aureus vs AMP, OB, NV, OFX.
Introduzione
Il diffondersi dell’antibiotico resistenza tra i microrganismi patogeni per l’uomo e per gli animali rappresenta una delle
principali problematiche sanitarie degli ultimi anni (Gnanou J.C. et Sanders P., 2000). La selezione o l’emergenza di
microrganismi antibiotico-resistenti può avvenire in ambito prettamente nosocomiale o negli allevamenti zootecnici. Da
questi ultimi può verificarsi una ulteriore disseminazione nell’ambiente e lungo la catena alimentare, attraverso i prodotti
di origine animale (MAFF, 1998). A tale proposito, riveste particolare interesse la valutazione dei fenomeni di resistenza
nei confronti degli antibiotici da parte degli agenti di mastite, clinica e subclinica (Guérin-Faublée V. et Brun Y., 1999).
Da tali patologie nella capra è frequente l’isolamento di microrganismi del genere Staphylococcus (Bergonier et al., 1998),
rappresentati principalmente da Stafilococchi Coagulasi Negativi (55%-95,2%) e da S. aureus (2,6%-37,3%). Le ricerche
sulle caratteristiche di sensibilità di Staphylococcus spp. isolati in casi di mastite subclinica (MSC) della capra sono limitate
(Adegoke G.O. et al., 1982; Bedidi-Madani N. et al., 1992), mentre la maggior parte dei dati si riferisce alla specie bovina
(McDonald J.S. et al, 1981; Mackie D.P. et al., 1988; Owens W.E. et al., 1988; Trinidad P. et al., 1990; Perrin-Coullioud
I. et al., 1991; Watts J.L. et al., 1995; Fthenakis G.G., 1998; Salmon S.A. et al., 1998; Busato A. et al., 2000; Carnevali N.
et Nocetti M., 2001). Gli studi sulla sensibilità di tali patogeni sono stati condotti prevalentemente con il metodo BauerKirby (Wray C. et Gnanou J.C., 2000) piuttosto che mediante microdiluizione in brodo o diluizione in agar (NCCLS,
2000), tecniche che consentono la diretta valutazione della Concentrazione Minima Inibente (MIC). La valutazione della
sensibilità dei microrganismi del genere Staphylococcus spp. isolati in mastiti subcliniche della capra riveste interesse per la
scelta dell’antibiotico da somministrare per via endomammaria in asciutta. Tale pratica terapeutica si è dimostrata infatti
efficace nei confronti delle mastiti subcliniche dei piccoli ruminanti ed è sempre più diffusa negli allevamenti (Poutrel B. et
al., 1997; De Santis E.P.L. et al., 2001). I risultati ottenuti consentiranno inoltre di valutare la diffusione di microrganismi
con antibiotico-resistenza singola o multipla negli allevamenti caprini.
Materiali e metodi
La ricerca è stata condotta su n. 126 ceppi appartenenti al genere Staphylococcus isolati in campioni di latte di capre di
razza sarda e sarda-maltese, allevate allo stato semi brado in n. 6 aziende situate in Sardegna. I microrganismi sono stati
isolati in campioni di latte prelevati nella prima fase della lattazione da emimammelle che non presentavano segni clinici
di mastite, nei quali l’analisi batteriologica aveva evidenziato la presenza di 5 o più colonie con caratteri macroscopici
omogenei ed il contenuto in cellule somatiche (CCS) risultava >300.000/ml. I campioni di latte, prelevati sterilmente,
venivano seminati (10 μl) su agar sangue (5%) e posti ad incubare per 48 - 72 ore a +37°C. La determinazione del
CCS è stata effettuata mediante Fossomatic 360 (Foss Electric), secondo la metodologia descritta in precedenti lavori
(Cosseddu A.M. et al., 1996). Nei confronti dei microrganismi isolati , mediante microdiluizione in brodo (NCCLS
1999a, 1999b), è stata determinata la MIC di 8 antibiotici (ampicillina, cefalotina, cefoperazone, cloxacillina, novobiocina,
ofloxacina, oxitetraciclina e vancomicina), saggiati in concentrazioni comprese tra 0,06 e 128 μg/ml. Relativamente alle
MIC di ciascuno dei chemioantibiotici sono state determinate la moda, il range, la MIC50, la MIC90 e definita la sensibilità,
rapportando i valori rilevati ai breakpoints di riferimento (NCCLS 1999, 2000).
Risultati e discussione
I microrganismi con caratteristiche riferibili alla famiglia Micrococcaceae (n. 126), appartenevano alle specie S. aureus (n.
30; 23,8%), S. caprae (n. 28; 22,2%), S. warneri (n. 18; 14,3%), S. simulans (n. 16; 2,7%), S. chromogenes (n.10; 7,9%),
S. epidermidis (n. 6; 4,8). Altri ceppi, appartenenti alla specie S. equorum (n.=3) oppure a specie meno rappresentate (n.
isolamenti =1) sono stati inclusi nel gruppo “altri SCN”. N.8 (6,35%) ceppi sono stati identificati esclusivamente a livello
di genere (S. spp.). Il CCS/ml (media geometrica) nei campioni di latte dai quali sono stati isolati i microrganismi è risultato
164
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
3,4x106, con range compreso tra 369x103 e 15,8x106. Per ciascuno degli antibiotici saggiati vengono di seguito riportati
ed analizzati i risultati dei test di microdiluizione. Ampicillina (AMP) - la MIC50 era pari a 0,12 μg/ml, la MIC90 2 μg/ml,
la moda 0,06 μg/ml e il range compreso fra 0,06 μg/ml e 16 μg/ml. Nei confronti dell’AMP n. 90 (71,4%) ceppi sono
risultati sensibili e n. 36 resistenti (28,6%). L’AMP, nelle prove condotte in vitro, si è dimostrato il meno efficace tra gli
antibiotici β-lattamici saggiati (tabella 1), contrariamente a quanto osservato in precedenti ricerche su ceppi isolati dalle
capre (Adegoke G.O. et Ojo M.O, 1982). Dei ceppi resistenti la maggior parte era rappresentata dagli SCN (n. 35; 36,5%)
mentre soltanto n. 1 apparteneva alla specie S. aureus (3,3%). La sensibilità nei confronti dell’AMP di Staphylococcus spp.
era compresa tra il 66,6% e il 100% dei ceppi isolati da MSC dell’ovino (Burriel A.R., 1997; Fthenakis G.G., 1998; De
Santis E.P.L. et al., 2000), mentre in isolati da MSC del bovino era del 31%-100% (Mackie D. P. et al., 1988; Trinidad
P. et al., 1990; Umoh V.J. et al., 1990; Fthenakis G.G., 1998; Busato A. et al., 2000; Carnevali N. et Nocetti M., 2001).
Cloxacillina (OB) - la MIC50 era 0,5 μg/ml, la MIC90 1 μg/ml, la moda 0,25 μg/ml ed il range compreso tra ≤0,06 μg/ml
e ≥128 μg/ml. La OB, penicillinasi resistente, risultava efficace nei confronti del 96,8% degli isolati; n. 4 ceppi (3,2%)
resistenti, appartenevano alle specie S. epidermidis (n.1), S. simulans (n.1), S. caprae (n.1) e altri SCN (n.1). Non sono
disponibili in letteratura dati relativi alle MIC della OB nei confronti degli stafilococchi isolati da MSC della capra, mentre,
in ceppi di provenienza ovina, la MIC50 era compresa fra 0,12μg/ml-0,5 μg/ml, la MIC90 0,5μg/ml-2 μg/ml e la sensibilità
compresa tra il 98,8% e il 100% (Burriel A.R., 1997; Fthenakis G.G., 1998; De Santis E.P.L. et al., 2000). In stafilococchi
isolati da MSC del bovino tale valore era compreso tra il 96% e il 100% (Mackie D.P. et al., 1988; Trinidad P. et al., 1990;
Fthenakis G.G., 1998; Busato A. et al., 2000; Carnevali N. et Nocetti M., 2001). Cefalotina (KF) - la MIC50 e la MIC90
risultavano coincidenti (0,25 μg/ml), la moda e il range erano rispettivamente di 0,25 μg/ml e comprese tra 0,06 μg/ml
e 128 μg/ml. Cefoperazone (CFP) - la MIC50 e la MIC90 erano rispettivamente comprese tra 2 μg/ml e 4 μg/ml, la moda
era di 2 μg/ml e il range compreso tra ≤0,06 μg/ml e 32 μg/ml. Nei confronti della KF e del CFP sono risultati sensibili
rispettivamente il 98,4% e il 99,2% dei ceppi testati. I microrganismi resistenti alla KF erano rappresentati da S. aureus (n.
1), S. spp. (n. 1) e solamente n. 1 ceppo della specie S. simulans presentava sensibilità intermedia nei confronti di entrambi
gli antibiotici. I risultati confermano l’eccellente efficacia delle cefalosporine nei confronti dei Gram positivi (Sanders C.C.
e Sanders W.E., 1986). Altri autori hanno rilevato, in ceppi isolati da MSC dell’ovino, una sensibilità nei confronti del CFP
compresa fra il 98,8% ed il 100% (Fthenakis G.G., 1998; De Santis E.P.L. et al., 2000), laddove nel bovino questa variava
tra il 96 ed il 100% (Trinidad P. et al., 1990; Busato A. et al., 2000; Carnevali N. et Nocetti M., 2001). La sensibilità dei
ceppi isolati da MSC della capra nei confronti della KF era del 100% (Bedidi-Madani et al., 1992), compresa tra il 96% e
il 100% in isolati bovini (Trinidad P. et al., 1990; Busato A. et al., 2000; Carnevali N. et Nocetti M., 2001) e tra il 70,56%
e il 100% quando di provenienza ovina (Fthenakis G. G., 1998; Carnevali N. et Nocetti M., 2001). Oxitetraciclina (OT)
- la MIC50 era 0,5 μg/ml, la MIC90 16 μg/ml, la moda 0,25 μg/ml e il range compreso tra ≤0,06 μg/ml e ≥128 μg/ml.
N. 113 (89,7%) ceppi isolati sono risultati sensibili all’OT e n. 13 (10,3%) resistenti. Questi ultimi appartenevano alle
specie S. caprae (n.2), S. epidermidis (n.1), S. aureus (n.5), S. warneri (n.1), S. spp. (n.2) e altri SCN (n.2). Le percentuali
di sensibilità riscontrate in precedenti ricerche nei confronti dell’OT erano comprese tra il 10% e il 68,4% (Adegoke G.O.
et Ojo M.O., 1982; Bedidi-Madani N. et. al., 1992) per i ceppi di provenienza caprina, tra il 78,3% e il 100% per gli
isolati dall’ovino (Fthenakis G.G., 1998; Burriel A.R., 1997; De Santis E.P. L. et al., 2000) e tra il 66,6% e il 100% nel
bovino (Mackie D.P. et al., 1988; Vecht U. et al., 1989; Trinidad P. et al., 1990; Busato A. et al., 2000; Fthenakis G.G.,
1998; Carnevali N. et Nocetti M., 2001). Novobiocina (NV) - la MIC50 era di 0,12 μg/ml, la MIC90 0,5 μg/ml, la moda
0,06 μg/ml e il range compreso tra 0,06 μg/ml e 32 μg/ml. Il 95,2% degli isolati era sensibile a questo antibiotico. I ceppi
novobiocina-resistenti appartenevano alla categoria “altri SCN” (n.6), erano rappresentati dalle specie S. equorum (n.3), S.
gallinarum (n.1), S. chonii (n.1) e S. xylosus (n.1). La sensibilità nei confronti della NV riveste interesse soprattutto sotto il
profilo tassonomico ed è specifica per gli SCN dotati di maggiore attività patogena (Deinhofer M. et Pernthaner A., 1995).
Nei confronti di questo antibiotico la sensibilità degli SCN isolati da MSC era compresa tra l’81,9% e il 93,9% nei ceppi
di provenienza ovina (Burriel A.R., 1997; De Santis E.P.L. et al., 2000) e tra l’83,4% e il 100% in quelli bovini (Trinidad P.
et al., 1990; Owens W.E. et al., 1997). Vancomicina (VA) - la MIC50 era di 2 μg/ml, la MIC90 4 μg/ml, la moda 2 μg/ml e
il range compreso tra 0,06 μg/ml e 4 μg/ml. Tutti gli stafilococchi saggiati erano sensibili alla VA conformemente a quanto
rilevato da altri autori (McDonald J.S. et al., 1981; Owens W.E. et al., 1988; Gutierrez L.M. et al., 1990; Bedidi-Madani
N. et al., 1992; De Santis E.P.L. et al., 2000). Ofloxacina (OFX), la MIC50 era di 0,5 μg/ml, la MIC90 1 μg/ml, la moda
0,5 μg/ml e il range compreso tra ≤0,06 μg/ml e 32 μg/ml. Sono risultati sensibili n. 123 (97,6%) ceppi. I microrganismi
resistenti e con sensibilità intermedia erano rappresentati rispettivamente da S. epidermidis (n.2) e S. caprae (n. 1). La
sensibilità degli Stafilococchi isolati da MSC dell’ovino nei confronti dell’OFX era pari al 92,1% (De Santis E.P.L. et al.,
2000). N. 10 ceppi (7,9%) presentavano resistenza multipla (tabella 2). Le specie contemporaneamente resistenti a due
o più antibiotici erano: S. aureus (AMP-OT), S. equorum (AMP-NV), S. gallinarum (AMP-NV-OB), S. simulans (AMPOB), S. warneri (AMP-OT), S. xylosus (NV-OT), S. spp. e n. 2 S. caprae (AMP-OT). N. 1 ceppo appartenente alla specie
S. epidermidis ha dimostrato resistenza nei confronti di quattro differenti antibiotici (AMP-OB-OFX-OT).
Conclusioni
I microrganismi del genere Staphylococcus isolati da casi di mastite subclinica della capra hanno dimostrato buona sensibilità
nei confronti di tutti gli antibiotici saggiati, ad eccezione dell’ampicillina. Gli SCN presentavano sensibilità inferiore
rispetto a S. aureus nei confronti dell’AMP (63,5% vs 96,7%), OB (95,8% vs 100%), OFX (97,9% vs 100%) e NV
(93,7% vs 100%). Soltanto nei confronti dell’OT la frequenza di ceppi di S. aureus resistenti è risultata più elevata rispetto
a quella degli SCN (16,7% vs 7,3%). E’ stata inoltre riscontrata resistenza multipla in n. 10 ceppi (7,9%), che in un
caso (S. epidermidis), era relativa a quattro degli antibiotici saggiati (AMP-OB-OFX-OT). Il fenomeno dell’antibiotico
resistenza pertanto è stato rilevato con maggiore frequenza negli SCN piuttosto che in S. aureus. Tuttavia è nota da tempo
la possibile trasmissione interspecifica di tale resistenza tra i microrganismi del genere Staphylococcus mediante plasmidi
e trasposoni (Lyon B.R. et Skurray R., 1987), che è indipendente dal grado di patogenicità. E’ stato infatti descritto il
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
165
trasferimento della resistenza da ceppi di SCN (S. epidermidis) a S. aureus (Jaffe H.W et al., 1980). L’antibiotico resistenza
rilevata in microrganismi del genere Staphylococcus isolati da casi di mastite subclinica della capra, rappresenta un possibile
rischio da considerare, non soltanto in relazione a risvolti clinici e terapeutici, ma anche per quanto concerne la sicurezza
alimentare.
Tabella 1 - Ceppi Sensibili (S), Intermedi (I), Resistenti (R) e relative percentuali (%). MIC50, MIC90, moda e range
delle MIC.
antibiotici
n°
S
%S
I
%I
R
%R
MIC50
MIC90
moda
range
AMP
126
90
71,4
0
0,0
36
28,6
0,12
2
0,06
0,06 - 16
CFP
126
125
99,2
1
0,8
0
0,0
2
4
2
0,06 - 32
KF
126
124
98,4
1
0,8
1
0,8
0,25
0,25
0,25
0,06 - 128
NV
126
120
95,2
0
0,0
6
4,8
0,12
0,5
0,06
0,06 - 32
OB
126
122
96,8
0
0,0
4
3,2
0,5
1
0,25
0,06 - ≥128
OFX
126
123
97,6
1
0,8
2
1,6
0,5
1
0,5
0,06 - 32
OT
VA
126
126
113
126
89,7
100,0
0
0
0,0
0,0
13
0
10,3
0,0
0,5
2
16
4
0,25
2
0,06 - ≥128
0,06 - 4
AMP=Ampicillina; CFP=Cefoperazone; KF=Cefalotina; NV=Novobiocina.; OB=Cloxacillina; OFX=Ofloxacina;
OT=Ossitetraciclina; VA=Vancomicina (Breakpoints NCCLS).
Tabella 2 - Resistenza multipla agli antibiotici: MIC (μg/ml) superiori ai breakpoints (NCCLS 1999, 2000)
specie
S. aureus
S. caprae
S. caprae
S. epidermidis
S. equorum
S. gallinarum
S. simulans
S. spp
S. warneri
S. xylosus
AMP
0,5
2
8
8
2
1
0,5
0,5
1
-
CFP
-
KF
-
NV
2
4
32
OB
>128
4
16
-
OFX
8
-
OT
128
≥128
≥128
≥128
128
≥128
≥128
VA
-
Bibliografia
A review of antimicrobial resistance in the food chain, A technical report for MAFF, July 1998.
Adegoke G.O., Ojo M.O. (1982). Biochemical characterization of staphylococci isolated from goats. Vet. Microbiol., 7, 463470.
Bedidi-Madani N., Richard Y., Borges E., Lerondelle C. (1992). Identification and susceptibility to antibiotics of coagulase negative
staphylococci isolated from goat milk. Rev. Méd. Vét., 143, 539-545.
Bergonier D., Berthelot X., Romeo M., Contreras A., Coni V., De Santis E.P.L., Rolesu S., Barillet F., Lagriffoul G., Marco J. (1998).
Frèquence des diffèrents germes responsables de mammittes cliniques chez les petits ruminants laitiers. 6th International Symposium on
the Milking of Small Ruminants., Athens.
Burriel A.R. (1997). Resistance of coagulase negative staphylococci isolated from sheep to various antimicrobial agents. Res. Vet. Sci.,
63, 189-190.
Busato A., Trachsel P., Schällibaum M., Blum J.W. (2000). Udder health and risk factors for subclinical mastitis in organic dairy farms
in Switzerland. Preventive Veterinary Medicine, 44, 205-220.
Carnevali N., Nocetti M. (2001). Indagine sulla sensibilità agli antibiotici di ceppi di S. aureus isolati da latte bovino in cinque anni. Atti
della Società Italiana di Buiatria. Vol XXXII, 231-137.
Cosseddu A.M., Spissu A., De Santis E.P.L., Mazzette R. (1996). Some microbiological causes of the increase of somatic cells in
sheep milk. Proceedings of International Symposium Somatic Cells and milk of small ruminants. Wageningen Pers. Wageningen (the
Netherlands).
Deinhofer M., Pernthaner A. (1995). Staphylococcus spp. as mastitis-related pathogens in goat milk, Vet. Microbiol, 43, 161-166.
De Santis E.P.L., Mencarelli A., Nieddu M.P., Farina S., Mazzette R., Sanna S., Virdis S. (2001). Efficacia della somministrazione
endomammaria di cloxacillina benzatina per il trattamento delle infezioni intramammarie dell’ovino nel corso dell’asciutta. Large
Animal Review., 7, 39-47.
De Santis E.P.L., Virdis S., Mazzette R., Nieddu M.P., Farina S., Corona A. (2000). Sensibilità nei confronti degli antibiotici di
stafilococchi coagulasi negativi isolati in mastiti subcliniche dell’ovino. Atti del XIV Congresso Nazionale S.I.P.A.O.C., 79-82.
Fthenakis G.G. (1998). Susceptibility to antibiotics of staphylococcal isolates from cases of ovine or bovine mastitis in Greece. Small
Rum. Res., 28, 9-13.
Gnanou J.C., Sanders P. (2000). Antibiotic resistance in bacteria of animal origin: methods in use to monitor resistance in EU countries.
International Journal of Antimicrobial Agents. 15, 311–322.
Guérin-Faublée V., Brun Y. (1999). La résistance aux antibiotiques chez les staphylocoques d’origine animale. Revue Méd. Vét., 150,
299-312.
166
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Gutierrez L.M., Garcia Lopez M.L., Otero A., Garcia Fernandez, Moreno B. (1990). Incidence of staphylococci in ovine mastitis milk
and antibiotic susceptibility of the strains. Milchwissenschaft, 45, 778-781.
Jaffe H.W., Sweeney H.M., Nathan C., Weinstein R.A., Kabins S.A., Cohen S. (1980). Identity and interspecific transfer of gentamicinresistance plasmids in Staphylococcus aureus and Staphylococcus epidermidis. J. Infect. Dis., 141, 738-747.
Lyon B.R., Skurray R. (1987). Antimicrobial resistance of Staphylococcus aureus: genetic basis. Microbiol. Rev., 51, 88-134.
Mackie D.P., Logan E.F., Pollock D.A., Rodgers S.P. (1988). Antibiotic sensitivity of bovine staphylococcal and coliform mastis isolates
over four years. Veterinary Record, 12, 515-517.
McDonald J.S., Anderson A.J. (1981). Antibiotic sensitivity of Staphylococcus aureus and coagulase negative stafilococchi isolated from
infected mammary glands. Cornell Vet., 71, 391-396.
NCCLS (1999a). Performance Standards for Antimicrobial Disk and Dilution Susceptibility Test for Bacteria Isolated from Animals;
Approved Standard. Document M3 1 -A Vol. 19 No 11.
NCCLS (1999b). Development of in Vitro Susceptibility Testing Criteria and Quality Control Parameters for Veterinary Antimicrobial
Agents; Approved Guideline. Document M3 7-A Vol. 15 No 3.
NCCLS (2000). Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically; Approved Standard-Fifth
Edition. Document M7-A5.
Owens W.E., Ray C. H., Watts J.L., Yancey R.J. (1997). Comparison of success of antibiotic therapy during lactation and results of
antimicrobical susceptibility tests for bovine mastitis. J. Dairy Sci., 80, 313-317.
Owens W.E., Watts J.L. (1988). Antimicrobial susceptibility and β-lactamase testing of staphylococci isolated from dairy herds. J. Dairy
Sci., 71, 1934-1939.
Perrin-Coullioud I., Martel J.L., Brouillet P., Fedida M. (1991). Identification et sensibilité aux antibiotiques des diverses espéces
de staphylocoques associées à des mammites bovines inapparentes et subcliniques. Revue Mèd Vèt., 142, 39-47.
Poutrel B., de Crémoux R., Ducelliez M., Vernau D. (1997). Control of intramammary infections in goat : impact on somatic cell
counts. Journal of Animal Science., 75, 566-570.
Salmon S.A., Watts J.L., Aarestrup F.M., Pankey J.W., Yancey R.J. (1998). Minimum inibitory concentration for selected antimicrobial
agents against organisms isolated from the mammary glands of dairy heifers in New Zealand and Denmark”. J. Dairy Sci., 81, 570578.
Sanders C.C., Sanders W.E. (1986). The cephalosporins and cephamycins. Pages 66-90 in The Antimicrobial Agents Annual 1. P. K.
Peterson, J. Verohef, ed. Elselvier Scientific Publisshers, New York, NY.
Trinidad P., Nickerson S.C., Luther D.G. (1990). Antimicrobial susceptibilities of staphylococcal species from mammary glands of
unbred and primigravid dairy heifers. J. Dairy Sci., 73, 357-362.
Umoh V.J., Adesiyun A. A., Gomwalk N. E. (1990). Antibiogram of staphylococcal strains isolated from milk and milk-products. J.
Vet. Med., 37, 701-706.
Vecht U., Wisselink H. J., Vette H. M. (1989). Sensitivity pattern of Staphylococcus aureus isolated from quarter milk from cattle.
Tijdschr Diergeneeskd., 114, 260-269.
Watts J.L., Salmon S.A., Yancey R. J., Nickerson S.C., Weaver L. J., Holmberg C., Pankey J.W., Fox L.K. (1995). Antimicrobial
susceptibility of microorganisms isolated from the mammary glands of dairy heifers. J. Dairy Sci., 78, 1637-1648
Wray C., Gnanou J.C. (2000). Antibiotic resistance monitoring in bacteria of animal origin: analysis of national monitoring programmes.
International Journal of Antimicrobial Agents 14, 291–294.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
167
CORRELAZIONE TRA CALIFORNIA MASTITIS TEST, CONTENUTO IN CELLULE
SOMATICHE E STATO SANITARIO DELLA MAMMELLA NELLA PECORA DA CARNE
CORRELATION AMONG THE CALIFORNIA MASTITIS TEST, THE SOMATIC CELLS
CONTENT AND THE HEALTH STATUS OF THE UDDER IN THE MEAT SHEEP
Aliberti A.1, Alessi A.1, Decaro N.2, Daidone A.1, Orlandella B.M.1, Fisichella V.1, Buonavoglia D.1
1)
Dipartimento di Sanità Pubblica Veterinaria, sez. Malattie Infettive, Facoltà di Medicina Veterinaria - Messina
2)
Dipartimento di Sanità e Benessere Animale, Facoltà di Medicina Veterinaria – Valenzano (Bari)
Riassunto
E’stata condotta una ricerca su 102 pecore da carne al fine di valutare la correlazione tra il California Mastitis Test (CMT)
ed il Contenuto delle Cellule Somatiche (CCS) in corso di mastite.
La ricerca è stata condotta su circa 2400 campioni di latte, prelevati settimanalmente durante tutto il periodo di allattamento
dell’agnello (12 settimane).
Su ogni campione è stato effettuato l’esame batteriologico, il CMT e la conta delle cellule somatiche.
I risultati ottenuti permettono di affermare che, in base allo stato sanitario della mammella valutato con l’esame batteriologico,
il numero delle cellule somatiche è correlato in maniera significativa con gli scores del CMT (P<0.025).
Summary
A research on 102 meat sheep was carried out to evaluate the correlation between the California Mastitis Test (CMT) and
the Content of Somatic Cells (SCC) in the presence of mastitis.
The research was based on analysis of about 2400 milk samples, collected weekly throughout the lactation period of the
lambs (12 weeks).
Each sample was tested by bacteriological examinations, by the CMT and by evaluation of the SCC.
The results obtained allow us to observe that, on the basis of the health status of the udder, evaluated by the microbiological
examinations, the number of somatic cells is significantly related to the CMT scores (P<0.025).
Introduzione
Le mastiti rappresentano un problema igienico-sanitario molto grave per l’allevamento della pecora da latte.
Clinicamente le mastiti possono essere distinte in cliniche e subcliniche e, se da una parte le mastiti cliniche, responsabili
di ingenti perdite economiche per la morte degli animali e per l’eliminazione prematura dei soggetti colpiti, si sono ridotte
notevolmente, quelle subcliniche possono interessare anche il 25-35% dei capi in produzione (de la Crutz M. et al.,
1994; De Santis E.P.L. et al., 1996). Queste, pur senza compromettere la vita e la carriera produttiva degli animali colpiti,
alterando la composizione del latte prodotto, ne riducono la resa alla caseificazione e, nella pecora da carne, incidono
negativamente sull’incremento ponderale dell’agnello (Ahmad G. et al., 1992; Fthenakis G.C. e Jones J.E.T., 1990; Keisler
D.H. et al., 1992).
Negli ultimi anni, numerosi Ricercatori hanno correlato lo stato sanitario della mammella nei piccoli ruminanti con il
contenuto di cellule somatiche (CCS) nel latte prodotto (Bergonier D. et al., 1995), anche se un aumento sensibile del
CCS, a volte, non deriva da cause infettive, ma fisiologiche quali l’età degli animali, il periodo della lattazione o, più
semplicemente, per il sistema di mungitura adottato.
Come per il bovino, anche per i piccoli riminanti è stato più volte suggerito di tracciare una linea guida che fissi alcuni
standard igienico-sanitari per il latte prodotto; per quanto riguarda il parametro CCS, dopo avere più volte cercato di fissare
il livello soglia, a tutt’oggi non esiste alcun valore di riferimento.
Il CCS rappresenta un valido parametro per identificare episodi di mastite, anche se la sensibilità spesso si riduce in corso
di mastite sostenuta da patogeni poco virulenti (Aliberti A. et al., 2002a; Aliberti A. et al., 2002b)
Nella presente nota si descrive la correlazione tra contenuto di cellule somatiche, California Mastitis Test (CMT) e stato
sanitario della mammella ai fini della diagnosi di mastite sub-clinica nella pecora da carne.
Materiale e Metodi
Animali - La ricerca è stata condotta su 102 pecore da carne, razza Bergamasca, durante l’intero periodo di allattamento
dell’agnello (12 settimane). Gli animali appartenevano a 3 allevamenti (a, b, c) della Sicilia Nord-Orientale, alimentati
prevalentemente con sottoprodotti agro-alimentari, integrati con mangime.
Gli animali del gruppo sperimentale, sono stati scelti previo esame clinico della mammella e dello stato generale
(Donovan G.A. et al 1992).
Protocollo sperimentale
Campioni – Complessivamente sono stati esaminati 2.448 campioni di latte. A partire dal terzo giorno post-partum,
settimanalmente, da ogni singola emimammella degli animali del gruppo sperimentale sono stati prelevati campioni
di latte per l’esame batteriologico, per la conta delle cellule somatiche e per la determinazione di altri parametri di
laboratorio. Al momento della raccolta dei campioni di latte in provette sterili, i capezzoli venivano puliti con apposite
salviettine imbevute di clorexidina.
Esame batteriologico – L’esame batteriologico è stato effettuato secondo le indicazioni del National Mastitis Council
(1999), utilizzando i seguenti terreni di coltura: Agar nutritivo al 5% di sangue defibrinato di montone, Agar Verde
Brillante e Staphilococcus medium 110 (OXOID), in piastre di Petri, per la ricerca di Staphilococcus aureus, enterobatteri e
Stafilococchi coagulasi negativi (SCN).
168
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Ogni piastra è stata seminata con 50μl del campione ed incubata a 37°C per 48 ore, valutando giornalmente lo
sviluppo di colonie e considerando negative quelle piastre che non presentavano lo sviluppo di almeno 5 colonie
morfologicamente omogenee. Ogni tipo morfologico di colonia è stato isolato e sottoposto a prove preliminari di
identificazione, prima di procedere alla caratterizzazione biochimica mediante API-test (Bio-Meriéux, Francia).
Cellule Somatiche – La conta delle cellule somatiche è stata effettuata con Fossomatic (metodo fluoro-opto-elettronico) su
campioni di latte (50 ml), addizionati con 100μl di azidiol alla concentrazione di 0.1ml/40ml.
California Mastitis Test – A 2 ml di latte è stata aggiunta la stessa quantità di reattivo CMT (lauril-etere-solfato al 3%
in H2O distillata) e l’interpretazione dei risultati ha tenuto conto di uno score a cinque gradi (da 0 a 4) che, in base alle
caratteristiche assunte dalla miscela latte/reattivo, classificava il campione come negativo, traccia, debolmente positivo,
positivo e molto positivo.
Analisi statistica – I risultati ottenuti sono stati inseriti in database ed analizzati con programma Microsoft Excel 2000
con P<0.05
RISULTATI
Duemilacentocinquantanove campioni esaminati, pari all’88%, sono risultati batteriologicamente negativi per tutta la
durata della prova.
Dai restanti 289 campioni, costantemente è stato possibile isolare microrganismi responsabili di mastite che, in
accordo con le indicazioni del FIL/IDF (1999), sono stati classificati come patogeni maggiori (Staphylococcus aureus e
Streptococchi emolitici) e patogeni minori (Stafilococchi coagulasi negativi, Micrococchi, Bacillus spp, Streptococchi non
emolitici e Corynebacterium spp.) (grafico 1).
grafico 1:microrganismi isolati dalle emimammelle infette
Nella tabella 1 è riportata la relazione tra il CMT ed il contenuto di cellule somatiche, così che allo score zero di CMT
corrisponde un valore medio di cellule somatiche di 73.772/ml-1, allo score 1 corrisponde un valore di 295.782/ml-1 e per
gli scores 2, 3 e 4 corrispondono, rispettivamente, valori di 532.557, 1.899.177 e 5.641.840/ml-1. La correlazione tra CMT
e CCS, valutata con il calcolo del r di Pearson, è risultata pari a 0.86 (P<0.025) (grafico 2), mentre l’analisi della varianza
(ANOVA) ha rilevato una differenza altamente significativa (P<0.001) tra gli scores di CMT.
tab. 1: Analisi descrittiva scores del CMT.
CCS
Media
E.S.
D.S.
Min.
Max
L.F. (95%)
0
73.772
2.010
51.423
12.000
358.000
3.945
1
295.782
8.837
157.340
73.000
886.000
17.387
Scores CMT
2
532.557
22.030
172.062
278.000
984.000
44.067
3
1.899.177
79.388
620.046
754.000
2.912.000
158.801
4
5.641.840
526.378
3.722.057
2.686.000
19.991.000
1.057.796
graf. 2: correlazione tra CCS eCMT
Nella tabella 2 è riportata la distribuzione dei campioni in relazione al CMT ed allo stato sanitario della mammella, da
dove si può evincere come la maggior parte dei campioni negativi abbia trovato collocazione negli scores zero, 1 e 2 di
CMT. I campioni infetti da patogeni responsabili di mastite sub clinica (patogeni minori) si sono distribuiti nei cinque
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
169
scores di CMT, con una maggiore prevalenza negli scores 3 e 4, mentre i campioni infetti da patogeni maggiori si sono
collocati solo negli scores 3 e 4 di CMT.
tab. 2: Distribuzione campioni in funzione di CMT, CCS e stato sanitario delle mammelle.
Score CMT
0
1
Media CCS
73.772
295.782
negativi
2
532.557
3
4
1.899.177
5.641.840
1.372
64%
668
31%
117
5%
2
=
0
=
patog. minori
20
9%
18
8%
15
7%
102
45%
71
31%
patog. magg
=
=
=
=
1
2%
27
43%
35
55%
graf. 3: Distribuzione dei campioni in funzione dell’IIM e CMT
Conclusioni
I risultati dell’esame batteriologico confermano che la prevalenza di mastite sub-clinica negli animali da carne è compresa
tra il 10% e il 15%. (Keisler D.H. et al., 1992).
Come per la pecora da latte, anche per quella da carne, in corso di mastite, il parametro che maggiormente risente dello
stato sanitario della mammella è il contenuto delle cellule somatiche. In base ai risultati ottenuti nella presente indagine,
è emerso che esiste una correlazione significativa tra infezione mammaria e aumento delle cellule somatiche nel latte
prodotto; pertanto, il parametro CCS, potendo indurre variazioni in aumento in corso di infezione mammaria, potrebbe
essere preso in considerazione per la diagnosi di mastite.
L’impiego del CMT per la diagnosi di mastite nella pecora, correlato con il CCS e con l’esame batteriologico del latte, ha
fornito anch’esso risultati statisticamente significativi.
La lettura del CMT è risultata particolarmente agevole quando i campioni esaminati si collocavano negli score 3 e 4 di
CMT.
Considerato che tutti i campioni di latte infetti da patogeni maggiori e la maggior parte di quelli infetti da patogeni minori
si sono collocati negli scores 3 e 4 di CMT e che tutti i campioni batteriologicamente negativi non hanno superato lo
score 2, si può tranquillamente affermare che il CMT, per la semplicità ed i tempi rapidi di esecuzione, nonché per i costi
relativamente contenuti, può essere considerato un test valido per la diagnosi di mastite.
Limiti riguardo alla specificità e alla sensibilità del test, il CMT li manifesta in corso di infezione sostenuta da microrganismi
poco patogeni, tali da indurre un aumento del CCS relativamente basso (falsi negativi) e quando l’aumento delle cellule
somatiche non deriva da cause infettive ma da fattori fisiologici (falsi positivi).
Bibliografia
Ahmad G., Timms L.L., Morrical D. G., Brackelberg P.O. – Dynamics and significance of ovine subclinical intramammary infections
and their effects on lamb performance. – Sheep Res J 1992;8:25-29
Aliberti A., Fisichella V., Alessi A., Tonante C., Costa R., Scatassa M.L., Buonavoglia D. - Cellule somatiche e California Mastitis
Test nella diagnosi di mastite subclinica nella capra. - Atti XV Congresso Nazionale S.I.P.A.O.C, Chia Laguna, Cagliari, 2002a 11-14
settembre 2002, p. 17.
Aliberti A., Fisichella V., Alessi A., Cirone F., Elia G., Rinaldo D., Tonante C., Buonavoglia D. - Indagine microbiologica in corso di
mastite subclinica nella pecora. - Procedings of X Fe.Me.S.P.Rum., Tunisi 2002b, 22-24 September
Bergonier D., Lagrifoull G., Concordet D., Barillet F., Berchelot X. – Dynamique des infections mammaire sub-clinique de la brebis
laitiere en relation avec le comptage de cellules somatique (CCS). – Renc. Rech. Ruminants 1995. 2: 299-302
de la Crutz M., Serrano E., Montoro V., Marco J., Romeo M., Baselga R., Albizu L., Amorena B. – Etiology and prevalence of
subclinical mastitis in the Manchega sheep at mid-lat lactation. – Small Rumin. Res. 1994. 14:175-180
De Santis E.P.L., Mazzette R., Lai G.. Spissu A., Farina S. – Qualità igienico-sanitaria del latte ovino: determinazione del contenuto in
cellule somatiche e infezioni della mammella. – Atti XII° Conv. Naz. S.I.P.A.O.C., Varere, 1996, Oct. 53-56
Donovan G.A., Risco C.A., Shearer J.K. 1992 Veterinary Clinics of North America, 8:2, 361
NMC (National Mastitis Concil) 1999. Laboratory Handbook on Bovine Mastitis -- Revised Edition, Madison, WI
FIL/IDF, 1999: Suggested interpretation of mastitis terminology. Bull. Int. Dairy Fed. 338, 3-26
170
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Fthenakis G.C., Jones J.E.T. – The effect of experimentally induced subclinical mastitis on milk yield of ewes and on the growth of
lambs. – British Vet. J. 1990. 146:43-49
Keisler D.H. Andrews M.L., Moffatt R.J. – Sub-clinical mastitis in ewes and its effect on lamb performance. – J. Anim. Sci. 1992,
70:1677-1681
Pasteurized Milk Ordinance (PMO).1995. Grade “A” Pasteurized milk ordinance. U.S. Dept. of Health and Human Services,
Washington, DC.
Schalm O.W., Carroll E.J., Jain N.C., 1971: Bovine mastitis. Lea and Febinger, Philadelphia
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
171
pagina bianca lasciata intenzionalmente
ATTI
SABATO 24 MAGGIO 2003
DIAGNOSI DI AGALASSIA CONTAGIOSA MEDIANTE UN TEST ELISA BASATO SU
PROTEINE RICOMBINANTI
Zinellu S., Rosa N., Fusco M., Foddai A., Idini G., Chessa G., Rocca S., Ibba B., e Tola S*.
VACCINAZIONE CONTRO IL MYCOPLASMA AGALACTIAE MEDIANTE UN VACCINO A DNA
Rocca S., Fusco M., Idini G., Foddai A., Rosa N., Ibba B., Zinellu S., Chessa G., e Tola S.
IDENTIFICAZIONE DEL MYCOPLASMA AGALACTIAE DAL MYCOPLASMA BOVIS
MEDIANTE POLYMERASE CHAIN REACTION (PCR)
Foddai A., Chessa G., Idini G., Fusco M., Rosa N., Ibba B., Zinellu S., Rocca S., e Tola S.
ANALISI PREDITTIVA PER L’IDENTIFICAZIONE DI ALLEVAMENTI CON SOGGETTI
PERSISTENTEMENTE INFETTI DA VIRUS DELLA DIARREA VIRALE BOVINA (BVDV)
Ciulli S., Ostanello F., Galletti E., Battilani M., Scagliarini A., Cazzoli M.,* Zocca A.*, Prosperi S.
TEST DI WESTERN BLOTTING PER DIFFERENZIARE
LE INFEZIONI DA BRUCELLA SPP. e YERSINIA ENTEROCOLITICA O:9 NEGLI OVINI
Corrente M., Desario C. , Greco G., Madio A. , Scaltrito D. , Consenti B. e Buonavoglia D.
DUE FOCOLAI DI FEBBRE CATARRALE MALIGNA IN BOVINI DEL SUD ITALIA
Decaro N., Tinelli A., Cirone F., Pratelli A., Tempesta M., Buonavoglia C.
ENTERITE NEONATALE DEI RUMINANTI DA ROTAVIRUS: IDENTIFICAZIONE DI UN
NUOVO SIEROTIPO VP4 NEL BUFALO
Martella V., Terio V., Camero M., Campolo M., Cavaliere N., Cafiero M., Buonavoglia C.
ABORTI OVINI E CAPRINI IN SARDEGNA RIFERITO A TOXOPLASMA GONDII, COXIELLA
BURNETII E CHLAMYDOPHILA ABORTUS : ANALISI DEL QUADRIENNIO 1999-2002
Tanda A., Porcu., Madau L., Gallisai E., Cillara G., Sanna S., Tola S., Masala G.
XI Congresso
Internazionale
della Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
173
DIAGNOSI DI AGALASSIA CONTAGIOSA MEDIANTE UN TEST ELISA
BASATO SU PROTEINE RICOMBINANTI
Zinellu S., Rosa N., Fusco M., Foddai A., Idini G., Chessa G., Rocca S., Ibba B., e Tola S*.
*Istituto Zooprofilatto Sperimentale della Sardegna “G. Pegreffi”, 07100 Sassari.
Riassunto
In questo lavoro, il gene p80 del Mycoplasma agalactiae è stato inserito in “open reading frame” nel polylinker del plasmide
pQE-30 (Qiagen). L’Escherichia coli, contenente il plasmide ricombinante, è stato fatto crescere in Luria Broth fino alla fase
logaritmica di crescita e successivamente indotto per 18 ore con isopropyl-1-thio-β-D-galactoside (IPTG). La proteina,
corrispondente al gene p80, è stata denaturata con Urea 8M, successivamente estratta con colonne di affinità all’acido
nickel-nitrilotriacetico ed infine quantificata allo spettrofotometro a 750 nm. Piastre di polistirene a 96 pozzetti sono state
sensibilizzate con 10 µg/pozzetto di proteina ricombinante in tampone carbonato-bicarbonato pH 9.6 a 4°C per 18 ore.
Dopo vari lavaggi con PBS contenente Tween20, la piastra è stata incubata con i sieri di pecora provenienti da un’infezione
sperimentale con M.agalactiae. Come controllo positivo si è utilizzato un siero di una pecora malata naturalmente. L’ELISA
con la proteina ricombinante si è dimostrato un metodo rapido e sensibile per la diagnosi di agalassia contagiosa.
Introduzione
L’agalassia contagiosa (a.c.) è una sindrome che colpisce i piccoli ruminanti ed è caratterizzata principalmente da
mastite e secondariamente da artrite e cheratocongiuntivite. L’a.c. fece la sua comparsa in Sardegna nel 1980 in seguito
all’introduzione di ovini portatori-eliminatori provenienti dalla Sicilia. In pochi anni la malattia ha colonizzato quasi
tutta l’isola provocando danni economici molto rilevanti, quantizzati in circa 10-15 miliardi/annui (Leori, 1997). La
diffusione dell’a.c. è dipesa da una serie di motivi legati, in prima istanza, all’alto numero di capi ovi-caprini presenti
in Sardegna (3.5 milioni di capi, circa 1/3 del patrimonio nazionale) e all’altissima densità di animali/km2; in seconda
istanza, alle caratteristiche strutturali dell’allevamento ovino in Sardegna (pascolo brado, transumanza, scambio di animali)
e infine, in terza istanza, all’inadeguatezza delle misure di polizia veterinaria, diagnostiche e profilattiche. Per quanto
riguarda la diagnosi, è stato messo a punto un sistema diagnostico basato sulla Polymerase Chain Reaction (PCR) in grado
di evidenziare la presenza di M. agalactiae nel latte ovino in solo 5 ore (Tola et al, 1996, 1997). Risultati molto interessanti
si sono conseguiti anche nella caratterizzazione genetica e proteica del M. agalactiae. L’analisi degli antigeni di membrana ha
permesso di evidenziare 6 principali proteine immunodominanti. In particolare, la proteina di 80 kDa è presente in tutti i
ceppi di M. agalactiae analizzati fin dai primi stadi d’infezione e potrebbe risultare un’ ottima candidata per l’allestimento
di un sistema diagnostico basato su proteine ricombinanti..
Materiali E Metodi
Estrazione del DNA dal ceppo di referenza- Il DNA è stato estratto dal ceppo di referenza PG2 utilizzando le metodiche
descritte da Ausubel et al. (1992); mentre la concentrazione del DNA è stata determinata mediante lettura spettrofotometrica
(Sambrook et al., 1989).
PCR del gene ma-mp81- Due primers, contrassegnati con KpnI-F e HindIII-R, sono stati disegnati a partire dalla sequenza
del gene p80 del M. agalactiae riportata in banca-dati sotto il numero di accesso X95628. Un μl di DNA totale di M.
agalactiae è stato utilizzato in 25 μl di una reazione standard di PCR costituita da: 2.5 μl di buffer 10X (Roche), 2.5 μl
di 50 mM MgCl2, 1 μl di primer reverse e forward alla concentrazione di 25 pmole/μl, 0.5 μl di 1.25 mM dNTP, 0.2 μl
di 5 U/μl Taq polymerase (Roche) e 12.3 μl di H2O. Le reazioni di PCR sono state effettuate in un Thermal cycler 9700
della Applied Biosystems utilizzando i seguenti parametri: denaturazione iniziale a 95 °C per 5 min., 30 cicli di 1 min di
denaturazione a 95 °C, 1 min di annealing a 52 °C e 1 min. di estensione a 72°C. Gli ampliconi sono stati fatti correre
a 100 V in un gel di agarosio all’1% e visualizzati sotto i raggi ultravioletti in seguito ad una colorazione con bromuro
di etidio. La banda è stata inoltre tagliata dal gel e purificata con il kit Concert Gel della Life Technologies. L’amplicone
concentrato è stato tagliato con gli enzimi di restrizione in modo da renderlo compatibile ed in Open Reading Frame
(ORF) con il plasmide pQE 30 (Qiagen).
Purificazione del plasmide pQE 30 - Il plasmide pQE 30 (Qiagen) contenente l’inserto è stato inserito in cellule di Escherichia
coli rese competenti a 2500V con l’elettroporatore. I ricombinanti di E.coli sono stati selezionati in piastre di Luria-agar
contenenti ampicillina (100 µg/ml) e kanamicina (25 µg/ml). Una colonia ricombinante di E. coli, contenente il plasmide
provvisto del gene di M. agalactiae, è stata fatta crescere a 37°C per 18 ore in Luria Broth contenente 1 mM isopropil-β
-tio-galactoside (IPTG).
Purificazione della proteina ricombinante- Il plasmide pQE 30 permette di produrre proteine ricombinanti legate ad una coda
di sei istidine (His)6 in modo da facilitare il legame delle molecole ricombinanti e conseguentemente la loro purificazione
mediante l’uso di colonne di affinità. Pertanto la brodocoltura indotta con IPTG è stata centrifugata a 6,000 rpm per
10 min e il pellet denaturato con 8M Urea. Dopo un’ulteriore centrifugazione a 10,000 rpm per 15 min, la proteina
ricombinante, presente nel surnatante, è stata estratta con colonne di affinità all’acido nickel-nitrilotriacetico (Qiagen) ed
infine quantificata allo spettrofotometro a 750 nm.
Infezione sperimentale- Due pecore di razza sarda di circa cinque-sei anni di età, negative al M. agalactiae, sono state trasferite
nel paddock dell’Istituto di Anatomia Patologica e Patologia Generale della Facoltà di Medicina Veterinaria di Sassari. Il
paddock e le attrezzature ivi inserite rispondevano al DLgs 116 del 27 gennaio 97 riguardante “ Attuazione della direttiva
n° 86/609/CEE in materia di protezione degli animali utilizzati a fini sperimentali od altri fini scientifici”.
L’acclimatamento alla stabulazione fissa è durato circa due settimane. Durante l’acclimatamento e tutta la prova di
challenge, le pecore sono state alimentate con Unipellet della Martini Mangimi.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
175
Le due pecore negative sono state infettate con un pool di micoplasmi. Alla prima pecora controllo sono stati introdotti,
per via intracanalicolare in entrambe le mammelle, 103 CCU di micoplasmi. Mentre alla seconda pecora controllo sono
stati somministrati, sempre per via intracanalicolare, 107 CCU di micoplasmi.
A queste 2 pecore infettate sono stati effettuati, quotidianamente, i prelievi termometrici e di sangue per una durata di 35
giorni. L’andamento anticorpale è stato valutato mediante immunoblotting.
SDS-PAGE e immunoblotting- per l’elettroforesi delle proteine di micoplasmi sono stati utilizzati dei gel di acrilamide (8 o
12 %) contenenti lo 0.1% di SDS, secondo il metodo di Laemmli (1970).
Dopo elettroforesi le proteine dei micoplasmi sono state trasferite su membrane di nitrocellulosa mediante un apparecchio
Trans-Blot-semidry (Bio-Rad). Le membrane sono state saturate mediante incubazione per 2 ore a temperatura ambiente
in PBS-2% di skim milk e poi incubate per 1 ora con i sieri provenienti dalle pecore trattate e con un antisiero positivo
per M. agalactiae. Dopo diversi lavaggi in PBS-2% di skim milk, i blots sono stati incubati per 1ora a 37 °C con un siero
anti-pecora coniugato con fosfatasi. Dopo vari lavaggi, i blots sono stati sviluppati con NBT/BCIP. La reazione è stata
bloccata infine con acqua
ELISA con la proteina ricombinate- Piastre da 96 pozzetti di polistirene sono state sensibilizzate con 960 µg di proteina
ricombinante in carbonato/bicarbonato pH 9.6 a 4°C per 18 ore. Dopo 5 lavaggi con un buffer salino (PBS, 0.1 M
phosphate, 0.33 M NaCl, pH 7.4) contenente 0.1% Tween 20, le piastre sono stati incubate per 1 ora a 37°C con i vari
sieri provenienti dall’infezione sperimentale e con un siero proveniente da una pecora malata naturalmente di agalassia
contagiosa. Dopo ulteriori lavaggi con PBS e Tween 20, le piastre sono state incubate con un anticorpo anti-IgG di pecora
coniugato con perossidasi. Dopo vari lavaggi, le piastre sono state sviluppate con o-pheniylenediamine/H2O2. La reazione
è stata bloccata infine con 2N H2SO4.
Risultati e discussione
In un lavoro precedente si è visto che le proteine immunogeniche del M. agalactiae sono lipoproteine e hanno un peso
molecolare compreso tra 80 e 30 kDa (Tola et al., 1997). In particolare della proteina p80 è conosciuta sia la sequenza
nucleotidica che aminoacidica.
Nella prima parte di questo lavoro abbiamo, pertanto, amplificato una porzione da 1000 bp del gene ma-mp 81. Tale
frammento è stato clonato in un vettore di espressione per la produzione di una proteina ricombinante provvisto di un tag
di sei istidine (Figura 1, pannello A e B).
Nella seconda parte del lavoro, abbiamo purificato la proteina ricombinante a partire dal ceppo di E. coli contenente
il gene della proteina p80. Dopo aver fatto crescere i coli a 18 ore a 37 °C in 250 ml di terreno contenente IPTG, la
proteina è stata purificata ed eluita dalle colonne di affinità della Qiagen. La concentrazione della proteina ricombinante
è stata stimata in 1.5 mg/ml.
Tale proteina è stata utilizzata per sensibilizzare delle piastre di polistirene. L’analisi mediante ELISA dei sieri provenienti
dalle pecore infettate naturalmente ha dato dei risultati comparabili con l’immunoblotting con il vantaggio che il
test ELISA rispetto all’immunoblotting è meno costoso. Ulteriori analisi dovranno essere condotte utilizzando i sieri
provenienti da pecore malate naturalmente di agalassia contagiosa.
A
B
Figura 1.
Pannello A-Corsa elettroforetica su gel di SDS-PAGE delle proteine totali di E.coli contenente il plasmide
con l’inserto di M. agalactiae. Linea O, coli non indotto; linea 1, coli dopo 30 min d’induzione con IPTG; linea 2,
coli dopo 60 min d’induzione con IPTG; linea 3, coli dopo 90 min d’induzione con IPTG. Il marker caleidoscopico
è indicato con M.
Pannello B-Immunoblotting dei ceppi di E.coli con i sieri anti sei istidine. Da sinistra
verso destra: M-marker caleidoscopico, O-ceppo di E.coli provvisto del gene p80 non idotto
con IPTG, 1-2-3-E.coli dopo 30, 60, 90 min di induzione con IPTG.
176
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
BIBLIOGRAFIA- Ausubel F. et al., (1993) Current protocols in molecular biology. Wiley Interscience – Laemmli, UK.
(1970) Nature 227: 680-685.- Leori et al., (1998) Mycoplasmas of ruminants:pathogenicity, diagnostics, epidemiology
and molecular genetics. EUR 18018/COST, pp 98-101.- Sambrook J. et al. (1989) Cold Spring Harbor Lab.,N.Y.- Tola S.
et al., (1997) FEMS Microbiol. Letters 154: 355-362. - Tola et al., (2001) FEMS Microbiol. Letters 202: 45-50.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
177
VACCINAZIONE CONTRO IL MYCOPLASMA AGALACTIAE
MEDIANTE UN VACCINO A DNA
Rocca S*., Fusco M., Idini G., Foddai A., Rosa N., Ibba B., Zinellu S., Chessa G., e Tola S.
Istituto Zooprofilatto Sperimentale della Sardegna “G. Pegreffi”, 07100 Sassari.
*Tel:079-216914, Fax:079-219477, e-mail: [email protected]
Riassunto
Per questo lavoro si è preparato il seguente costrutto: nel plasmide pCMV-Script della Stratagene, contenente un’origine
di replicazione ColE1 e la resistenza alla neomicina, si è inserito in “open reading frame” il gene p80 del Mycoplasma
agalactiae.
Un gruppo di 6 pecore adulte di razza sarda, sprovviste di anticorpi anti-M.agalactiae, è stato sottoposto a vaccinazione per
via intramuscolo con 100 µg di plasmide. Il primo richiamo è stato effettuato a distanza di un mese sempre con 100 µg di
plasmide mentre il secondo richiamo a distanza di un altro mese. L’andamento anticorpale è stato monitorato mediante
immunoblotting.
Introduzione
L’agalassia contagiosa (A.C.) è una delle malattie più serie tra quelle che colpiscono i piccoli ruminanti, considerata
endemica nella maggior parte dei paesi mediterranei. Il principale agente eziologico è il Mycoplasma agalactiae.
L’ A.C. ha fatto la sua comparsa in Sardegna nel 1980 nella provincia di Cagliari, presumibilmente in seguito all’Introduzione
di ovini portatori-eliminatori provenienti dalla Sicilia (Leori, 1985). L’elevato numero di ovini e caprini presenti nell’isola,
circa 1/3 del patrimonio nazionale, alcune condizioni strutturali dell’allevamento brado (pascolo in comune, scambio
incontrollato di animali) e un’insufficiente adozione di misure di polizia veterinaria hanno determinato una diffusione
pressochè incontrollata dell’infezione, con un danno economico stimato intorno ai 10 miliardi annui.
Nei primi anni la malattia si è manifestata con una sintomatologia iperacuta e acuta (agalassia, mastite, cheratite, artrite)
mentre negli ultimi anni si è osservata una progressiva attenuazione, e in alcuni casi la scomparsa, di sintomi come la
cheratite e l’artrite a significare che la malattia, anche in Sardegna, va assumendo i caratteri della forma enzootica.
Il controllo e l’eventuale eradicazione di questa malattia potrebbe essere fatto, oltre che migliorando le condizioni igienicosanitarie degli allevamenti, applicando test diagnostici rapidi e sensibili, terapie antimicrobiche mirate ed efficaci e
producendo presidi immunizzanti in grado di bloccare la diffusione dell’A.C.
Nello specifico, la conoscenza dei principali antigeni del M. agalactiae permetterebbe di realizzare dei test diagnostici
sierologici e di sviluppare nuovi tipi di vaccini basati su definiti antigeni protettivi.
Molte proteine immunogeniche del M. agalactiae sono state identificate e caratterizzate (Rosati et al., 1999; Tola et al.,
2001). In particolare la lipoproteina p80 è non solo immunogenica ma risulta essere presente in tutti i ceppi di M.
agalactiae a partire dai primi stadi d’infezione (Tola et al., 1997).
Con il presente studio ci siamo prefissi di allestire un vaccino a DNA inserendo nel plasmide una porzione del
gene ma-mp 81 e di somministrarlo ad un campione di pecore per analizzarne la produzione anticorpale.
Materiali e metodi
Ceppi utilizzati e condizioni di crescita. In questo lavoro è stato utilizzato il ceppo di referenza PG2 (Bga) del M. agalactiae. I
micoplasmi sono stati messi a crescere in terreno di Hayflick modificato fino alla fase logaritmica di crescita e successivamente
sottoposti a centrifugazione e lavaggio con un buffer salino (PBS, 0.1 M phosphate, 0.33 M NaCl, pH 7.4). Il pellet è stato
utilizzato per l’estrazione del DNA.
Estrazione del DNA dal ceppo di referenza. Il DNA è stato estratto dal ceppo di referenza PG2 utilizzando le metodiche
descritte da Ausubel et al. (1992); mentre la concentrazione del DNA è stata determinata mediante lettura spettrofotometrica
(Sambrook et al., 1989).
PCR del gene ma-mp81. Due primers, contrassegnati con HindIII-F e EcoRI-R, sono stati disegnati a partire dalla sequenza
del gene p80 del M. agalactiae riportata in banca-dati sotto il numero di accesso X95628. Un μl di DNA totale è stato
utilizzato in 25 μl di una reazione standard di PCR costituita da: 2.5 μl di buffer 10X (Roche), 2.5 μl di 50 mM MgCl2,
1 μl di primer reverse e forward alla concentrazione di 25 pmole/μl, 0.5 μl di 1.25 mM dNTP, 0.2 μl di 5 U/μl Taq
polymerase (Roche) e 12.3 μl di H2O. Le reazioni di PCR sono state effettuate in un Thermal cycler 9700 della Applied
Biosystems utilizzando i seguenti parametri: denaturazione iniziale a 95 °C per 5 min., 30 cicli di 1 min di denaturazione
a 95 °C, 1 min di annealing a 52 °C e 1 min. di estensione a 72°C. Gli ampliconi sono stati fatti correre a 100 V in un gel
di agarosio all’1% e visualizzati sotto i raggi ultravioletti in seguito ad una colorazione con bromuro di etidio. La banda
è stata inoltre tagliata dal gel e purificata con il kit Concert Gel della Life Technologies. L’amplicone concentrato è stato
tagliato con gli enzimi di restrizione in modo da renderlo compatibile ed in Open Reading Frame (ORF) con il plasmide
pCMV-Script.
Purificazione del plasmide pCMV-Script.- Il plasmide pCMV-Script (Stratagene) contenente l’inserto è stato inserito in
cellule di Escherichia coli rese competenti a 2500V con l’elettroporatore. Una colonia ricombinante di E.coli, contenente
il plasmide provvisto del gene di M. agalactiae, è stata fatta crescere a 37°C per 18 ore in Luria Broth. Successivamente il
plasmide è stato estratto e purificato con il Kit Endo-free (Qjagen). La determinazione della quantità di plasmide estratto
è stata valutata allo spettrofotometro alla lunghezza d’onda di 260 nm.
Animali da esperimento- Per questo lavoro sono state utilizzate 6 pecore di razza sarda di circa cinque-sei anni di età. Prima
di iniziare il protocollo vaccinale, tutte le pecore sono state sottoposte a visita clinica preliminare per escludere patologie in
178
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
atto o pregresse, soprattutto quelle a carico dell’apparato mammario.
Per escludere qualsiasi contatto con micoplasmi, abbiamo analizzato campioni di latte, provenienti dalle mammelle destra
e sinistra di ciascuna pecora, e campioni di siero. I campioni di latte sono stati analizzati mediante PCR mentre i sieri
mediante immunoblotting.
Protocollo vaccinale- Il protocollo vaccinale è stato articolato in modo da prevedere: una prima vaccinazione e un richiamo
ad un mese dalla prima vaccinazione. In ogni fase abbiamo somministrato alle pecore per via intramuscolo, 100 µg di
plasmide ricombinante. A partire dalla prima vaccinazione, abbiamo prelevato dei campioni di sangue alle pecore trattate.
L’analisi anticorpale è stata fatta mediante immunoblotting.
SDS-PAGE e immunoblotting: per l’elettroforesi delle proteine di micoplasmi sono stati utilizzati dei gel di acrilamide (8 o
12 %) contenenti lo 0.1% di SDS, secondo il metodo di Laemmli (1970).
Dopo elettroforesi le proteine dei micoplasmi sono state trasferite su membrane di nitrocellulosa mediante un apparecchio
Trans-Blot-semidry (Bio-Rad). Le membrane sono state saturate mediante incubazione per 2 ore a temperatura ambiente
in PBS-2% di skim milk e poi incubate per 1 ora con i sieri provenienti dalle pecore trattate e con un antisiero positivo
per M. agalactiae. Dopo diversi lavaggi in PBS-2% di skim milk, i blots sono stati incubati per 1ora a 37 °C con un siero
anti-pecora coniugato con fosfatasi. Dopo vari lavaggi, i blots sono stati sviluppati con NBT/BCIP. La reazione è stata
bloccata infine con acqua.
Risultati E Conclusioni
Un frammento di 1000 bp del gene ma-mp 81 del M. agalactiae è stato inserito “ in frame” nel plasmide pMCV-Script
della Stratagene. Il frammento clonato è stato amplificato in modo tale che presentasse il codone iniziale ATG e il codone
Stop TAG. La selezione dei ricombinati è stata possibile grazie alla presenza nel plasmide dell’antibiotico resistenza alla
kanamicina. Il plasmide è stato costruito in modo da permettere un’alta espressione proteica a livello delle cellule eucaristiche.
Nei mammiferi l’espressione dei frammenti clonati è sotto il controllo di un promoter derivato da citomegalovirus (CMV).
Il plasmide contiene anche il gene per la resistenza alla neomicina che viene espressa a livello delle cellule eucariotiche sotto
la guida del promoter SV40.
1
2
Figura 1-Immunoblotting delle proteine di M. agalactiae con il siero di
una pecora prima della vaccinazione (linea 1) e dopo le due vaccinazioni
(linea 2).
La somministrazione intramuscolo del vaccino a DNA ad un gruppo di pecore è stata monitorata mediante immunoblotting.
Dopo due somministrazioni le pecore presentavano una notevole produzione di anticorpi nei confronti della proteina di
M. agalactiae codificata dal gene inserito nel plasmide (Figura 1, linea 2). Ulteriori studi sono necessari per valutare l’azione
protettiva degli anticorpi prodotti dal vaccino a DNA.
Bibliografia-
Ausubel F. et al., (1993) Current protocols in molecular biology. Wiley Interscience – Laemmli, UK. (1970) Nature 227: 680-685.Leori et al., (1998) Mycoplasmas of ruminants:pathogenicity, diagnostics, epidemiology and molecular genetics. EUR 18018/COST, pp
98-101.- Rosati et al., (1999) Infect. Immun. 67: 6213-6216.- Sambrook J. et al. (1989) Cold Spring Harbor Lab.,N.Y.- Tola S. et al.,
(1997) FEMS Microbiol. Letters 154: 355-362. - Tola et al., (2001) FEMS Microbiol. Letters 202: 45-50.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
179
IDENTIFICAZIONE DEL MYCOPLASMA AGALATIAE DAL MYCOPLASMA BOVIS MEDIANTE
POLYMERASE CHAIN REACTION (PCR)
Foddai A., Chessa G., Idini G., Fusco M., Rosa N., Ibba B., Zinellu S., Rocca S., e Tola S*.
* Istituto Zooprofilattico Sperimentale Della Sardegna “G. Pegreffi”, 07100 Sassari
Riassunto
Nell’ambito dei micoplasmi animali, il Mycoplasma agalactiae e il Mycoplasma bovis hanno un ruolo determinante
rispettivamente in molte malattie ovine e caprine. Queste 2 specie sono filogeneticamente correlate tra di loro. L’analisi
comparata della sequenza del 16S rRNA ha infatti mostrato un’identità tra le due specie pari a 99.47%. In questo lavoro,
partendo dal gene ma-mp81 del M. agalactiae, si è disegnato una coppia di primers in grado di amplificare un frammento
di 1000 bp interno al gene ma-mp81. Tale amplicone è stato marcato con fluoresceina per essere utilizzato come sonda in
un Southern Blotting di DNA totale di M. bovis digerito con HindIII. Il frammento di DNA del M. bovis, riconosciuto
dalla sonda, è stato isolato,clonato e sequenziato. Dall’analisi comparata delle due sequenze, è stata disegnata una coppia di
primers specifica per il M. bovis e un’altra che amplifica entrambe le specie.
Introduzione
I mollicutes sono microrganismi privi di parete cellulare con dimensioni tali da ritenerli i più piccoli tra i batteri conosciuti.
La classe Mollicutes è suddivisa in 8 generi, tra cui anche il genere Mycoplasma che comprende più di 120 specie. Alcune di
queste specie sono patogene per l’uomo mentre altre per animali e piante (Maniloff et al., 1992). Nell’ambito delle specie
patogene per gli animali, il Mycoplasma agalactiae e il Mycoplasma bovis hanno un ruolo determinante rispettivamente in
molte malattie ovine e bovine. Il Mycoplasma agalactiae è l’agente responsabile dell’agalassia contagiosa degli ovini e dei
caprini caratterizzata da mastite, poliartrite e cheratocongiuntivite (DaMassa, 1983). Il Mycoplasma bovis può determinare
mastite, artrite, polmonite e ipofertilità nei bovini (Boughton,1979).
Queste due specie sono strettamente correlate fra loro, tant’è che fino al 1976 il M. bovis veniva classificato come M.
agalactiae subsp. bovis in quanto presenta le stesse caratteristiche biologiche e biochimiche del M. agalactiae (Askaa and
Erno,1976). La stretta correlazione tra le due specie è confermata anche dagli studi sul 16S RNA che hanno evidenziato
una similitudine del 99.47% tra i due patogeni ( Mattsson e al. 1994).
Data tale altissima similarità, risulta difficile approntare una PCR diagnostica in grado di differenziare le due specie.
Subramaniam et al. (1998) utilizzando il gene uvrC non sono riusciti ad evidenziare le minime variazioni intraspecifiche.
Nel 2001, Tola et al. hanno identificato nel M. agalactiae un gene codificante per una lipoproteina di membrana. A partire
da questo gene, gli autori di questo lavoro hanno sequenziato il gene omologo nel M. bovis. Dalle sequenze sono stati tratti
dei primers in grado di differenziare il M. agalactiae dal M. bovis mediante PCR e Restriction fragment lenght polymorphism
(RFLP)-PCR.
Materiali e metodi
Ceppi utilizzati e condizioni di crescita. In questo lavoro sono stati utilizzati 15 ceppi di M. agalactiae isolati da altrettanti
campioni di latte provenienti da focolai di agalassia contagiosa, il ceppo di referenza PG2 (Bga), 13 ceppi di M. bovis e
il ceppo di referenza PG45. I ceppi di M. agalactiae sono stati clonati (Tully 1983) e identificati mediante PCR (Tola
et al., 1996). I micoplasmi sono stati messi a crescere in terreno di Hayflick modificato fino alla fase logaritmica di
crescita e successivamente sottoposti a centrifugazione e lavaggio con un buffer salino (PBS, 0.1 M phosphate, 0.33 M
NaCl, pH 7.4). Il pellet è stato utilizzato per l’estrazione del DNA
Estrazione del DNA e ibridazione. Il DNA è
stato estratto dai ceppi di referenza PG2 e PG45 e da tutti i ceppi da campo. I pellets contenenti i vari ceppi sono stati
risospesi in TE buffer (10 mM Tris-HCl, 1 mM EDTA; pH 8.0) addizionato con SDS e proteinase K. Dopo 2 ore di
incubazione a 50 °C, il DNA è stato estratto mediante due passaggi in fenolo-cloroformio e una precipitazione in etanolo,
secondo la metodica descritta da Ausubel et al. (1992). La concentrazione del DNA è stata determinata mediante lettura
spettrofotometrica (Sambrook et al., 1989). Il DNA dei ceppi di M. bovis è stato digerito con HindIII e fatto correre a 15 V
per 18 ore in un gel di agarosio alla concentrazione di 0.6%. Successivamente il DNA digerito è stato trasferito secondo il
metodo di Southern (1972) su una membrana di nylon (Qiabrane, Qiagen) e ibridizzato con l’amplicone derivato dal gene
ma-mp 81 marcato con fluoresceina. Le bande positive sono state, infine, tagliate dal gel e purificate con il kit Concert Gel
della Life Technologies.
Inserimento delle bande positive in plasmide. Le bande di DNA positive all’ibridazione sono state inserite all’interno del
plasmide pZero (Invitrogen) predigerito con lo stesso enzima dei frammenti positivi. I trasformanti sono stati ottenuti
dopo aver seminato le cellule TOP10/plasmide/inserto in piastre di Luria Broth Agar contenenti tetraciclina (50 μg/ml),
zeocina (15 μg/ml) e isopropil-β -tio-galactoside (IPTG).
Sequenze del DNA. I frammenti clonati in pZero sono stati sequenziati mediante l’utilizzo dell’apparecchio semiautomatico
ALF-express dell’ Amhersham.
Analisi delle sequenze. Le sequenze nucleotidiche dei frammenti clonati sono stati analizzati utilizzando differenti programmi
on-line. In particolare, sono stati consultati BLAST e ORF-FINDER.
Primers e PCR - I primers utilizzati in questo lavoro sono stati tratti dalla sequenza del gene ma-mp 81(GenBank, numero
180
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
di accesso:AF299294 e dal gene omologo del M. bovis. Un μl di ciascun campione di DNA è stato utilizzato in 25 μl di una
reazione standard di PCR costituita da: 2.5 μl di buffer 10X (Roche), 2.5 μl di 50 mM MgCl2, 1 μl di reverse e forward
primer per ciascun gene alla concentrazione di 25 pmole/μl, 0.5 μl di 1.25 mM dNTP, 0.2 μl di 5 U/μl Taq polymerase
(Roche) e 12.3 μl di H2O.
Le reazioni di PCR sono state effettuate in un Thermal cycler 9700 della Applied Biosystems utilizzando i seguenti
parametri: denaturazione iniziale a 95 °C per 5 min., 30 cicli di 1 min di denaturazione a 95 °C, 1 min di annealing a 52
°C e 1 min. di estensione a 72°C. Gli ampliconi sono stati fatti correre a 100 V in un gel di agarosio all’1% e visualizzati
sotto i raggi ultravioletti in seguito ad una colorazione con bromuro di etidio.
Restriction fragment lenght polymorphism (RFLP). Gli ampliconi ottenuti con i primers specifici per M. agalactiae e M.
bovis sono stati digeriti con gli enzimi di restrizione Sau3A, BglI e ClaI (Roche) per 12 ore e alla temperatura indicata dal
produttore. I polimorfismi di restrizione sono stati analizzati in un gel di agarosio al 3 % in TAE 1X.
RISULTATI E DISCUSSIONE
Sequenza del frammento del M. bovis. Il frammento di 2900 bp derivato dalla digestione HindIII del M. bovis è stato sequenziato.
La sequenza confrontata in banca-dati presenta un’omologia del 63.9% con il gene ma- mp81 del M.agalatiae.
PCR differenziale. Dall’ analisi comparata delle due sequenze, è stato possibile individuare i primers BT ed F1 che amplificano
un frammento di circa 537 bp specifico per il M. bovis e assente nel M. agalactiae. Con tali primers è stata allestita una
PCR in grado di amplificare solo il DNA del M. bovis (Foto 1, linea 2). Dalla sequenza del M. agalactiae sono stati tratti i
primers A1 e BX che amplificano una porzione di
M1 2 3 4 5 6 7
Figura 1- Corsa elettroforetica su gel di agarosio all’1.5% dei prodotti di PCR ottenuti utilizzando i primers BTF1
e BTR1 con M. bovis (linea 1), i primers A1 e BX con M. agalactiae, (linea 2), i primers XB e BX con M. agalactiae
(linea 3), i primers A1-BX e BTF1-BTR! con M. agalactiae e M. bovis (linea 4), e i primers XB-BX e BTF1-BTR1
con M. agalactiae e M. bovis (linea 5). La linee 6 e 7 rappresentano i controlli negativi, mentre M è il marker VII
della Roche.
L’uso contemporaneo dei primers A1-BX del frammento ma-mp81 e BT-F1 e BT-R1 in una multiplex PCR ha
permesso di differenziare i due microrganismi anche su campione ibrido contenente il DNA di entrambi (Figura 1, linee 4
e 5).
Bibliografia
Askaa et al., (1976) Int. J. Syst. Bacteriol. 26: 323-325 - Ausubel F. et al., (1993) Current protocols in molecular biology.
Wiley Interscience .- Boughton, E. (1979) Vet. Bull. 49: - DaMassa (1983) J.Am. Vet. Med. Assoc. 183: 548-554Maniloff, J. et al.,(1992) Mycoplasmas : molecular biology and pathogenesis. ASM Press, Washington D.C.- Sambrook J.
et al. (1989) Cold Spring Harbor Lab.,N.Y.- Tola S. et al., (1996) Vet. Microbiol. 51: 77-84. - Tola et al., (2001) FEMS
Microbiol. Letters 202: 45-50.- Tully, J. G., (1983), Methods of Mycoplasmology 1, 173-177.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
181
ANALISI PREDITTIVA PER L’IDENTIFICAZIONE DI ALLEVAMENTI CON SOGGETTI
PERSISTENTEMENTE INFETTI DA VIRUS DELLA DIARREA VIRALE BOVINA (BVDV)
Ciulli S., Ostanello F., Galletti E., Battilani M., Scagliarini A., Cazzoli M.,* Zocca A.*, Prosperi S.
Dipartimento di Sanità Pubblica Veterinaria e Patologia Animale
Università degli Studi di Bologna, Bologna.
*Libero professionista.
Summary
Bovine Viral Diarrhoea (BVD) is a cosmopolitan disease with a great economic impact in the world. The spreading of
the infection is related to the presence of persistent infectious animal (PI) in the herd. This study has the aim to test the
application of the sampling method proposed by Houe et al., (1995) in the Emilia-Romagna region, Italy. This method
allows to detect the herds with PI animal testing for BVDV-Ab a little number of animal of 6-18 months. The data
from the serological survey of 8 farms were used to calculate the probability to find at least 2 (Pmin2) or at least 3 (Pmin3)
seropositive animals out of 5 sampled animals in the group of the animals between 6 months and the first birth. The Pmin2
and Pmin3 values were related to the presence of PI animal in the herd. These results show that is possible to test for BVDVAb a little number of animals to know the presence/absence of PI animal in the herd. This sampling method, easy and
cheap, could be used to set up a control programme in a region with high BVDV prevalence.
ANALISI PREDITTIVA PER L’IDENTIFICAZIONE DI ALLEVAMENTI CON SOGGETTI
PERSISTENTEMENTE INFETTI DA VIRUS DELLA DIARREA VIRALE BOVINA (BVDV)
Riassunto
La diarrea virale bovina (BVD) è una patologia cosmopolita che riveste una grande importanza dal punto di vista economico.
La trasmissione dell’infezione è legata soprattutto alla presenza in allevamento di animali persistentemente infetti (PI). Il
presente lavoro ha lo scopo di valutare l’applicabilità del metodo di campionamento proposto da Houe et al., (1995)
nella realtà produttiva della Regione Emilia-Romagna. Questo metodo permetterebbe di individuare le stalle con bovini
PI testando un piccolo numero di animali della classe di età 6-18 mesi. I dati ottenuti da un’indagine sierologica svolta
su 8 allevamenti sono stati utilizzati per calcolare la probabilità di trovare almeno 2 (Pmin2) o almeno 3 (Pmin3) soggetti
sieropositivi su un campione di 5 animali di età compresa tra i 6 mesi e il primo parto. I valori di Pmin2 e Pmin3 sono stati
messi in relazione alla presenza di soggetti PI nell’allevamento. I risultati dello studio dimostrano che è possibile utilizzare
un piccolo campione di animali per la ricerca degli anticorpi anti-BVDV per valutare la presenza/assenza di soggetti PI in
azienda. Tale metodo di campionamento, agevole e economico, potrebbe essere sfruttato per intraprendere un’eventuale
piano di controllo da applicare in una regione ad elevata prevalenza di BVDV.
INTRODUCTION
Bovine Viral Diarrhoea (BVD) is widespread throughout different areas of the world. BVDV infection was found
everywhere the bovine are farmed and it is responsible for huge economic losses (Houe, 1999). In Italy the pathology was
described since 1960 (Poggi and Carboni, 1960) and it is now widespread in dairy farms and in beef farms (Cavirani et
al., 1999; Luzzago et al., 1999). Some European country began programs for the control or for the eradication of BVDV
to reduce the economic losses and increase the animal trade (Lindberg and Alenius, 1999).
Persistent infected (PI) animals are responsible of the widespread of the virus in the farm and among different farms when
some animals are moved from a herd to another. Detection and removal of PI animal is therefore fundamental to control
the pathology (Houe, 1999).
Houe (1992) proposed a sampling methods to detect farm with PI animals analysing 3 to 5 bovine in each farm. This
method represent the first fundamental step for the identification of farms with PI animals without testing all the farm,
saving time and money.
Later other Authors evaluate the adaptability of this method to their countries (Roxanne and Grooms 2002; Zimmer et
al., 2002).
The aim of this study was to evaluate the application of the Houe et al., (1995) sampling method in Emilia-Romagna region,
north Italy. We analysed 7 dairy farms and 1 milk and beef farm with reproductive problems. Serological investigation was
conduct in each farms. BVDV PI animals were detect with RT-PCR. Seroprevalence data were used for the calculation of
probability of obtaining at least two (Pmin2) or three (Pmin3 ) BVDV-antibody positive cattle out of a sample of 3 to 5 animals
6 to 24 months old. Pmin2 and Pmin3 were calculated by use of a hypergeometric probability function.
Materials and methods
− Collection of blood and analysis of samples
We analysed 7 dairy farms and 1 milk and beef farm from Bologna and Modena provinces, Emilia-Romagna region,
north Italy. Herd consistency varied from 31 to 160 animals. No BVDV vaccination was used in any of the tested farms.
Reproductive problems like aborts, low first-service conception rate and repeat breeding were signalised in each herds by
farm veterinarians.
Sera were drawn from 6 to 24 months old heifers to evaluate the BVDV antibody presence. Six to 24 months class was
chosen to avoid maternal passive antibody or pre existing immunity. Some Authors emphasise this class as the most
182
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
representative of actual infection status of the herd (Houe, 1992). Antibody negative animals were then drawn to collect
blood samples for virological test to identify PI animals. Positive animals were tested again a month later to confirm
persistent infection. Blood samples from <6 months old cattle were collected in farms 1b, 2, 4, 5, 6, 8 for virological
analysis.
Serological analysis was conduct with a commercial test (Calfcheck BVD, Agrolabo, Italy). Infection status was established
with two tests: a commercial ELISA test (Pestivirus Antigen Detection kit, Moredun, UK) and a RT-PCR as described by
Vilcek et al., 1994.
− Pmin2 and Pmin3 calculations
Antibody positive and antibody negative animals were calculated in each farms. The probability of obtaining at least two
(Pmin2 ) or at least 3 (Pmin3 ) antibody positive animals out of a sample of n animals was calculated (Houe et al. 1995). In
accordance with Houe et al. (1995) sample consistency was 5 animals.
For the calculation we use the following formula
Pmin2 = 1 - P0 - P1
Pmin3 = 1 - P0 - P1 – P2
At last, Pmin2 and Pmin3 values were correlated to the presence of PI animals in the farms.
Results
Serological results are shown in table 1 and Pmin2 and Pmin3 values are shown in table 2. In figure 1, Pmin2 value was express
in function of the presence/absence of PI animals in the farms.
Table 1. Serological analysis results.
No. of
Herd no. Herd production animals in
herd
A
B
C
D
E
F
G
H
milk
milk
milk
milk
milk and beef
milk
milk
milk
160
160
120
160
160
31
110
150
No. of animals aged 6 to 24 months
No. of tested
animals
No. antibodypositive
No. antibodynegative
29
38
50
54
48
9
49
57
26
3
41
1
41
8
7
51
3
35
9
53
7
1
42
6
Table 2. Pmin2 and Pmin3 values.
Herd no.
Pmin2
Pmin3
A
B
C
D
E
F
G
H
1.000
0.040
0.998
0.000
0.999
1.000
0.143
1.000
1.000
0.001
0.965
0.000
0.982
1.000
0.017
0.994
No. of PI animals in
the herd
3
0
8
0
1
0
0
0
In farms with PI animals Pmin2 value were 0.998 to 1 and Pmin3 were 0.965 to 1. In farms without PI animals, but farms
F and H, Pmin2 value were 0.000 to 0.143 and Pmin3 were 0.000 to 0.017. In farms F and H where Pmin2 value was 1 and
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
183
Pmin3 values varied between 0.994 and 1. In farm F we didn’t found any PI animals at the sampling time, but a veal sold
to farm E resulted to be persistent infected. The high values of Pmin2 and Pmin3 in farm F was due to this animal, in fact, it
was responsible for the infection in farms E and F. In farm H we didn’t found any PI animal, this result could be due to
the quickly removal of male cattle from the farms; these subjects are normally moved within 6 days from the birth and we
couldn’t test them.
Figure 1. Pmin2 value are express in function of the presence/absence of PI animals in the farms.
1.0
0.9
0.8
0.7
0.6
Pm
in 2
0.998
0.5
0.999
1.000
1.000
1.000
E
H
F
A
0.4
0.3
0.2
0.1
0.0
0.000
D
0.040
B
0.143
G
C
H er d no .
Discussion and conclusions
In this work we apply the hypergeometric probability function (Houe et al., 1995) to calculate the probability of obtaining
at least two (Pmin2 ) or at least 3 (Pmin3 ) antibody positive animals out of a sample of 5 animals in farm with and without
BVDV PI animals.
With this sampling method we can easily and cheaply detect farm with PI animals and subsequently identify PI animals
without testing all the farms. For this reason this method provides an incentive for the application of control programs in
regions with high BVD prevalence.
Different Authors evaluate the adaptability of this method to their countries (Roxanne and Grooms 2002; Zimmer et al.,
2002); so we did it for Emilia-Romagna region, north Italy.
We found a good correlation between Pmin2 and Pmin3 values and the presence/absence of PI animals in the herd.
Some Authors reported that farms with PI animals could have low Pmin2 values when PI animals are younger that two
months or when they are separate from heifers (Houe, 1992); but in our study we have not the chance to confirm this
hypothesis.
In some cases the early removal of the young male cattle, as it happens in dairy farm, could interfere with the finding of PI
animal in herd with high Pmin2 as we suspect in farm H. Despite these disadvantages the application of this method could
be suitable to set up control programs in areas with high BVDV prevalence where the cost of this programs are very high.
This method could decrease the cost of the programs providing an incentive for the eradication of BVD-MD.
Refereces
CAVIRANI S., ALLEGRI G., DONOFRIO G., CABASSI C. S., CECCATO C., BALLOTTIN M., GALVANI G. AND TADDEI S.
(1999). Anticorpi Verso Bovine Viral Diarrhea Virus in Bovini da Carne Allevati in Nord Italia. Atti Soc. Ital. Buiatria, 31, 303-309.
HOUE H. (1992). Serological analysis of a small herd sample to predict presence or absence of animals persistently infected with bovine
viral diarrhoea virus (BVDV) in dairy herds. Res. Vet. Sci., 53, 320-323.
HOUE H., BAKER J.C., MAES R.K., RUEGG P.L. AND LLOYD J.W. (1995). Application of antibody titers against bovine viral
diarrhea virus (BVDV) as a measure to detect herds with cattle persistently infected with BVDV. J. Vet. Diagn. Invest., 7, 327-332.
HOUE H. (1999). Epidemiological Features and Economical Importance of Bovine Virus Diarrhoea Virus (BVDV) Infections. Vet.
Microbiol., 64, 89-107.
LINDBERG A. AND ALENIUS S. (1999). Principles for eradication of bovine viral diarrhoea virus (BVDV) infections in cattle
populations. Vet. Microbiol., 64, 197-222.
LUZZAGO C., PICCININI R., ZEPPONI R. AND ZECCONI A. (1999). Study on prevalence of bovine viral diarrhoea virus
(BVDV) antibodies in 29 italian dairy herds with reproductive problems. Vet. Microbiol,. 64, 247-252.
POGGI A. AND CARBONI A. (1960). La diarrea da virus dei bovini della Pianura Padana. Sel. Vet., 1, 281-283.
ROXANNE B. AND GROOMS D. (2002). Serologic evaluation of five unvaccinated heifers to detect herds that have cattle persistently
infected with bovine viral diarrhea virus. Am. J. Vet. Res. 63, 499-505.
VILCEK S., HERRING A.J., NETTLETON P.F., LOWINGS J.P. AND PATON D.J. (1994). Pestivirus isolated from pigs, cattle and
sheep can be allocated into at least three genogrups using polimerase chain reaction and restriction endonuclease analysis. Arch.Virol.,
136 ,309-323.
ZIMMER G., SCHOUSTRA W. AND GRAAT E. A. M. (2002). Predictive values of serum and bulk milk sampling for the presence
of persistently infected BVDV carriers in dairy herds. Res. Vet. Sci., 72, 75-82.
184
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
TEST DI WESTERN BLOTTING PER DIFFERENZIARE
LE INFEZIONI DA BRUCELLA SPP. E YERSINIA ENTEROCOLITICA O:9 NEGLI OVINI
Corrente M. a, Desario C. a, Greco G.a, Madio A. a, Scaltrito D. b, Consenti B. b e Buonavoglia D. c
a
Dipartimento di Sanità e benessere animale, Facoltà di Medicina Veterinaria Università di Bari
b
Istituto Zooprofilattico Sperimentale della Puglia e Basilicata.
c
Dipartimento di Patologia e Malattie Infettive, Università di Messina,.
Riassunto
E’ stato messo a punto un test di Western Blotting (WB) per la diagnosi di brucellosi negli ovini, utilizzando come antigene
le proteine della membrana esterna (OMPs) del ceppo Rev 1 di Brucella melitensis. Sono stati saggiati 45 sieri di pecore con
differente reattività ai tests sierologici per Brucella spp., così raggruppati: A) n. 10 sieri positivi prelevati da pecore infette
da B. melitensis e 1 siero da una pecora vaccinata con Rev 1; B) n. 10 sieri negativi di animali provenienti da allevamenti
ufficialmente indenni; C) n. 12 sieri classificati dall’Istituto Zooprofilattico come “sospetti”; D) n. 12 sieri classificati come
“positivi” ma prelevati ad animali “single reactors”(SR). In aggiunta sono stati saggiati 9 sieri prelevati a intervalli di 1
settimana da una pecora sottoposta a infezione sperimentale con Yersinia enterocolitica O:9. Nel test WB è stata evidenziata
la reattività verso una proteina di 17kDa nei sieri del gruppo A (animali infetti) e solo in 3 sieri del gruppo D (SR). I
risultati ottenuti suggeriscono un possibile e utile impiego del WB come test di conferma per la diagnosi di brucellosi, nelle
situazioni epidemiologiche in cui è ipotizzabile una cross-reattività sierologica.
Abstract
Western Blotting assay was developed for the diagnosis of brucellosis in sheep, using Outer Membrane Proteins (OMPs)
of Rev-1 strain of Brucella melitensis as an antigen. The following sera were tested: A) n. 10 samples positive and collected
from sheep infected with Brucella melitensis and 1 sample from a sheep vaccinated with the Rev 1 strain; B) n. 10 samples
collected in “officially brucellosis-free” herds; C) n. 12 samples classified as “suspicious” by Istituto Zooprofilattico; D)
n. 12 samples classified as “positive” and collected from animals “Single reactors”(SR). We tested also 9 serum samples
collected weekly from one sheep that had been experimentally infected with Y. enterocolitica O:9. In the WB assay, a
17kDa protein was recognised by all sera of the group A (infected animals) and 3 sera of the group D (SR). The results
suggest WB as a confirmatory test for the diagnosis of brucellosis in the epidemiological conditions suggesting a serological
cross-reaction.
Introduzione
La brucellosi è una malattia caratteristica di diverse specie animali sia domestiche che selvatiche. Negli animali da reddito
causa notevoli danni economici, legati ad aborto e infertilità; inoltre la brucellosi può essere trasmessa all’uomo tramite
il consumo di latte non sottoposto a trattamenti termici, o formaggi freschi, soprattutto di origine ovina (MichauxCharachon e coll, 2002) . Per questi motivi, i Paesi membri dell’Unione Europea applicano da diversi anni piani di
profilassi che mirano all’eradicazione della brucellosi negli allevamenti. L’individuazione degli animali infetti è effettuata
mediante prove sierologiche, il test di sieroagglutinazione rapida (r-SAT) e la Fissazione del complemento (FdC). Questi
test, che rilevano la produzione di anticorpi verso il Lipopolisaccaride di membrana (LPS) di Brucella spp., hanno un’elevata
sensibilità (Nielsen, 2002). Alcuni batteri gram –, come Escherichia coli, Salmonella enterica subsp. enterica, e soprattutto
Yersinia enterocolitica O:9, condividono frazioni antigeniche a livello del LPS. Questo può determinare false positività
ai test suddetti, con gravi problemi soprattutto negli allevamenti ufficialmente indenni (a.u.i.) in quanto la presenza di
pochi animali positivi, chiamati Single Reactors (SR) provoca la perdita dello status sanitario di allevamento ufficialmente
indenne, con notevoli danni economici. Le attuali norme di Polizia veterinaria non prevedono la possibilità di chiarire la
natura della sieropositività dei SR (Godfroid e col, 2002). In letteratura sono riportati diversi studi sull’impiego di frazioni
antigeniche più specifiche come le Outer membran proteins (OMPs), da utilizzare in test sierologici, per discriminare le
infezioni da Brucella spp. e Yersinia enterocolitica O:9. (Weynants e coll, 1996) In questa nota è descritto un test di Western
Blotting basato sull’impiego di OMPs di un ceppo attenuato (Rev 1) di B. melitensis come antigene e la validazione di
questo test per la diagnosi di brucellosi negli ovini.
Materiali e metodi
Infezione sperimentale. Per ottenere un antisiero specifico, una pecora proveniente da un allevamento ufficialmente
indenne e sieronegativa per Brucella spp. è stata infettata sperimentalmente con un ceppo di Y. enterocolitica O:9, mediante
somministrazione per os per 5 giorni consecutivi di 4 ml di una sospensione di 1012 cellule/ml. Sono stati effettuati prelievi
di sangue a intervalli di 7 giorni, a partire dal giorno della prima somministrazione del bolo sino alla 8a settimana post
infezione (p.i.). Sono stati inoltre prelevati settimanalmente campioni di feci per l’esame batteriologico.
Sieri Oltre ai 9 campioni di siero prelevati dalla pecora sottoposta a infezione sperimentale (gruppo I), sono stati saggiati
altri 45 sieri, divisi nei seguenti gruppi: A) n. 10 sieri positivi prelevati da pecore infette da B. melitensis e 1 siero da una
pecora vaccinata con Rev 1; B) n. 10 sieri negativi di animali provenienti da allevamenti ufficialmente indenni; C) n.
12 sieri classificati dall’Istituto Zooprofilattico come “sospetti”, ovvero r-SAT + e FdC -; D) n. 12 sieri classificati come
“positivi”, ovvero r-SAT + e FdC +, ma prelevati ad animali “single reactors” (SR). Tutti i sieri sono stati testati con le
prove ufficiali r-SAT e FdC, secondo le direttive dell’Office International des Epizooties (OIE, 2000), e con il Western
Blotting.
Western Blotting. Il ceppo di Rev 1 è stato messo in coltura in Tryptose soy broth (TSB, Oxoid , Milano) per 3 giorni in
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
185
agitazione a 37°C. La brodocoltura è stata centrifugata a 4000 xg per 10 minuti. Il pellet è stato trattato con un tampone di
lisi (Potassio fosfato 50 mM, NaCl 400 mM, KCl 100mM, glicerolo 10%, Triton X-100 0.5%, imidazolo 10mM, ph 7.8)
sino a completa chiarificazione. I corpi cellulari non dissolti sono stati allontanati mediante centrifugazione a 5000 xg per 2
minuti; il surnatante è stato centrifugato a 10000 xg per 40 minuti e il pellet conservato in soluzione fisiologica a –80°C.
Per l’ SDS PAGE ( Laemmli, 1970), è stato utilizzato un gel secondo gradiente lineare 4-22%, ricostituendo l’antigene
in proporzione 1:4 in buffer di Laemmli (Tris HCl 5 mM, SDS 2.5%, 2-β- mercaptoetanolo 5%, glicerolo 15%, blu di
bromofenolo 0.05%, ph 6.8).
La separazione delle proteine è stata effettuata mediante un apparato verticale (BIORAD Laboratories S.r.l. USA) a 20
mA per 6 ore in Running Buffer (Tris 25 mM, glicina 192 mM, SDS 0,1% a ph 8,3).
Il gel è stato equilibrato in Transfer Buffer (Tris 25 mM, glicina 192 mM, pH 8.3, metanolo 20 %) per 1 h e quindi
sottoposto a trasferimento su di una membrana di Polyvinylidene difluoride (PVDF, diametro dei pori 0.45μm, Immobilon
P, Millipore Corporation, Bedford) a un voltaggio costante di 70 V per 6 h. La membrana è stata tagliata in strisce, che
sono state immerse in una soluzione di TBS-T ( Tris 25 mM, Na Cl 200 mM, ph 7,4, Tween 20 0,05%) con 5% di latte
scremato per una notte, allo scopo di saturare i siti aspecifici di reazione. Dopo tre lavaggi in TBS per 10 minuti, le strisce
sono state incubate con i sieri ovini diluiti 1:100 in TBS-T per 90 min. Sono stati effettuati ancora 3 lavaggi, quindi l’
incubazione con IgG di coniglio anti-pecora marcate con perossidasi (Sigma Chemicals, St.Louis, MO) diluite 1:5000 in
TBS-T, per 90 min. Dopo 3 lavaggi le strisce sono state trattate con una soluzione cromogena (3,3’-Diaminobenzidine
tetrahydrochloride [Sigma] in TBS-T, Perossido d’idrogeno 0.08%) sino a sviluppo della reazione, che è stata bloccata
con acqua distillata.
Risultati e discussione
Infezione sperimentale. La pecora non ha mostrato sintomi in seguito all’infezione sperimentale , nonostante l’esame
batteriologico abbia messo in evidenza l’escrezione fecale di Y. enterocolitica O:9 a partire dalla 1a sino alla 8a settimana
dopo l’infezione.
Test sierologici. La pecora sottoposta a infezione sperimentale è risultata positiva a r-SAT e FdC a partire dalla 2a settimana
p.i., mostrando un alto titolo anticorpale in Fdc dalla 4a settimana. Come è indicato nella tabella 1, i sieri del gruppo A
sono risultati positivi con alti titoli anticorpali, mentre i sieri del gruppo B sono risultati negativi. Per quanto riguarda i
sieri dei gruppi C e D, sono stati confermati i risultati dell’Istituto Zooprofilattico.
Immunoblotting. I campioni di sangue prelevati dalla pecora infetta con Y. enterocolitica O:9 hanno mostrato una reattività
verso bande di 28 e 23 kDa, a partire dalla 5a settimana p.i. Nei campioni di siero del gruppo A (infetti) sono stati
evidenziati anticorpi verso bande di 60 , 35, 28, 23 e soprattutto nei confronti di una proteina di 17 kDa. Il siero della
pecora vaccinata con il Rev 1 ha mostrato la stessa reazione. I sieri del gruppo B (negativi) non hanno mostrato reattività
nel test di WB. Nessuno dei sieri del gruppo C ha mostrato reattività verso la proteina di 17 kDa, mentre nel gruppo D,
solo 3 sieri (n. 43,47 e 52) hanno reagito con tale proteina.
L’infezione sperimentale con Y. enterocolitica O:9 ha evidenziato che nella pecora, come in altre specie animali, questo
microorganismo induce la produzione di anticorpi che cross-reagiscono con l’antigene impiegato nei test per la diagnosi
della brucellosi.
Il test WB ha evidenziato la reattività verso una proteina di 17 Kda solo nei sieri delle pecore infette da Brucella spp o
vaccinate con Rev 1. Dei sieri degli animali SR solo 3 hanno reagito con la proteina 17 kDa. Questo dato è estremamente
importante e sottolinea l’esigenza di mettere a punto nuovi test per valutare in maniera corretta il responso sierologico in
situazioni epidemiologiche in cui l’infezione da Brucella potrebbe essere poco probabile.
Bibliografia
Michaux-Charachon S, Foulongne V, O’Callaghan D, Ramuz M. Brucella à l’aube du troisième millénaire: organisation
du génome et pouvoir pathogène. Pathol Biol (2002); 50: 401-412. Nielsen K. Diagnosis of brucellosis by serology.Vet
Microbiol 2002; 90: 447-459. Godfroid J, Saegerman C, Wellemans V, Walravens K, Letesson J-J, Tibor A, Mc Millan
A, Spencer S, Sanna M, Bakker D, Pouillot R, Garin-Bastuji B. How to substantiate eradication of bovine brucellosis when
aspecific serological reactions occur in the course of brucellosis testing. Vet Microbiol 2002; 90: 461 – 477. Weynants V,
Tibor A, Denoel PA, Saegerman C, Godfroid J, Thiange P, Letesson J-J. Infection of cattle with Yersinia enterocolitica 0:9 a
cause of the false positive serological reactions in bovine brucellosis diagnostic tests. Vet Microbiol 1996; 48: 101-12. OIE
Manual of standards for diagnostic tests and vaccines. Caprine and ovine brucellosis. Paris 2000; 475-489. Laemmli UK.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227: 680-685.-
186
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Tabella 1: risultati del test di sieroagglutinazione rapida (r-SAT). Fissazione del Complemento (FDC) e Western Blotting
(WB) in sieri di pecora.
Sieri
I§
A
B
C
D
Campioni
1*
2
3
4
5
6
7
8
9
r-SAT
+
+
+
+
+
+
+
FdC
1:80^
1:80
1/160
1/160
1/160
1/160
WB’
-
10
11
12
13
14
15
16
17
18
19
20°
+
+
+
+
+
+
+
+
+
+
+
1:160
1: 320
1:160
1:160
1:80
1:80
1:320
1:320
1:80
1:160
1:640
+
+
+
+
+
+
+
+
+
+
+
21
22
23
24
25
26
27
28
29
30
-
-
-
31
32
33
34
35
36
37
38
39
40
41
42
+
+
+
+
+
+
+
+
+
+
+
+
-
-
43
44
45
46
47
48
49
50
51
52
53
54
+
+
+
+
+
+
+
+
+
+
+
+
1:20
1:40
1:20
1:20
1:40
1:80
1:40
1.20
1:20
1:40
1:80
1:20
+
+
+
-
’: reattività alla proteina di 17 kDa; §: prelievi da pecora sottoposta a infezione sperimentale ;
*tempo O (inizio dell’infezione sperimentale); ^: titolo anticorpale ( UI /ml); °: pecora vaccinata con Rev 1.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
187
DUE FOCOLAI DI FEBBRE CATARRALE MALIGNA IN BOVINI DEL SUD ITALIA
Decaro N., Tinelli A., Cirone F., Pratelli A., Tempesta M., Buonavoglia C.
Dipartimento di Sanità e Benessere Animale, Facoltà di Medicina Veterinaria di Bari
Autore comunicante:
Nicola Decaro
Dipartimento di Sanità e Benessere Animale, Facoltà di Medicina Veterinaria di Bari
S.p. per Casamassima km 3, 70010, Valenzano, Bari
Tel: 080 4679833
Fax: 080 4679843
E-mail: [email protected]
Riassunto
La febbre catarrale maligna (MCF), causata da ovine herpesvirus 2 (OvHV-2), è stata descritta in diversi paesi europei, mentre,
al momento, in Italia le segnalazioni sono sporadiche e mai supportate dalla identificazione dell’agente causale.
Nella nota vengono descritti due focolai di MCF in bovini presenti in due distinti allevamenti dell’Italia Meridionale. Gli
animali colpiti, una vacca di tre anni ed un vitello di sei mesi di età, hanno presentato i segni clinici caratteristici della
forma cefalo-oculo-nasale, osservata in corso di MCF: febbre, scialorrea, diarrea, opacamento corneale, scolo oculo-nasale
mucopurulento, ulcere sulla mucosa oronasale e necrosi della cute del musello. Nell’allevamento di provenienza della vacca
è stata accertata una stretta coabitazione con gli ovini, mentre nessun contatto con specie carrier è stato documentato per
l’episodio osservato nel vitello. Mediante il test di immnuofluorescenza indiretta (IFI), sono stati evidenziati anticorpi
specifici solo nel vitello, mentre la bovina è risultata sieronegativa. Il test PCR per la ricerca del DNA di OvHV-2,
effettuato su campioni di sangue e di tessuti prelevati dai due animali, ha fornito esito positivo in entrambi i casi. Si tratta
delle prime due segnalazioni in Italia di focolai di MCF, confermati dall’identificazione diretta di OvHV-2.
TWO OUTBREAKS OF MALIGNANT CATARRHAL FEVER IN CATTLE IN SOUTHERN ITALY
Abstract
Malignant catarrhal fever (MCF), caused by ovine herpesvirus 2 (OvHV-2), has been described in several European
countries, but in Italy reports are rare and not reinforced by the identification of the causative agent.
In this note, two outbreaks of MCF in cattle belonging to different herds of Southern Italy are reported. The affected
animals, a three-year-old cow and a six-month-old calf, developed clinical manifestations resembling those of the “head and
eye” form of MCF, i. e., fever, hypersalivation, diarrhoea, corneal opaqueness, mucopurulent ocular and nasal discharge,
erosions of the oronasal mucosa, and necrosis of the muzzle. A close cohabitation with sheep was demonstrated in the farm
of the cow, whereas no contact with carrier animals was reported for the calf. By an indirect immunofluorescent (IIF) assay,
MCF antibodies were found only in the serum of the calf, whereas the cow resulted seronegative. A PCR assay detected
the OvHV-2 DNA in blood and tissue samples from both the affected animals. These are the first cases of MCF in Italy,
which were confirmed by PCR detection of OvHV-2 DNA.
Introduzione
La febbre catarrale maligna (MCF) è una malattia infettiva a decorso acuto ed invariabilmente letale, che colpisce i
bovini domestici e numerose specie di ruminanti selvatici. È caratterizzata da fenomeni linfoproliferativi e da infiltrazione
linfocitaria a carico di diversi tessuti. Attualmente sono note due diverse forme della malattia, differenziabili su base
eziologica ed epidemiologica. La wildebeest-associated MCF (WA-MCF), sostenuta da alcelaphine herpesvirus 1 (AlHV1), è diffusa in Africa, colpisce prevalentemente alcuni ruminanti selvatici e riconosce come carrier asintomatici gli gnu; la
sheep-associated MCF (SA-MCF), causata da ovine herpesvirus 2 (OvHV-2), è diffusa su scala mondiale, colpisce i bovini
ed i cervidi ed è veicolata da pecore e capre (Plowright, 1990; Radostits e coll., 2000).
La malattia nella specie bovina ha carattere sporadico. I bovini rappresentano degli ospiti a fondo cieco, in quanto,
generalmente, sviluppano una forma clinica rapidamente letale e non sono in grado di trasmettere l’infezione ad altri
animali recettivi. Sono tuttavia numerose le segnalazioni di SA-MCF in bovini con decorso benigno o inapparente. La
trasmissione di OvHV-2 dagli ovicaprini ai bovini si realizza a seguito di uno stretto contatto tra le due specie; i bovini si
infettano attraverso l’inalazione di aerosol proveniente dalle secrezioni nasali ed oculari di agnelli infetti, oppure mediante
l’ingestione di acqua o foraggi contaminati dai secreti infetti o dai liquidi del parto (Plowright, 1990).
Nei bovini la SA-MCF può presentarsi in diverse forme cliniche, tra le quali la forma cefalo-oculo-nasale (head and eye form
degli autori anglosassoni) è la più frequente ed è caratterizzata da febbre (41-42°C), depressione, scolo oculo-nasale mucoso
o mucopurulento, fotofobia, lacrimazione, opacamento corneale, mono o bilaterale, iperemia della mucosa oronasale, che
appare cosparsa di focolai erosivo-necrotici. Nei casi più gravi possono comparire anche i segni dell’interessamento del
SNC, quali atassia, nistagmo, rigidità cervicale e tremori (Plowright, 1990; Radostits e coll., 2000).
Nella presente nota si descrivono due casi di MCF in bovini allevati in Italia Meridionale.
Materiali e metodi
Casi clinici. I casi clinici sono stati osservati in due diversi allevamenti dell’Italia Meridionale. Il primo episodio di MCF è stato
osservato in un allevamento di bovini di razza frisona della provincia di Benevento, che comprendeva 56 bovine da latte e 32
188
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
vitelli. In aprile 2002, una vacca di 3 anni ha sviluppato una grave forma clinica, caratterizzata da febbre (42°C), abbattimento,
lacrimazione, scolo oculo-nasale di tipo mucopurulento e diarrea profusa. Ad un attento esame clinico si potevano apprezzare
linfoadenopatia generalizzata e lesioni necrotiche sul musello ed intorno alle narici, le quali, ostruendo il passaggio dell’aria,
erano responsabili di difficoltà respiratoria. La morte sopraggiungeva 4 giorni dopo la comparsa della sintomatologia respiratoria.
Dall’indagine epidemiologica è emerso che lo stesso allevamento ospitava un gregge di 110 pecore, le quali avevano accesso agli
stessi foraggi ed agli stessi abbeveratoi dei bovini. In base alla sintomatologia ed all’anamnesi è stata formulata la diagnosi di
sospetto di MCF. Un campione di sangue intero, un campione di siero ed una crosta del musello, prelevati dalla vacca poco prima
della morte, sono stati inviati al laboratorio per gli accertamenti virologici.
Il secondo caso di MCF è stato segnalato, a settembre dello stesso anno, in un allevamento di 36 brune alpine della provincia
di Potenza. Un vitello di sei mesi ha presentato i segni tipici della forma cefalo-oculo-nasale, con ipertermia (41°C),
cheratocongiuntivite bilaterale, opacamento corneale, scialorrea, scolo nasale, dapprima mucoso e poi mucopurulento,
nonché iperemia e fenomeni erosivi a carico della mucosa oronasale. Dopo 11 giorni dalla comparsa dei primi segni
clinici, il vitello ha sviluppato sintomi nervosi (incoordinazione motoria e convulsioni) ed è stato abbattuto. Prima
dell’abbattimento sono stati prelevati campioni di sangue con e senza anticoagulanti, mentre subito dopo la morte sono
stati asportati i turbinati, che presentavano una grave flogosi. Il materiale raccolto è stato inviato al laboratorio.
Estrazione del DNA virale e PCR. Dal sangue intero della vacca e del vitello con sospetta MCF è stato raccolto il buffy
coat mediante stratificazione su Lympholyte®-H (Cedarlane, Hornby, Ontario, Canada), seguendo le istruzioni della casa
produttrice. Il DNA virale è stato estratto dal buffy coat dei due animali mediante QIAamp® DNA Blood Mini Kit (Qiagen
GmbH, Hilden, Germany), e dalla crosta del musello della vacca e dai turbinati del vitello mediante DneasyTM Tissue Kit
(Qiagen GmbH, Hilden, Germany). Per la ricerca del DNA di OvHV-2 è stata effettuata una eminested-PCR, secondo la
metodica descritta da Baxter e coll. (1993), modificata da Hüssy e coll. (2001). Nel primo ciclo di amplificazione è stata
utilizzata la coppia di primers 488 (AGTCTGGGG TATATGAATCCAGATGGCTCT)/755 (AAGATAAGCACCAG
TTATGCATCTGATAAA), che amplifica un frammento di 422 bp del gene che codifica per la proteina del tegumento.
Sono state impiegate le seguenti condizioni termiche: 40 cicli di 94°C per 30 sec, 60°C per 30 sec, 72°C per 30 sec, seguiti
da una fase finale di polimerizzazione a 72°C per 10 min. Un’aliquota di 2,5 μl dell’amplificato PCR è stata sottoposta ad
un secondo ciclo di amplificazione (eminested), utilizzando i primers 488/555 (TTCTGGGGTAGTGGCGAGCGAAG
GCTTC), che amplificano un frammento interno di 238 bp, e le stesse condizioni termiche della PCR per un totale di 30
cicli. Infine, i prodotti dei due cicli di amplificazione sono stati sottoposti ad elettroforesi in gel di agarosio e visualizzati
al transilluminatore UV, previa colorazione con etidio bromuro. Come controlli positivi sono stati utilizzati il DNA di
OvHV-2 estratto da un campione di campo, gentilmente fornito da I. Campbell (Department of Viral Diseases, Veterinary
Laboratories Agency, Weybridge, UK), ed il plasmide pOvHV-2 (Hüssy e coll., 2001), gentilmente fornito da M. Engels
(Institute of Virology, Veterinary Medical Faculty, Zurigo, Svizzera).
Analisi di sequenza. Gli amplificati PCR di 422 bp sono stati inviati alla Genome Express (Meylan, Francia) per
il sequenziamento diretto. Le sequenze ottenute sono state analizzate, utilizzando il programma di analisi molecolare
BLAST del National Center of Biotechnology Information (NCBI; www.ncbi.nih.gov), ed allineate mediante il software
BIOEDIT (Hall, 1999).
Esami sierologici. La ricerca di anticorpi specifici per i virus della MCF è stata effettuata mediante test di
immunofluorescenza indiretta (IFI). Lo stipite AlHV-1 WC 11 è stato inoculato su cellule primarie di rene fetale bovino
e le cellule infette, quando l’effetto citopatico era avanzato, sono state tripsinizzate, distribuite su vetrini multispot e
fissate in acetone freddo. I sieri dei due bovini sono stati diluiti per raddoppio, partendo dalla diluizione 1:50, fino a
1:1600, e le diverse diluizioni sono state deposte sui pozzetti e incubate a 37°C per 30 min. Dopo 3 lavaggi in soluzione
salina tamponata (PBS) di 15 min ciascuno, è stato aggiunto siero anti-IgG di bovino marcato con fluoresceina (Sigma
Aldrich Srl, Milano). Dopo incubazione a 37°C per 30 min, i vetrini sono stati sottoposti a 3 cicli di lavaggi in PBS ed
osservati al microscopio a fluorescenza.
Diagnosi differenziale. Il buffy coat ed i campioni di tessuto dei due bovini sono stati testati in diversi test PCR, per la
ricerca dell’acido nucleico del virus della diarrea virale bovina (BVDV), dell’herpesvirus bovino tipo 1 (BoHV-1) e tipo 4
(BoHV-4).
Risultati
I sintomi presentati dai due bovini sono altamente indicativi di MCF. I test PCR ed eminested hanno evidenziato la
presenza dell’acido nucleico di OvHV-2 nel buffy coat e nei campioni di tessuto prelevati da entrambi gli animali.
L’analisi di sequenza dei prodotti PCR ottenuti ha evidenziato una identità nucleotidica del 99% rispetto alle sequenze di
OvHV-2 disponibili nella GenBank (numeri di accesso L05908 e S64565) ed al DNA plasmidico pOvHV-2, mentre una
identità del 100% è stata riscontrata nei confronti del campione positivo di Weybridge.
Tuttavia, mediante test IFI, anticorpi specifici per i virus della MCF sono stati messi in evidenza solo nel siero del vitello,
con titolo pari a 1:800, mentre la vacca è risultata sieronegativa.
I test PCR per la ricerca di BVDV, BoHV-1 e BoHV-4 hanno fornito esito costantemente negativo.
DISCUSSIONE
La diagnosi clinica di MCF nei due bovini è stata confermata dall’esito positivo dei test PCR ed eminested, la cui specificità è stata
dimostrata dall’analisi di sequenza degli amplificati ottenuti. L’indagine epidemiologica ha evidenziato una stretta coabitazione
con le pecore solo per la vacca, mentre per il vitello non sono emersi pregressi contatti con specie carrier (ovicaprini), anche se
non possono essere esclusi occasionali contatti al pascolo. L’assenza di anticorpi specifici per i virus della MCF nel siero della
vacca potrebbe essere spiegata dal decorso rapidamente letale della malattia. È infatti noto che un decorso particolarmente rapido
della MCF può portare a morte l’animale, prima che gli anticorpi raggiungano un livello evidenziabile con le normali tecniche
sierologiche (Radostits e coll., 2000).
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
189
In Italia, focolai di MCF in allevamenti promiscui sono stati raramente segnalati e, comunque, la diagnosi è stata effettuata
sulla base dei sintomi clinici, dei dati anamnestici, del quadro istopatologico, oppure dei risultati degli esami sierologici
(Guarino e coll., 1993; Casalinuovo e coll., 1996; Decaro e coll., 2003). Pertanto, i casi descritti nella presente nota
rappresentano, in Italia, le prime segnalazioni di MCF, nelle quali il quadro clinico e gli esami sierologici sono stati
confermati dall’evidenziazione dell’acido nucleico di OvHV-2.
Bibliografia
Baxter SIF, Pow A, Bridgen A, Reid HW (1993) PCR detection of the sheep-associated agent of malignant catarrhal fever. Arch. Virol.,
132: 145-159. - Casilinuovo F, Cacia A, Scarpino P, Gualtieri G, Gagliardi G, Caparello G (1996). Febbre catarrale maligna dei bovini:
segnalazione di 2 casi clinici negli allevamenti calabresi. Praxis Vet., 17: 20-22. - Decaro N, Bozzo G, Tinelli A, Aliberti A, Buonavoglia
D, Magrì VM (2003). Febbre catarrale maligna in due bovine in Sicilia. L.A.R., 9: 29-35. - Guarino A, Agrimi U, Fenizia D, Tollis M
(1993). Focolaio di Febbre catarrale maligna bovina in Italia. Atti S.I.S.Vet., Riccione, 29 Settembre – 2 Ottobre 1993, 47: 1949-1950.
- Hall TA (1999). BioEdit: a user-friendly biological sequence alignment and analysis program for Windows 95/98/NT. Nucleic Acids
Symp. Ser., 41: 95-98. - Hüssy D, Stäuber N, Leutenegger CM, Rieder S, Ackermann M (2001). Quantitative fluorogenic PCR assay
for measuring ovine herpesvirus 2 replication in sheep. J. Clin. Microbiol., 8: 123-128. - Plowright W. (1990). Malignant catarrhal fever
virus. In: Dinter Z, Morein B, Eds, Virus infections of vertebrates, vol. III, Virus infections of ruminants, 1st Ed., pp. 123-150; Elsevier
Science Publishing Co. Inc., Amsterdam, The Netherlands. - Radostits OM, Gay CC, Blood DC, Hinchcliff KW. (2000). Diseases
caused by viruses. In: Radostits OM, Gay CC, Blood DC, Hinchcliff KW, Eds, Veterinary Medicine: a textbook of diseases of cattle,
sheep, pigs, goats, and horses, 9th Ed., pp. 1081-1085; W.B. Saunders Co. Ltd., London, UK.
190
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ENTERITE NEONATALE DEI RUMINANTI DA ROTAVIRUS:
IDENTIFICAZIONE DI UN NUOVO SIEROTIPO VP4 NEL BUFALO
Martella V.,1 Terio V.,1 Camero M.,1 Campolo M.,1 Cavaliere N.,2 Cafiero M.,2 Buonavoglia C.1
Dipartimento di Sanità e Benessere Animale, Facoltà di Medicina Veterinaria di Bari
2
Istituto Zooprofilattico Sperimentale – Sezione di Foggia
1
Autore comunicante:
Martella Vito
Dipartimento di Sanità e Benessere Animale, Facoltà di Medicina Veterinaria di Bari
S.p. per Casamassima Km3, 70010, Valenzano, Bari
Tel: 080 4679833 Fax: 080 4679843
E-mail: [email protected]
Riassunto
Uno stipite rotavirus, 10733, isolato dalle feci di un vitello di bufalo colpito da grave enterite, è stato caratterizzato
mediante analisi dei principali determinanti antigenici (VP7, VP4 e VP6), nonché dei geni delle proteine non struttali
(NSP4, NSP5/6) e del pattern di migrazione elettroforetico dell’RNA genomico virale. Da un punto di vista antigenico, il
virus è stato classificato come P5B[3],G6, SG I. Il lungo pattern elettroforetico di migrazione dei segmenti di RNA virale e
l’omologia nei geni delle proteine non strutturali (NSP4, NSP5/6) confermano l’origine prettamente bovina (o comunque
l’appartenenza ad un ruminante) del virus isolato. Mediante analisi di sequenza, la frazione VP8* della VP4 ha rilevato
una elevata omologia nella sequenza aminoacidica (96.3%) con lo stipite di scimmia RRV (P5B[3]). Ad eccezione del virus
prototipo RRV MMU18006, isolato alla fine degli anni ’70 negli Stati Uniti da una scimmia rhesus, rotavirus in possesso
dell’allele P5B[3] non sono mai stati identificati né negli animali né nell’uomo. L’identificazione del genotipo P[3], RRVsimile in un bufalo, fornisce ulteriore conferma della diversità antigenica/genetica dei rotavirus di gruppo A.
Abstract
A rotavirus strain, 10733, isolated from the faeces of a buffalo calf affected with severe enteritis diarrhoea, was characterised
by analysis of the main antigenic determinants (VP7, VP4 and VP6), as well as of the electrophoretic pattern of the genomic
viral RNA segments. Strain 10733 was antigenically characterised as P5B[3],G6, SGI. The long electrophoretic pattern
and the high sequence similarity to bovine rotaviruses in the non structural protein (NSP4 and NSP5/6) confirm that
strain 10733 is a bovine-like rotavirus (or a ruminant-like strain). Sequence analysis of the VP8* trypsin-cleavage product of
the VP4 protein revealed a high amino acid (aa) identity (96.3%) to that of RRV (P5B[3]). With the only exception of the
prototype strain RRV MMU1088, isolated in the early 1970s in the USA from a rhesus monkey, P5B[3] rotaviruses have
never been identified neither in animals nor in humans. Thus, the identification of the P[3] VP4 genotype, RRV-like, in a
buffalo calf, provides additional evidence for the antigenic/genetic diversity of group A rotaviruses.
Introduzione
I rotavirus di gruppo A sono la principale causa di gastroenterite virale acuta nell’uomo ed in molte specie animali. I rotavirus
appartengono alle Reoviridae e possiedono 11 segmenti di RNA bicatenario (dsRNA) racchiuso in un capside trilaminare
(Estes, 2001). La proteina interna VP6 esprime l’antigene di gruppo e sottogruppo che permette la classificazione in
sottogruppi SGI, SGII o SGI+II (19). I ceppi rotavirus possono esibire pattern elettroforetico (e-tipo) lungo o corto, sulla
base della migrazione dell’11° segmento di dsRNA su gel. La maggior parte dei ceppi animali ed umani possiedono pattern
lungo ma i primi appartengono al SGI, i secondi al SGII (Kapikian et al., 2001).
La classificazione in sierotipi si basa su due determinanti antigenici, localizzati rispettivamente sulla proteine capsidiche
esterna VP7 (G sierotipo) e VP4 (P sierotipo) (Estes, 2001). Sulla base dell reattività sierologica e della analisi genetica, 15
G sierotipi sono stati identificati (Estes, 2001; Kapikian et al., 2001). Antisieri specifici e anticorpi monoclonali costruiti
verso la VP4 hanno identificato 14 P sierotipi, mentre l’analisi di sequenza della VP4, o della subunità VP8* della VP4,
ha identificato 23 P genotipi (Hoshino et al., 2002; Kapikian et al., 2001; Martella et al ., in press; Liprandi et al.,
comunicazione personale). Con poche eccezioni, (Ciarlet et al., 1997a), ceppi che esibiscono almeno l’89% di omologia
aminoacidica (aa) sono classificati come appartenenti allo stesso P genotipo. Seguendo le linee guida di questo sistema di
classificazione, il P sierotipo viene indicato come un numero immediatamente subito dopo la lettera P, mentre il genotipo
viene indicato con un numero tra parentesi quadra (Estes, 2001; Hoshino et al., 2002; Kapikian et al., 2001).
Rotavirus appartenenti ai sierotipi G6, G8 e G10, in associazione con tipi VP4 P6[1], P7[5] o P8[11], sono comunemente
identificati nei bovini, sebbene siano stati identificati sporadicamente dei ceppi appartenenti ai tipi G1, G2, G3, G7 e
G11 (El-Attar et al., 2002; Kapikian et al., 2001; Varshney et al., 2002). Inoltre, è stato possibile isolare da vitelli dei virus
inusuali, P[17],G7, presumibilmente di origine aviare (Rohwedder et al., 1995), e degli stipiti P[21],G15, mai identificati
prima in nessun altra specie animale (Rao et al., 2000).
Nel presente studio, viene descritto l’isolamento e la caratterizzazione molecolare dei geni VP8*, VP7, VP6, NSP4, e
NSP5/6 di un inusuale stipite rotavirus, 10733, da un vitello di 1 settimana di età colpito da grave enterite. Dall’analisi
molecolare si evince che, sebbene lo stipite 10733 possieda una costellazione di alleli tipicamente di origine bovina, uno
dei suoi determinanti antigenici, la proteina VP4, risulta molto simile (> 96% a livello aa) a quella di un virus di scimmia
rhesus (RRV), mai identificato sinora negli animali e nell’uomo.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
191
Materiali e metodi
Isolamento del virus.
Lo stipite rotavirus 10733 è stato isolato nel 2001 nel Sud Italia in un allevamento di bufali da un vitello di 1 settimana
di età, che manifestava gravi sintomi di enterite. Il virus è stato adattato alla crecita su cellule MA-104, in DMEM
addizionato di tripsina 5 µg/ml. La crescita virale è stata evidenziata mediante osservazione dell’effetto citopatico (ECP)
ed immunofluorescenza indiretta (IF), usando un siero di coniglio specifico per rotavirus di gruppo A. Dopo 12 passaggi
seriali, il virus è stato purificato per tre volte ed il suo titolo è stato determinato mediante metodo delle placche. Le placche
virali sono state ottenute usando DMEM agarosio 0.6% in presenza di tripsina 5 µg/ml e siero fetale bovino 2.5% ed il
titolo virale è stato espresso in unità formanti placche per ml (UFP/ml). Lo stipite virale 10733 ha prodotto placche di 0.11 mm in terreno semi-solido, raggiungendo titoli di 1.5x107 UFP/ml già dal 9° passaggio in vitro.
Determinazione dell’elettroferotipo.
L’RNA virale è stato estratto dalle cellule infette in presenza di ECP 50%. Il virus è stato purificato mediante solvente
(Mendez et al., 2000) e l’RNA è stato estratto con fenolo-cloroformio, precipitato con etanolo e sodio acetato 0.3 M, e
risospeso in TE (Tris-EDTA, pH 8.0). L’e-tipo è stato visualizzato in TAE gel (Tris-EDTA-Acetato, pH 8.0) allo 0.5% e
1.5% di agarosio, dopo elettroforesi a 15V per 18 h e colorazione con etidio bromuro.
Extrazione RNA virale e amplificazione PCR dei geni VP7, VP4, VP6, NSP4 e NSP5/6.
L’RNA virale è stato estratto sia dal campione di feci originario sia dal 3° passaggio su cellule, mediante adsorbimento su
cellulosa CF11, come descritto in precedenza (Wilde et al., 1990). L’RNA virale è stato denaturato in dimetilsulfossido a
97°C per 5 min. La retrotrascrizione virale è stata effettuata usando la retrotrascrittasi MuLV (Perkin-Elmer Europe B.V.
Monza), mentre l’amplificazione PCR è stata effettuata usando la DNA-polimerasi AmpliTaq Gold (Perkin-Elmer Europe
B.V. Monza).
Il gene VP7 (1,062 nucleotidi [nt]) è stato amplificato usando i primer Beg9 (Gouvea et al., 1990) ed il primer End9deg
(GGTCACATCDWMCARYTCTAAYYHM). La sub-unità VP8* del gene VP4, il peptide di connessione, e l’estremità
N-terminale della sub-unità VP5* della VP4 (876 nt) sono stati amplificati usando i primer Con2-Con3 (Gentsch et
al., 1992). Il gene NSP4 (725 nt) è stato amplificato usando i primer 10Beg16-10End722 (Lee et al., 2000), mentre il
gene NSP5/NSP6 (667 nt) è stato amplificato usando i primer descritti da Krishna et al. (2001). Il genogruppo VP6,
predittivo della specificità di SG, è stato determinato mediante amplificazione di un frammento di 379 nt, codificante per
gli aminoacidi (aa) 241-367, usando i primer VP6F-VP6R (Iturriza-Gòmara et al., 2002).
Analisi di sequenza.
Per l’analisi di sequenza diretta, tre distinti amplificati PCR sono stati analizzati e una sequenza consensus è stata elaborata.
Inoltre, i geni VP7 e VP8* sono stati clonati nel vettore pCRT7/NT-TOPO (Invitrogen BV, Groningen, The Netherlands)
e la sequenza è stata determinata usando tre cloni plasmidici. Le sequenze sono state assemblate ed analizzate usando il
software Bioedited (Hall et al., 1999) e registrate in GenBank con i numeri di accesso AY281360, AY281359, AY293829,
AY293830, per la VP7, VP8*, NSP4 ed NSP5/6, rispettivamente.
Risultati
Determinazione dell’elettroferotipo.
L’e-tipo dello stipite 10733 ha esibito un pattern lungo, tipico dei rotavirus di gruppo A animali con minime differenze di
mobilità nei segmenti 4, 7, 8 e 9 rispetto ai ceppi di referenza del nostro laboratorio (dati non mostrati).
Analisi di sequenza.
Il gene VP7 dello stipite di bufalo 10733 è risultato lungo 1,062 nt. La sequenza aa della proteina codificata, lunga 326
aa, è risultata molto simile (98.7-87.4%) a quella di virus appartenenti al sierotipo G6. La più elevata omologia (98.7 e
93.5% aa) è stata osservata nei confronti degli inusuali virus umani P3[9],G6 Hun4 (Ungheria) e PA151 (Italia). A livello
del frammento VP8*, il virus 10733 ha mostrato un’elevata omologia ( 95.6% nt e 96.2% aa) verso lo stipite di scimmia
rhesus RRV MMU10833, caratterizzato come P5B[3] (Tabella 1). Un’elevata omologia (83% nt e 90.8% aa) è stata inoltre
osservata nei confronti del virus caprino GRV, recentemente identificato in Giappone (Lee et al., 2000). Poiché virus che
esibiscono un’omologia a livello di VP8* · 89% (aa) appartengono allo stesso P sierotipo o sottotipo (Gorziglia et al., 1990),
lo stipite 10733 può essere assegnato al genotipo P[3] ed al sierotipo P5B, di cui lo stipite RRV MMU18006 è il prototipo.
L’analisi comparativa del frammento VP6 (aa 281-350), correlato con la specificità SG (Iturriza-Gómara et al., 2002), ha
permesso di caratterizzare il virus 10733 come genogruppo I, indicativo del SGI (dati non mostrati). La sequenza della
proteina NSP4 è risultata simile (97.1%) a quella dell’inusuale stipite umano A64, G10, di probabile origine bovina, ed
al ceppo bovino UK, P7[5],G6, consentendo di caratterizzare il virus come appartenente al genogruppo NSP4 A, KUNsimile, cui appartiene la maggior parte dei ceppi bovini. La sequenza del gene NSP5/6 del virus 10733 ha mostrato la
più elevata omologia (96.7%) nei confronti dello stipite bovino RF. In questo gene, un’elevata omologia è stata osservata
anche verso i virus umani P3[9], come gli stipiti 512B (93.9%), K8 e AU-1 (93.4%), nonché verso lo stipite bovino UK
(92.9%).
Discussione
L’epidemiologia dei rotavirus nei bufali è poco nota. La tipologia di conduzione dell’allevamento e/o la stretta affinità di
specie tra bovini e bufali possono spiegare l’identificazione nei bufali di rotavirus con determinanti antigenici G6, G8 e
G10, associati a P6[1], P7[5], o P8[11] in Italia (Martella et al., 1999; Pratelli et al., 1999). Analogamente, rotavirus dotati
di specificità antigeniche analoghe a quelle dei rotavirus bovini sono stati identificati nei bufali in India, dove i tipi G10 e
P8[11] sono prevalenti (Gulati et al., 1999).
Il virus di bufalo 10733, ha mostrato un e-tipo lungo, e una specificità VP6 di tipo SG I. Un tale pattern è comunemente
descritto nei virus di origine animale (Kapikian et al., 2001). Inoltre, l’analisi di sequenza dei geni VP7, VP8*, NSP4 e
NSP5/6 ha mostrato che il virus possiede specificità G6 e P[3], nonché geni NSP5/6 ed NSP4 (KUN-simile, genotipo
192
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
A), di origine bovina.
L’elevata omologia nucleotidica ed aminoacidica della VP8* dello stipite 10733 nei confronti del virus RRV, suggerisce
che lo stipite 10733 possiede un allele VP4 analogo a quello del virus RRV e consente di includere il virus 10733 nel P
tipo P5B[3]. Analizzando le sequenze nei database, è stato possibile trovare la sequenza del gene VP8* di un virus, GRV,
isolato da un capretto in Corea, che mostra elevata omologia nei confronti dei virus 10733 ed RRV (Lee et al., 2003).
L’identificazione del raro allele VP4 P[3], RRV-simile, nei ruminanti solleva degli interrogativi sull’ origine e
sull’Introduzione di questo nuovo P tipo nel pool di alleli dei rotavirus dei ruminanti. Lo stipite di scimmia rhesus
RRV MMU18006 è stato originariamente isolato dalle feci di una scimmia rhesus di 3-5 mesi di età colpita da diarrea
(Stucker et al., 1980). Lo stipite RRV è stato classificato sia sierologicamente che geneticamente come P5B[3],G3, SG I
e genotipo NSP4 C (Au-1-simile) (Ciarlet et al., 2000). Mentre la specificità G3 è stata descritta in un ampio spettro di
specie animali (Estes, 2001), sinora il virus prototipo RRV è il solo stipite che possiede allele VP4 P5B[3] (Hoshino et
al., 2002). Nonostante sia usato come ceppo di referenza in molti laboratori e come virus vettore nel vaccino tetravalente
riassortante sviluppato per la prevenzione della rotavirosi nei bambini (Kapikian, 2002; Midthun et al., 1985, 1986), virus
RRV- simili non sono mai stati descritti sinora ed il P tipo 5B[3] è considerato un allele di scarsa rilevanza epidemiologica
sia negli uomini che negli animali. Pertanto, l’identificazione di virus P[3] RRV-simili, ha solo due possibili spiegazioni:
(i) l’allele P[3] RRV-simile è presente nei ruminanti ma non è mai stato identificato sinora a causa della sua limitata
diffusione e/o dei sistemi di tipizzazione utilizzati; (ii) tale allele è stato introdotto recentemente nel pool di alleli genici
dei rotavirus dei ruminanti, come risultato di un riassortimento genetico realizzatosi con un virus di scimmia o con
il virus vaccinale rhesus. Per esempio, la trasmissione orizzontale del virus è stata dimostrata sia nei bambini vaccinati
sia nei soggetti di controllo durante la sperimentazione del vaccino riassortante rhesus in Venezuela (Perez-Schael et al.,
1997). Poiché il vaccino reassortante rhesus è stata sperimentato in diversi Paesi sin dalla metà degli anni ’80, potrebbe
avere avuto luogo una massiva contaminazione ambientale con il virus di origine vaccinale nel corso degli ultimi 20
anni. Questa ipotesi è estremamente affascinante, poiché evoca lo spettro del potenziale rischio biologico derivante
dalla manipolazione di virus vivi che possiedono elevata plasticità genetica/antigenica, quali i virus ad RNA segmentato.
L’identificazione di uno stipite rotavirus di bufalo, caratterizzato come P5B[3],G6, mentre da una parte fornisce un’ulteriore
conferma della diversità genetica/antigenica dei rotavirus di gruppo A, d’altra parte è anche importante nella prospettiva
di comprendere la basi della restrizione d’ospite di questi virus. Sebbene i rotavirus abbiano una bassa specie-specificità, le
infezioni eterologhe (in una specie ospite inusuale) di solito non determinano segni clinici e non sono in grado di propagarsi
efficientemente (Ciarlet et al., 1998; 2000; Estes, 2001). Lo stipite 10733 è stato isolato da un vitello di bufalo con
diarrea, pertanto la presenza di questo nuovo allele VP4, RRV-simile, nel background di un virus bovino è probabilmente
permissiva nei confronti dell’infezione acuta sintomatica nei vitelli. Curiosamente, il virus RRV, P5B[3],G3, è anche il solo
stipite in grado di determinare infezione eterologa produttiva (sintomatica ed in grado di propagarsi) nel modello coniglio
(Ciarlet et al., 1998; 2000).
L’analisi comparativa della sequenza di altri geni del virus 10733, nonché l’infezione sperimentale di vitelli bovini
o bufalini, potrebbe fornire importanti informazioni sui meccanismi molecolari che regolano la restrizione dello
spettro d’ospite nel caso dei rotavirus, nonché potrebbe aiutare a comprendere l’origine di questo virus insolito.
Bibliografia
Ciarlet M, Estes MK, Barone C, Ramig RF, Conner ME. J Virol (1998), 72: 2341-2351. Ciarlet M, Estes MK, Conner ME. J Gen
Virol (2000), 81: 1237-1249. Ciarlet M, Estes MK, Conner ME. Arch Virol (1997), 142: 1059-1069. El-Attar L, Dhaliwal W, IturrizaGomara M, Bridger JC. J Clin Microbiol (2002), 40: 937-942. Estes MK. Fields virology (2001), p. 1747-1785. Gentsch JR, Glass
RI, Woods P, Gouvea V, Gorziglia M, Flores J, Das BK, Bhan MK. J Clin Microbiol (1992), 30: 1365-1373. Gorziglia M, Larralde G,
Kapikian AZ, Chanock RM. Proc Natl Acad Sci USA (1990), 87: 7155-7159. Gouvea V, Glass RI, Woods P, Taniguchi K, Clark HF,
Forrester B, Fang Z-Y. J Clin Microbiol (1990), 28: 276-282. Gulati BR, Nakagomi O, Koshimura Y, Nakagomi T, Pandey R. J Clin
Microbiol (1999), 37: 2074-2076. Hall TA. Nucl Acids Symp Ser (1999), 41: 95-98. Hoshino Y, Jones RW, Kapikian AZ. Virology
(2002), 299: 64-71. Iturriza-Gómara M, Wong C, Blome S, Desselberger U, Gray JJ. J Virol (2002), 76: 6596-601. Kapikian AZ. The
Lancet (2002), 359: 1065-1066. Kapikian AZ, Hoshino Y, Chanock RM. Fields virology (2001), p. 1787-1833. Krishna Mohan KV,
Atreya CD. Virus Genes (2001), 23: 321-329. Lee C-N, Wang Y-L, Kao C-L, Zao C-L, Lee C-Y, Chen H-N. J Clin Microbiol (2000),
38: 4471-4477. Lee J-B, Youn S-J, Nakagomi T, Park S-Y, Kim T-J, Song C-S, Jang H-K, Kim B-S, Nakagomi O. Arch. Virol. (2003),
148: 643-657. Martella V, Ciarlet M, Camarda A, Pratelli A, Tempesta M, Greco G, Cavalli A, Elia G, Decaro N, Terio V, Bozzo G,
Camero M, Buonavoglia C. Virology. In press. Martella V, Pratelli A, Pinto O, Ferrara G, Tempesta M, Buonavoglia D. J Vet Med B
(1999), 19: 871-876. Mendez II, Hermann LL, Hazelton PR, Coombs KM. JVirol Methods, 2000. 90: 59-67. Midthun K, Greenberg
HB, Hoshino Y, Kapikian AZ, Wyatt RG, Chanock RM. J Virol (1985), 53: 949-954. Midthun K, Hoshino Y, Kapikian AZ, Chanock
RM. J Clin Microbiol (1986), 24: 822-826. Perez-Schael I, Guntinas MJ, Perez M, Pagone V, Rojas AM, Gonzales R, Cunto W,
Hoshino Y, Kapikian AZ. . Engl J Med (1997), 337: 1181-1187. Pratelli A, Martella V, Tempesta M, Buonavoglia C. Microbiologica
(1999), 22: 105-109. Rao CD, Gowda K, Reddy BSY. Virology (2000), 276: 104-113. Rohwedder A, Schutz KI, Minamoto N, Brussow
H. Virology (1995), 210: 231-235. Stucker G, Oshiro LS, Schmidt NJ. J Clin Microbiol (1980), 11: 202-203. Varshney B, Jagannath
MR, Vethanayagam RR, Kodhandharaman S, Jagannath HV, Gowda K, Singh DK, Rao D. Arch Virol (2002), 147: 143-165. Wilde J,
Eiden J, Yolken R. J Clin Microbiol (1990), 28: 1300-1307.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
193
Tabella 1: comparazione aminoacidica della porzione VP8* dello stipite rotavirus di bufalo 10733
con P genotipi noti. N.d.: non determinato.
P
Genotipo
P
Sierotipo
Stipite (origine)
194
Identità aminoacidica VP8*
(aa 1 - 247)
10733
GRV
RRV
A5 (bovino)
SA11 (scimmia)
1
2
6
5B
80.9
85.4
81.2
84.5
79.8
84.0
RRV (scimmia)
3
5B
96.2
91.0
-
10733 (bufalo)
3
n.d.
-
91.3
96.2
GRV (capra)
3
n.d.
91.3
-
90.9
K9 (cane)
3
5A
88.2
87.8
85.7
CU-1(cane)
3
5A
87.1
86.5
85.7
L26 (uomo)
4
1B
61.8
62.8
61.1
UK (bovino)
5
7
66.3
69.1
66.3
M37 (uomo)
6
2A
64.9
63.9
64.2
Gottfried (suino)
6
2B
64.2
63.5
64.2
OSU (suino)
7
9
79.2
78.1
77.1
WA (uomo)
8
1A
61.4
63.5
60.7
K8 (uomo)
9
3
62.1
63.2
62.1
69M (uomo)
10
4
77.7
77.2
78.3
B223 (bovino)
11
8
45.2
46.9
45.5
H-2 (equino)
12
72.2
73.6
72.57
MDR-13 (suino)
13
67.7
70.5
67.0
ALA (coniglio)
14
61.8
63.2
61.5
Lp14 (ovino)
15
78.8
80.5
78.8
EW (topo)
16
68.7
68.2
67.7
993/83 (topo)
17
48.2
49.3
47.2
L338 (equino)
18
73.3
75.7
74.6
Mc323 (uomo)
19
12
64.2
65.6
63.5
EHP (topo)
20
13
73.3
78.1
75.7
Hg18 (bovino)
21
68.7
71.2
67.7
160/01 (lapine)
22
65.9
68.8
64.9
11
10
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ABORTI OVINI E CAPRINI IN SARDEGNA RIFERITO A TOXOPLASMA GONDII, COXIELLA
BURNETII E CHLAMYDOPHILA ABORTUS :
ANALISI DEL QUADRIENNIO 1999-2002
Tanda A.1, Porcu.1, Madau L.1, Gallisai E.1, Cillara G.1, Sanna S.1, Tola S.1, Masala G.1
Isituto Zooprofilattico Sperimentale della Sardegna “ G. Pegreffi” Sassari
1
Riassunto
Durante il periodo 1999-2002 sono stati analizzati 9639 sieri ed 815 prodotti di aborto (670 feti e 145 placente) provenienti
da 964 allevamenti “problema”, ovini e caprini, distribuiti su tutto il territorio regionale.
Scopo di questo lavoro è avere un quadro epidemiologico ed una mappa di distribuzione degli agenti infettivi Toxoplasma
gondii, Coxiella burnetii e Chlamydophila abortus nel territorio sardo. Tutti gli emosieri sono stati esaminati per valutare
la presenza di anticorpi circolanti per gli agenti infettivi oggetto del nostro studio; sono state applicate tecniche quali :
immunofluorescenza indiretta (IFI) per T. gondii, ELISA per C. burnetii e C. abortus . E’ stata eseguita la Polymerase Chain
Reaction su 2421 campioni fetali ovini e 356 caprini ( placenta, cervello, muscolo, fegato, milza, IV stomaco) utilizzando
primers specifici per ciascun microorganismo. La sieroprevalenza media nel quadriennio considerato si è rivelata più elevata
a carico del T. gondii (IgG ovini 29% e caprini 10.7 % ; IgM ovini 9.5% e caprini 4.1 %). Le percentuali sierologiche
riconducibili a C. burnetii (ovini 9.7%, caprini 11.85%) e C. abortus (ovini 6 %, caprini 10.7 %) sono relativamente basse,
indice di scarsa circolazione nella nostra isola di tali agenti abortigeni.
Sono risultati positivi in PCR (considerando specie ovina e specie caprina ) 294 organi (10.6%) per T. gondii, 141 (7.2%)
per C. burnetii e 26 (2.2%) per C. abortus.
Introduzione
L’ incidenza degli aborti ovini e caprini di origine infettiva in Sardegna è molto elevata; questo è attribuibile sia all’ingente
patrimonio zootecnico dell’isola che all’alta densità di animali sul territorio.
Si tratta di un fenomeno sempre di grande attualità e interesse non solo sanitario ma anche economico causato dalla perdita
di agnelli e dalla mancata lattazione: si stima che il danno si attesti ogni anno intorno ai 10 milioni di Euro.
La diagnosi di alcuni agenti infettivi responsabili di aborto è alquanto complessa ed è legata ad una serie di concause dirette
ed indirette. La prima è in stretta relazione con i metodi diagnostici utilizzati per isolare batteri e protozoi ; le tradizionali
tecniche colturali permettono infatti la crescita di batteri poco esigenti dal punto di vista nutrizionale ma non favoriscono
la crescita dei microrganismi particolarmente “difficili” quali Toxoplasma gondii, Coxiella burnetii, e Chlamydophila abortus
che necessitano di lunghi tempi di crescita e di un substrato cellulare per l’isolamento [3,6,7,8,12,14]. La seconda è
connessa al materiale patologico, non essendo facile, considerate le condizioni strutturali degli allevamenti della Sardegna,
reperire feti e placente per le analisi di laboratorio.
Scopo del nostro lavoro è : 1) avere un quadro epidemiologico degli agenti infettivi ad interesse zoonosico nel territorio sardo
; 2) ridurre i tempi di diagnosi applicando metodiche bio-molecolari ai prodotti di aborto, per migliorare la diagnostica
diretta; 3) abbreviare i tempi di refertazione.
In questo lavoro presentiamo i risultati di un quadriennio di raccolta di sieri e prodotti di aborto relativi ai valori di
sieroprevalenza, in Immuno-fluorescenza indiretta ed Enzyme-Linked Immunosorbent Assay, ed all’identificazione degli
agenti infettivi mediante Polymerase Chain Reaction.
Materiali e metodi
Tutti i campioni di sangue e prodotti di aborto ovini e caprini pervenuti presso i nostri laboratori nel quadriennio 19992002 da 964 aziende “problema” distribuite su tutto il territorio sardo sono elencati in Tabella 1.
ANNO
Allevam.
ovini
Allevam.
caprini
Sieri ovini
Sieri
caprini
Feti ovini
Feti
caprini
Placente
ovine
Placente
caprine
1999
210
23
1972
463
49
8
15
-
2000
216
18
1437
554
240
27
37
-
2001
219
21
1689
365
131
11
32
3
2002
225
32
2096
1063
162
42
49
9
Totali
870
94
7194
2445
582
88
133
12
Tabella 1- Numero dei sieri, dei feti e delle placente ovini e caprini pervenuti nel periodo 1999-2002.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
195
Analisi sierologica
Tutti gli emosieri sono stati esaminati per ricerca di anticorpi specifici per Toxoplasma gondii, Coxiella burnetii, e
Chlamydophila abortus.
Per l’individuazione di anticorpi circolanti per Toxoplasma gondii è stato utilizzato l’antigene liofilizzato della ditta
Biomerieux, ricostituito e dispensato, alla concentrazione indicata dalla casa produttrice su vetrini a 24 pozzetti (GSGNuclear). Dopo una prima incubazione con i sieri da analizzare, diluiti a partire da 1:200 per IgG e 1:20 per IgM, i vetrini
sono stati lavati con PBS, incubati con il 2° anticorpo coniugato con isotiocianato di fluoresceina (FITC, Kpl) e letti al
microscopio a fluorescenza.
L’analisi sierologica è stata eseguita con metodica ELISA, per la ricerca di Ac verso Coxiella burnetii, utilizzando piastre
sensibilizzate prodotte dalla ditta Hoechst-Roussel Vet. , seguendo le istruzioni della casa produttrice.
Gli anticorpi per Chlamydophila abortus sono stati ricercati mediante i kit Panclabort della ditta Yaba : i sieri positivi alle
piastre “Screen” venivano testati successivamente utilizzando le piastre “Controlled” che mettono in evidenza esclusivamente
anticorpi specifici per ceppi abortigeni di Chlamydophila escludendo falsi positivi dovuti a ceppi patogeni ma non abortigeni
oppure a ceppi saprofiti.
Stoccaggio dei feti e delle placente.
Da ciascuno dei 670 feti sono stati asportati il fegato, la milza, il cervello, il IV stomaco e il muscolo. Gli organi fetali e le
145 placente sono stati lavati tre volte con un buffer salino (PBS: 0.1 M phosphate, 0.33 M NaCl, pH 7.2) addizionato con
1.000.000 UI/L di penicillina (Carlo Erba) e di streptomicina (Squibb) e successivamente digeriti con tripsina al 2% per 3
ore a 37°C. Per il cervello è stata utilizzata tripsina allo 0.6%. Dopo una filtrazione con garza sterile, il materiale digerito è
stato centrifugato a 3500 rpm per 10 min, lavato 3 volte con PBS, risospeso in siero fetale con dimetilsolfossido (DMSO)
al 10% e congelato a –80°C fino al momento d’uso.
Estrazione del DNA e PCR.
Il Dna dei microrganismi è stato estratto con kit High Pure PCR Template della ditta ROCHE, successivamente amplificato
mediante PCR (Polymerase Chain Reaction) [1]: le bande specifiche di positività sono state evidenziate mediante separazione
degli ampliconi con elettroforesi su gel di agarosio.
I primers utilizzati amplificavano frammenti della dimensione di: 497 bp delle sequenze intrageniche (IGS) del dna
ribosomiale (rDNA) di Toxoplasma gondii [4]; 257 bp del gene di Coxiella burnetii che codifica per l’enzima superossido
dismutasi [13] ; 320 bp del gene Omp2 per Chlamydophila abortus [10] .
Risultati
Sieroprevalenza
I risultati ottenuti sono riportati nelle tabelle 2, 3 e 4. Nella tabella 2 sono illustrati i risultati ottenuti in IFI per Toxoplasma
gondii utilizzando anticorpi anti IgG ed anti IgM. I positivi anti-IgM relativamente alla specie ovina sono in totale 652
pari in media al 9.50% mentre i positivi anti-IgG sono complessivamente 2048 pari in media al 29%. La percentuale di
positività media per la specie caprina è del 10.75% per le anti-IgG e del 4.10% per le anti-IgM.
Il test IFI utilizzato per Toxoplasma gondii possiede alta specificità e buona sensibilità [5].
ANNO
Ovini
Caprini
Sieri positivi IgG
Sieri positivi IgM
Sieri dubbi
1999
249
12,60%
103
5,20%
84 (4,20%)
2000
416
28,90%
122
8,40%
198 (13,70%)
2001
753
44,50%
366
21,60%
41 (2,40%)
2002
630
30,00%
61
2,90%
80 (3,80%)
Tot 2048
Media 29%
Tot 652
Media 9.5%
Tot 403 ; Media 6.00%
1999
60
12,90%
15
3,20%
20 (4,30%)
2000
46
8,30%
18
3,20%
15 (2,70%)
2001
19
5,20%
1
0,20%
10 (2,70%)
2002
177
16,60%
100
9,80%
29 (2,70%)
Tot 302
Media 10.70% Tot 134 Media 4.10%
Tot 74 ; Media 3.10%
Tabella 2 - Risultati ottenuti con l’immunofluorescenza indiretta per Toxoplasma gondii.
Dalla Tabella 3 si evince che la media delle positività in ELISA per Coxiella burnetii e pari al 9.7% per la specie ovina
e al 11.90% per la specie caprina. Il test ELISA utilizzato è specifico al 98% e sensibile al 100% [2,11].
ANNO
Ovini
Caprini
1999
2000
2001
2002
1999
2000
2001
2002
Sieri positivi
133
243
185
91
Tot 652
14
135
54
58
Tot 261
Sieri dubbi
6,70%
16,90%
10,90%
4,30%
Media 9.70%
3,00%
24,30%
14,70%
5,40%
Media 11.90%
148
58
50
46
Tot 302
13
17
7
49
Tot 86
7,50%
4,00%
2,90%
2,20%
Media 4.15%
2,80%
3,00%
1,90%
4,60%
Media 3.70%
Tabella 3- Risultati ottenuti con il test ELISA riferiti alla Coxiella burnetii.
La tabella 4 riporta i dati relativi alla sieroprevalenza per Chlamydophila abortus ottenuti mediante ELISA
“Screening”. La percentuale di positivi è risultata essere maggiore per la specie caprina (media 10.80%) rispetto
alla specie ovina (media 6%).
Al successivo esame con ELISA Chlamydophila Controlled si è avuta una riduzione del 50% di positività sia
nella specie ovina che caprina.
ANNO
Ovini
Caprini
1999
2000
2001
2002
1999
2000
2001
2002
Sieri positivi
186
90
48
116
Tot 440
44
62
24
169
Tot 299
Sieri dubbi
9,40%
6,30%
2,80%
5,50%
Media 6,00%
9,50%
11,00%
6,60%
16,00%
Media 10.80%
146
24
9
7
Tot 186
14
2
2
5
Tot 23
7,40%
1,70%
0,50%
0,30%
Media 2.50%
3,00%
0,40%
5,50%
0,50%
Media 2.25%
Tabella 4- Risultati ottenuti con il test ELISA riferiti alla Chlamydophila abortus.
PCR
I risultati ottenuti sono riportati nelle tabelle 5,6 e 7.
Dalla tabella 5 si evince che su 2421 organi ovini analizzati con primers specifici per Toxoplasma gondii sono
risultati positivi 271 pari al 11.1%. La prevalenza maggiore è stata riscontrata a carico della placenta, seguita dal
muscolo e dal cervello. Su 356 organi caprini analizzati abbiamo ottenuto una media del 6.40% di positività.
La banda di amplificazione ottenuta risulta di circa 497 bp corrispondente a quanto riportato in letteratura.
ovini
ORGANI
Campioni
esaminati
Campioni
positivi
Muscolo
496
76
caprini
Campioni
esaminati
Campioni
positivi
15,30%
80
5
6,20%
Fegato
479
34
7,00%
79
2
2,50%
IV stomaco
420
32
7,60%
63
-
-
Milza
394
24
6,00%
41
3
7,30%
Cervello
499
63
12,60%
81
7
8,60%
Placenta
133
42
31.60%
12
6
50,00%
2421
271
11.10%
356
23
6,40%
Totali
Tabella 5- Risultati ottenuti con la PCR riferiti al Toxoplasma gondii.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
197
Nella tabella 6 sono riportati i campioni positivi per Coxiella burnetii : su 1948 organi ovini e caprini esaminati
sono risultati positivi 141 (7.2%). La maggiore prevalenza di positivi è a carico della placenta .
L’amplicone di 257 bp corrisponde a quanto riportato in letteratura.
ovini
ORGANI
Campioni
esaminati
Campioni
positivi
Muscolo
344
28
Fegato
358
IV stomaco
caprini
Campioni
esaminati
Campioni
positivi
8.10%
43
-
29
8.10%
43
-
295
25
8.50%
38
-
Milza
287
21
7.30%
21
-
Cervello
353
26
7.40%
39
-
Placenta
115
10
8.70%
12
2
1.70%
Totali
1752
139
7.90%
196
2
1.00%
Tabella 6- Risultati ottenuti con la PCR riferiti alla Coxiella burnetii.
Infine nella tabella 7 sono presentati i campioni positivi per Chlamydophila abortus : su 1184 organi ovini e caprini
esaminati sono risultati positivi 26 (2.2%). La maggiore prevalenza di positivi è a carico della placenta.
La banda di amplificazione ottenuta risulta di 320 bp corrispondente a quanto riportato in letteratura.
ovini
ORGANI
Campioni
esaminati
Campioni
positivi
Muscolo
217
6
Fegato
230
IV stomaco
caprini
Campioni
esaminati
Campioni
positivi
2.80%
23
-
-
4
1.70%
23
-
-
170
3
1.80%
20
-
-
Milza
179
3
1.70%
12
-
-
Cervello
218
4
1.80%
21
-
-
Placenta
62
5
8.00%
9
1
11.80%
Totali
1076
25
2.30%
108
1
0.90%
Tabella 7- Risultati ottenuti con la PCR riferiti alla Chlamydophila abortus.
Discussione e conclusioni
L’analisi del quadro epidemiologico della campagna quadriennale, relativa agli agenti Toxoplasma gondii,
Coxiella burnetii e Chlamydophila abortus è risultato esaustivo ma non definitivo poichè abbiamo preso in
considerazione solo tre agenti abortigeni. La sieroprevalenza media in IFI per il Toxoplasma gondii è risultata
essere del 29% ma tale dato potrebbe essere sottostimato poiché si è escluso il 4.56% di risultati dubbi che una
futura sieroconversione avrebbe potuto in parte o del tutto sommare alla risultante positiva : ciò indica una
“forte” circolazione del T. gondii nei nostri allevamenti.
Le percentuali di positività sierologiche per Coxiella burnetii oscillananti tra il 9.7% e il 11.90% indicano
che seppur in misura minore tale microorganismo circola nella regione sarda. La bassa positività sierologica
per Chlamydophila abortus ha notevolmente ridimensionato il ruolo di questo agente abortigeno nel nostro
territorio. L’analisi bio-molecolare applicata ai prodotti di aborto ha evidenziato la maggiore incidenza di
infezioni attribuibili a Toxoplasma gondii; infatti l’11.1% degli organi ovini ed il 6.40% degli organi caprini
analizzati è risultato positivo. Le percentuali di positività in PCR riconducibili alla Coxiella burnetii e alla
Chlamydophila abortus oscillano dal 7.9% al 2.3% rispettivamente.
In definitiva i dati ottenuti nella campagna di aborti 1999-2002 e relativi agli agenti Toxoplasma gondii, Coxiella
burnetii e Chlamydophila abortus hanno messo in evidenza che, in Sardegna, il primato degli aborti spetta al
Toxoplasma gondii . L’obiettivo futuro è isolare e caratterizzare i ceppi di Toxoplasma gondii presenti nella nostra
isola così da differenziarli per diverso grado di patogenicità .
Questo pone due ordini di problemi:
1) di ordine igienico-sanitario in quanto Toxoplasma gondii, Coxiella burnetii e Chlamydophila abortus sono
agenti zoonosici.
198
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
2) di management aziendale perché non esiste una terapia farmacologica diretta né un vaccino utilizzabile per
Toxoplasma gondii.
A questo si aggiunge che, le misure di profilassi indiretta (derattizzazione, controllo dei vettori passivi) non
risultano di facile applicazione nelle aziende sarde.
In merito all’impiego di avanzate tecniche di biologia molecolare come la PCR per la routine diagnostica, è
lecito confermare un effettivo progresso nella specificità, sensibilità e rapidità analitica.
Bibliografia
1- Ausubel F.M., Brent R., Kingston R.E., Moore D.D. Seidan J.G., Smith A.A., Struhl K. Current protocols in molecular
biology. 1992 ; vol I. Wiley-Interscience, New York, NY.
2- Cowley R., Fernandez F., Freemantle W., Rutter D. Enzime immunoassay for Q fever: comparison with complement
fixation and immunofluorescence test and dot immunoblotting. J. Clin. Microbiol.,1992; vol. 30: pp 2451-2455.
3- Dawson M., Zaghloul A., Wilsmore A., J. Ovine enzootic abortion : experimental studies of immune responses.
Research Veterinary Science, 1986; vol. 40: 59-64.
4- Guay J.M., Dubois D., Morency M., Gagnon S., Mercier J., Levesque R. Detection of pathogenic parasite Toxoplasma
gondii by specific amplification of ribosomal sequences using comultiplex polymerase chain reaction. J. Clin. Microbiol.
1993; vol. 31: pp 203-207.
5- Marca M.C., Ramos J.J., Loste A., Saez T., Sanz M.C. Comparison of indirect immunofluorescent antibody test and
modified direct agglutination test methods for detection of Toxoplasma gondii antibodies in adult sheep in Spain. Vet.
Parassit., 1996; vol.67: pp 99-103.
6- Maurin M., Raoult D. Q fever. Clinical Microbiol., Reviews, 1999. vol 12: pp 518-553.
7- Owen M.R., Clarkson M.J., Trees A.J. Acute phase Toxoplasma abortions in sheep. Veterinary Record , 1998, 142 :
pp 480-482.
8- Palmer N.C., Kierstaed M., Key D. W. Placentitis and abortion in goat and sheep in Ontario caused by Coxiella
burnetii. Can. Vet. J., 1983, 24 : pp 60-63.
9- Sambrook J., Fritsch E.F., Maniatis T. Molecular cloning: a laboratory manual. 1989, Cold spring Harbor Laboratory,
Cold Spring Harbor, NY.
10- Sheehy N., Markey B., Gleeson M., Quinn P.J. Differentiation of Chlamydia psittaci and C. pecorum strains by
species-specific PCR. J. Clinical Microbiol.,1996, vol. 34: pp 3175-3179.
11- Soliman A.K., Botros B.A.M., Watts D.M. Evaluation of a competitive enzyme immunoassay for detection of Coxiella
burnetii antibody in animal sera. J.Clin. Microbiol.,1992; vol. 30: pp 1595-1597.
12- Stamp J.T., McEwen A.D., Watt J.A.A., Nisbett D.I. Enzootic abortion in ewes. Trasmission of the disease. Vet. Rec.,
1950 , 62: pp251-254.
13- Stein A., Raoult D. Detection of Coxiella burnetii by DNA amplification using polymerase chain reaction. J. Clin.
Microbiol.1992, vol. 30: pp 2462-2466.
14- Waldhalm D.G., Stoenner H.G., Simmons R.E., Thomas L.A. Abortion associated with Coxiella burnetii infection in
dairy goats. J. Amer. Med. Assoc. 1978, 133: pp 1580-1581.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
199
pagina bianca lasciata intenzionalmente
ATTI
SABATO 24 MAGGIO2003
RIATTIVAZIONE NATURALE DI CAPRINE HERPESVIRUS 1 (CPhv.1)
IN CAPRE CON INFEZIONE LATENTE IN SICILIA
Guercio A., Vicari D., Purpari G., Ferrantelli V., Di Marco P., Camero M., Tempesta M.
EPIDEMIOLOGIA MOLECOLARE DI STAPHYLOCOCCUS AUREUS DI ORIGINE
VETERINARIA.
Marenzoni M.L., Splendiani F. , Orso F. , Cuteri V. , Valente C.
ANAPLASMOCI E BABESIOSI DEL BOVINO, RECENTI OSSERVAZIONI
CLINICO-EPIDEMIOLOGICHE EFFETTUATE NELL’ITALIA DEL SUD
Ceci L, Carelli G., Sasanelli M., de Caprariis D., Febbraio G. Lacinio R, Greco B.
ECOGRAFIA BIDIMENSIONALE E DOPPLER DELLA MAMMELLA DI PECORA
E CAPRA: OSSERVAZIONI PERSONALI.
De Majo M., Pugliese M., Niutta P.P.
ASPETTI FARMACO-EPIDEMIOLOGICI IN MEDICINA VETERINARIA:
ESPERIENZE SUL TERRITORIO
Niutta P.P., Licitra G., Giudice E., Pugliese A.
PROTIDOGRAMMA DEL SECRETO LACRIMALE NEL BUFALO (Bubalus bubalis)
Montalbano R.M., Gruppillo A., Pugliese M., Incardona A., Di Pietro S.
ELEMENTI DI SEMIOLOGIA OCULARE NEI BUFALI
Incardona A., Di Pietro S., Montalbano R.M., Gruppillo A., Pugliese A.
UMORE ACQUEO DELL’OVINO: TRACCIATO ELETTROFORETICO.
Gargano V., Santangelo L., Domina F., Niutta P.P., Pugliese A.
XI Congresso
Internazionale
della Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
201
RIATTIVAZIONE NATURALE DI CAPRINE HERPESVIRUS 1 (CPHV.1) IN CAPRE CON
INFEZIONE LATENTE IN SICILIA
Guercio A.*, Vicari D.*, Purpari G.*, Ferrantelli V.*, Di Marco P.*, Camero M.*, Tempesta M.**
*Istituto Zooprofilattico Sperimentale della Sicilia, Palermo
** Dipartimento di Sanità e Benessere Animale, Facoltà di Medicina Veterinaria di Bari
Autore comunicante:
Vicari Domenico
Istituto Zooprofilattico Sperimentale della Sicilia, Palermo
Via Rocco Dicillo, 4
90129 Palermo Tel/fax: 091/6565243
e-mail [email protected]
Riassunto
L’infezione da Caprine Herpesvirus 1 (CpHV.1) è diffusa negli allevamenti caprini di numerosi Paesi. Indagini sierologiche
condotte in Italia meridionale riferiscono percentuali di positività oscillanti tra il 37% ed il 43%. In Sicilia, analoghe indagini
hanno dimostrato una prevalenza dell’infezione pari al 37,4%. Gli AA. hanno posto sotto osservazione un allevamento caprino
con problemi di ipofertilità e mortalità neonatale riconducibili ad infezione da CpHV.1. Per 3 mesi sono stati sottoposti a
monitoraggio 7 soggetti adulti (6 femmine, 1 maschio) sieropositivi a bassi titoli neutralizzanti verso CpHV.1. Durante il periodo
di osservazione, ogni settimana sono stati prelevati tamponi oculari, nasali, vaginali/prepuziali e prelievi di sangue per la valutazione
della cinetica anticorpale. Sui campioni è stata eseguita la PCR per la ricerca del DNA virale ed è stato tentato l’isolamento di
CpHV.1 su colture cellulari in linea continua MDBK (Madin Darby Bovine Kidney). CpHV.1 è stato evidenziato mediante PCR
da un tampone vaginale e da un tampone prepuziale prelevati in coincidenza con il periodo estrale. Dallo stesso tampone vaginale
è stato possibile isolare il virus su colture cellulari. Il ceppo virale identificato come CpHV.1, è stato sottoposto all’analisi genomica
con enzimi di restrizione per la comparazione con lo stipite di referenza italiano CpHV.1 BA.1.
Introduzione
Caprine Herpesvirus (CpHV.1) è causa di una sindrome acuta ad esito letale in capretti di 1 - 2 settimane di età, caratterizzata da
interessamento prevalente dell’apparato enterico con comparsa di grave diarrea, dolorabilità addominale, depressione del sensorio,
anoressia, ipertermia (Saito et al., 1974;Tempesta et al., 1998c). Il quadro anatomopatologico è caratterizzato dalla presenza di
lesioni ulcerativo-necrotiche a livello della mucosa intestinale. Negli adulti la malattia generalmente evolve in forma subclinica ed
interessa prevalentemente la sfera genitale e l’apparato respiratorio (Rosadio et al., 1984; Buddle et al., 1990). A carico dell’apparato
genitale si riscontrano lesioni della vulva e della mucosa vaginale e peniena: edema, iperemia, ulcerazioni (Grewal and Wells., 1982;
Horner et al., 1982). Frequenti sono gli aborti e la nascita di agnelli poco vitali.
La malattia è ampiamente diffusa nel territorio. Indagini sierologiche hanno evidenziato la presenza di CpHV.1 in numerosi Paesi,
tra cui Norvegia, Irlanda del Nord, Spagna, Siria, Turchia (Kao et al., 1985), Nuova Zelanda (Horner and Tisdall, 1985), Germania
(Muluneh and Liebermann, 1990), Grecia (Koptopoulos et al., 1988) e Italia, con una prevalenza nelle regioni meridionali pari al
35-37% (Cavalli et al., 1993; Tempesta et al., 1994; Palomba and Iovane, 1995; Foti et al., 1996; Guercio et al., 1998).
L’infezione nel gregge si manifesta con andamento ciclico e diffonde soprattutto durante la stagione degli accoppiamenti piuttosto
che all’epoca dei parti (Koptopoulos et al., 1988). In condizioni naturali, la riattivazione virale è stata osservata solo nel periodo
dell’estro (Tempesta et al., 1998a, 1998b), ma questa evenienza non si realizza facilmente né in condizioni naturali né sperimentali.
L’ipotesi che l’infezione tra gli adulti abbia luogo soprattutto per via venerea è supportata dai risultati di alcune ricerche che
evidenziano una prevalente e più duratura escrezione del virus per via vaginale o prepuziale rispetto ad altre vie di escrezione
(Tempesta et al., 1995; Buonavoglia et al., 1996).
Gli A.A. hanno ritenuto opportuno effettuare una ricerca a lungo termine in un allevamento caprino con problemi a carico
della sfera riproduttiva riconducibili ad infezione da CpHV-1 e con una diffusa positività sierologica al fine di verificare: 1) una
eventuale riattivazione naturale in soggetti con bassi titoli sierologici; 2) effettuare l’isolamento del CpHV-1; 3) effettuare l’analisi
genomica con enzimi di restrizione dell’isolato e confrontarlo con lo stipite di referenza italiano CpHV.1 BA.1.
MATERIALE E METODI
L’indagine è stata condotta in un allevamento caprino, semistabulato, in cui afferivano soggetti provenienti da differenti aziende.
L’anamnesi recente riferiva un basso indice di natalità e mortalità neonatale. In totale erano presenti 115 capi di cui 86 capre
adulte, 26 caprette e 3 becchi. La maggior parte dei soggetti erano meticci, pochi appartenevano alla razza maltese e siriana.
Al fine di conoscere la prevalenza sierologica verso CpHV.1, considerati gli alti valori riscontrati in precedenza in Sicilia (37,4%)
(Guercio et al., 1998), sono stati saggiati tutti i capi presenti in azienda. Tra i soggetti risultati positivi sono stati individuati 6 capi
(5 femmine e 1 maschio) con bassi titoli neutralizzanti, compresi tra 1:4 e 1:16. Una femmina sieronegativa è stata inserita nello
studio come controllo negativo .
Il monitoraggio dei soggetti selezionati è stato condotto nell’arco di 3 mesi, includendo nel periodo di studio la stagione dell’estro,
e precisamente da Aprile (T0) a Luglio (T13) 2002, per un totale di 13 settimane. Durante questo periodo gli animali sono stati
sottoposti settimanalmente a visita clinica e da ognuno di essi sono stati prelevati, per l’isolamento virale e per la PCR, tamponi
oculari, nasali, vaginali e prepuziali. Al termine della sperimentazione è stato fatto un controllo sierologico negli animali in
osservazione per valutare eventuali movimenti anticorpali.
Esami sierologici. Le analisi sierologiche sono state condotte mediante la tecnica della sieroneutralizzazione in micrometodo utilizzando come antigene
202
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
100TCID50 dello stipite Svizzero E/CH di CpHV.1 e cellule in linea continua MDBK (Madin Darby Bovine Kidney ) coltivate in Minimum Essential
Medium con il 10% di siero fetale bovino (Buonavoglia et al., 1996).
Esami virologici. I tamponi sono stati immersi in MEM con aggiunta di antibiotici (1000 IU/ml di penicillina, 1 mg/ml di streptomicina a 2,5 µg/ml di
amfotericina B) e siero fetale bovino al 2% per 30 minuti, e poi sono stati centrifugati per 15 min. a 2000 g a +4°C. Con il surnatante di ciascun campione
sono stati infettati monostrati confluenti di cellule MDBK. Le colture sono state tenute in osservazione per 5 gg; in assenza di effetto citopatico sono stati
effettuati altri 2 passaggi. Il virus isolato è stato identificato in base al tipico effetto citopatico e alla prova di virusneutralizzazione con un siero monospecifico
di capra per CpHV.1
PCR. La PCR è stata condotta secondo il protocollo riportato in precedenti lavori (Sagazio et al., 1998). Come DNA target è stato scelto un frammento
della lunghezza di circa 414 bp del gene che codifica per la glicoproteina C di CpHV.1.
Analisi con enzimi di restrizione. Il genoma del virus isolato è stato sottoposto ad analisi con enzimi di restrizione e comparato con il genoma dello stipite
italiano BA.1. L’analisi è stata effettuata seguendo il protocollo descritto in letteratra (Pratelli et al., 2000). Sono stati utilizzati gli enzimi BamHI, BstEII,
KpnI, NotI e PstI.
Risultati
Le visite cliniche effettuate sugli animali in osservazione non hanno mai rilevato alcuna sintomatologia ascrivibile ad infezione
da CpHV.1.
Le indagini virologiche condotte sui tamponi effettuati con cadenza settimanale, hanno dato esito positivo per CpHV.1 soltanto
in 2 dei 6 animali siero positivi rispettivamente un maschio ed una femmina, alla settima settimana di osservazione (prima decade
di giugno) in concomitanza con il periodo degli accoppiamenti. Nella femmina è risultato positivo solo il tampone vaginale sia
all’isolamento sulle colture cellulari che alla PCR. Il tampone oculare e quello nasale prelevati dallo stesso soggetto hanno dato
esito negativo. Nel maschio, invece, ha fornito esito positivo in PCR soltanto il tampone prepuziale, l’isolamento virale è risultato
negativo. Le indagini virologiche condotte sui prelievi effettuati successivamente, sino alla fine della sperimentazione, hanno
sempre fornito risultati negativi.
In Tabella 1 sono riportati gli esiti degli esami sierologici effettuati sui soggetti selezionati ad inizio ed al termine del periodo di
osservazione.
In Figura 1 è confrontato il profilo di restrizione del DNA dello stipite di CpHV.1 isolato con quello del ceppo di riferimento
BA.1.
Tabella 1
A B C D E F G H I L
Identificativo
T0
T13
Maschio n. 1
6
48
23.1 kb
Femmina n. 2
8
48
9.4
Femmina n. 3
4
96
6.6
Femmina n. 4
12
192
4.4
Femmina n. 5
6
12
2.3
Femmina n. 6
12
12
NEG
NEG
2.0
Femmina n. 7 (K neg)
Figura 1 Profilo di restrizione dei DNA dello stipite BA.1 (linee
A, C, E, G, I) e dello stipite di CpHV.1 isolato in Sicilia (linee B,
D, F, H, L) digeriti con gli enzimi di restrizione BamHI (A,B),
BstEII (C, D,), KpnI (E, F), NotI (G, H) e PstI (I, L). Come
DNA marker è stato impiegato il lambda DNAx HIndIII.
Discussione e conclusioni
Nel corso dei tre mesi (13 settimane) di osservazione nessuno degli animali oggetto di studio ha mai manifestato sintomi
clinici riferibili ad infezioni da CpHV.1. Nonostante ciò, l’indagine virologica ha fornito risultati positivi nei campioni
prelevati in corrispondenza della 7° settimana, in piena stagione degli accoppiamenti, in un tampone vaginale effettuato
da un soggetto (femmina n. 4) avente titolo sierologico 12 al T0 ed in un tampone prepuziale (maschio n. 1) avente titolo
sierologico 6 al T0. Quanto rilevato risulta in accordo con le osservazioni di altri Autori (Tempesta et al., 1998a, 1998c) che
hanno indicato una maggiore frequenza di riattivazione virale, sia in condizioni naturali che sperimentali, in soggetti con
bassi titoli neutralizzanti ed hanno ipotizzato nella fase estrale il periodo in cui più facilmente si verifica la riattivazione
naturale del virus (Koptopoulos et al., 1992; Tempesta M., et al. 2000). Il tampone vaginale della femmina n. 4 ha fornito
esito positivo sia all’isolamento su MDBK che in PCR. Il tampone prepuziale del maschio n. 1 è invece risultato positivo
soltanto in PCR. Ciò, probabilmente, è da ricondurre alla estrema labilità di CpHV.1 e conferma l’utilità di utilizzare
diverse metodiche diagnostiche complementari.
Le analisi sierologiche condotte all’inizio ed alla fine del periodo di osservazione hanno evidenziato sieroconversione in 4
soggetti su 7 in osservazione. Tuttavia la mancata comparsa dei sintomi clinici conferma che tale malattia sovente evolve in
forma subclinica. Il capo sieronegativo si è mantenuto tale sino a fine sperimentazione.
L’analisi con gli enzimi di restrizione ha permesso di evidenziare alcune piccole differenze tra lo stipite BA.1 ed il virus
isolato in Sicilia soprattutto con l’enzima KpnI. I profili di restrizione dei due virus sono apparsi sovrapponibili con
l’enzima NotI.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
203
RINGRAZIAMENTI
Si ringrazia per la collaborazione tecnica la Sig.ra Laura Russotto.
Bibliografia
Buddle B. M., Pfeffer A., Cole D. J. W., Pufford H.D., Ralston M. J. (1990). A caprine pneumonia outbreak associated with caprine
herpesvirus and Pasteurella haemolyitica respiratory infection. N. Z. Vet. J. 38, 28-31.
Buonavoglia C., Tempesta M., Cavalli A., Voigt V., Buonavoglia D., Conserva A., Corrente M. (1996). Reactivation of caprine herpesvirus
1 in latently infected goats. CIMID 19, 275-281.
Cavalli A., Voigt V., Buonavoglia D., Tempesta M., Iovane G. (1993). Anticorpi per Caprine herpesvirus 1 (CapHV-1) in allevamenti dell’
Italia del Sud. Acta Med. Veterinaria 39, 89-91.
Foti M., Orlandella B. M., Sciortino M. T., Corrado F., Medici M. A. (1996). Diffusione di anticorpi per Caprine herpesvirus-1 (CpHV-1)
in capre della Sicilia .Atti SISVET 50, 277-278.
Grewal A. S., Welles R. (1986). Vulvovaginitis of goats due to a herpesvirus. Aust. Vet. J.63, 79-82.
Guercio A., Greco A., Iannizzotto G., Di Marco V., Todaro M. (1998). Valutazione della diffusione di anticorpi anti Herpes Virus della
capra in allevamenti della Sicilia.Atti SIPAOC 12, 138-142.
Horner G. W., Day A. M. (1982). An outbreak of vulvovaginitis in goat caused by a caprine herpesvirus. N. Z. Vet. J. 30, 150152.
Horner G. W., Tisdall D. (1985). Veterinary Viral Diseases, Their Significance in South-East and Western Pacific. Ed. A. J. Della-Porta.
Sydney, Academic. Press. p 459
Kao M., Liskau T., Koptopoulos G., Papadopulos O., Horner G. W., Hyllseth B., Fadel M., Gedi A. H., Straub O. C., Ludwig H. (1985).
Immunity to herpesvirus infection of domestic animals. Report 9739. Eds P. P. Pastoret, E. Thery, J. Saliki. Brussels, Commission of the
European Communities. p 93.
Koptopoulos G., Papanastasopoulos M., Papadopoulos O., Ludwig H. (1988). The epizootology of caprine herpesvirus (BHV-6) infections
in goat populations in Greece. Comp Immun Microbiol Infect Dis 11, 199-250.
Koptopoulos G., Papanastasopoulou M., Lekkas S., Skaragas G., Papadopoulos O. (1992). CIMID 15, 235.
Palomba E., Iovane G. (1995). Indagine siero-epidemiologica sull’ infezione da CapHV-1 incapre dell’ Italia Meridionale. Atti SISVET
49, 529-530
Pratelli A., Greco G., Dall’Ara P., Engels M., Tempesta M., Buonavoglia C. (2000) Restriction endonuclease analysis of the genome of two
italian caprine herpesvirus 1 strains. Archives of Virology, 145:845-851.
Rosadio R. H., Evermann J. F., Mueller G. M. (1984). Spectrum of naturally occurring discase associated with herpesvirus infections of
goats and sheep. Agri-Practice 5, 20-27.
Sagazio P., Tempesta M., Buonavoglia D., Cirone F., Scatassa M.L., Greco G. (1998). Amplificazione del gene della glicoproteina C di
Caprine herpesvirus 1 mediante la polymerase chain reaction. Atti XIII SIPAOC 135-137.
Saito J. K., Gribble D. H., Berrios P. E. Knight H. D., and McKercher D. G (1974). A. new herpesvirus isolate from goats: preliminary
report. Am. J. Vet. Res.,35, 847-848
Tempesta M., Cavalli A.,Voigt V., Buonavoglia D. (1994). Presenza di anticorpi per Caprine herpesvirus 1 (CapHV-1) in allevamentoi
caprini dell’ Italia Meridionale. Atti SIPAOC 11, 121-122.
Tempesta M., Abdi Farah A., Cavalli A., Corrente M., Narcisi D., Buonavoglia C. (1995). Studio della riattivazione di Caprine herpesvirus
1 in capre con infezione latente. Atti SISVET 49, 531-532.
Tempesta M., Buonavoglia D., Sagazio P., Pratelli A., Buonavoglia C. (1998a). Natural reactivation of caprine herpesvirus 1 in latently
infected goats. Vet. Rec.143,200.
Tempesta M., Cavalli A., Sagazio P., De Palma M. G., Camero M., Buonavoglia C. (1998b). Infezione sperimentale di capre con caprine
herpesvirus 1. Atti 13° SIPAOC, Palermo 16-19/4/1998.
Tempesta M., Pratelli A., Buonavoglia D., Greco C. (1998c). Infezione da caprine herpesvirus 1 e mortalità neonatale in capretti. Large
animal review, 4(4), 59-62.
Tempesta M., Buonavoglia D., Greco G., Pratelli A., Normanno G., Carelli G., Buonavoglia C. (2000). 7° International Conference on
Goats, France, 15-21/5/2000.
204
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
EPIDEMIOLOGIA MOLECOLARE DI STAPHYLOCOCCUS AUREUS
DI ORIGINE VETERINARIA.
Marenzoni M.L.1, Splendiani F. 2, Orso F. 2, Cuteri V. 2, Valente C. 1
Dipartimento di Tecnologie e Biotecnologie delle Produzioni Animali, Sez. Malattie Infettive, Università di Perugia, Italy
2
Dipartimento Scienze Veterinarie, Università di Camerino, Italy
1
Riassunto
Staphylococcus aureus in medicina veterinaria è uno dei più importanti agenti patogeni responsabili di infezioni mammarie,
cutanee e contaminazioni alimentari. L’uso eccessivo degli antibiotici, nel settore veterinario, ha determinato, nell’ambito
di questo microrganismo, l’insorgenza di antibiotico-resistenza, in particolare nei confronti di meticillina.
E’ stata condotta uno studio genomico allo scopo di comparare 33 ceppi di Staphylococcus aureus, meticillino-resistenti
(MRSA) e meticillino-sensibili (MSSA), di diversa provenienza.
I ceppi sono stati analizzati secondo il metodo della macrorestrizione con SmaI risolta mediante elettroforesi pulsata
(PFGE). Degli stipiti impiegati, 15 sono stati ulteriormente analizzati per variazioni nei siti di restrizione EcoRI ed MseI,
usando la tecnica dell’Amplified Fragment Length Polymorphism (AFLP).
La PFGE ha evidenziato una similarità genomica tra 6 ceppi, 4 MRSA, di cui 2 identici e 2 strettamente correlati, e 2
MSSA risultati anch’essi strettamente correlati.
L’AFLP, una metodica più discriminante rispetto alla PFGE, ha dimostrato la grande diversità genomica di tutti i ceppi,
nonostante gli stipiti esprimessero comuni caratteristiche chimico-metaboliche.
Abstract
Staphylococcus aureus, in veterinary medicine, is one of the most important pathogen responsible of mammary and cutaneous
infections and food contaminations. The indiscriminate use of antibiotics, in the veterinary practice, has determined, in
this microrganisms, the arise of antibiotic-resistant strains, particularly against the methicillin. It was carried out a study on
the genomic similarity among 33 strains of Staphylococcus aureus, methicillin-resistant (MRSA) and methicillin-sensitive
(MSSA), of various origin. The strains have been analysed according to the method of macrorestriction SmaI resolved by
Pulsed Field Gel Electrophoresis (PFGE). 15 strains, out of the 33, has been further analyses for variations of restriction
EcoRI and MseI, using the Amplified Fragment Length Polymorphism (AFLP) technique. The PFGE has evidenced a
genomic similarity between 6 strains, 4 MRSA, 2 of which were identical and 2 closely correlated, and 2 MSSA closely
correlated too.
The AFLP, a method one more discriminating regarding the PFGE, have demonstrated the great genomic diversity of all
the strains, in spite of the common chemical-metabolic characteristics.
Introduction
The presence in veterinary medicine of methicillin-resistant Staphylococcus aureus (MRSA), is kwow since the methicillin was
introduced into clinical practice to control the infection caused by this microorganisms (Devriese, 1975). The colonizing capacity
and active moltiplication of staphylococci represent some of virulence carachters. The risk factors that contribute to diffusion of
infection are represented by slowly of recovery of some recurrent infections, by prolonged antibiotic treatment, by use of catheters
and finally by the presence of wound (Zadoks e coll., 2000).
Staphylococcus aureus is one of the most significant and widespread pathogens causing infections and it is the cause of mastitis in
dairy cows (Devriese, 1975; Zadoks e coll., 2000), in sheep and goats and is often involved in skin infections in pigs and others
animals (Scott e coll., 1988) and finally is responsible of food contaminations (Wei & Chiou, 2002).
The continuous selective pressure resulting from the extensive use of antibiotics, in order to limit the bacterial spread, causes
antibiotic-resistant bacterial strains and the appearance of resistance genes among pathogenic microrganisms (Pérez-Roth e coll.,
2001).
During the terapeutic treatment of staphylococci infections, using methicillin and β-lactamic in general, it is possible that
methicillin-resistant strains arise. MRSA are isolated from dog (Pattanayak e coll., 2000), horse and dairy cows (Wei & Chiou,
2002).
The methicillin-resistant S. aureus (MRSA) are of a remarkable interest because have a gene acquired and activated, the mecA,
which encodes the low-affinity penicillin-binding protein 2A, the PBP2A, and can work as a transpeptidase in the presence of
high concentrations of β-lactam antibiotics inactivating the four high-affinity PBPs native to S. aureus (de Jonge & Tomasz,
1993; Wei e coll., 2001). Resistance to methicillin and oxacillin, a similar antibiotic frequently used in veterinary pathology, is
usually associated to an analougus behaviour against an elevated range of antibiotics (Vos e coll., 1995) as well to compromise the
terapeutic treatment that , for as regard mastitis, represent the more efficacy methods for the control of disease.
In order to clarify the epidemiology and genetic relatedness of MRSA and to identify the strains responsible for cross-infection,
a genomic typing must be make.
The pulsed field electrophoresis is considered from many authors the gold standard for molecular typing of a wide range of
microorganisms and for many pathogen bacteria it has been demonstrated highly discriminative and comparable, if not advanced,
to other methods (Excoffier e coll., 1992; Zabeau & Vos, 1993; (Wei & Chiou, 2002).
Accurate fingerprinting techniques are required and among all the techniques, the amplified fragment length polymorphism
(AFLP) analysis, is resulted the most suitable since this assay is a PCR-based technique, which has already been demonstrated
to have a higher discriminative power in differentiating highly related bacterial strains at the infra-subspecies level (Agodi e coll.,
1999; Pattanayak e coll., 2000).
The aim of the study was to compare the sensitivity of two different molecular analysis in differentiating methicillin-resistant S.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
205
aureus (MRSA) isolated in the same breeding area among theme and from MRSA strains.
Materials and methods
Bacterial strains.
During 2001, 33 strains of Staphylococcus aureus from dairy cows with subclinical mastitis, were isolated.
The isolates were cultured on blood sheep agar and Mannitol Salt Agar (Oxoid), tested for catalase, coagulase and DNAse
and biochemically identified with Api Staph (bio Mérieux, France) and Sceptor System (Beckton Dickinson) (Cuteri e
coll., 2002).
The S. aureus used for this study are divided in MRSA and MSSA. The MSSA were 10 samples and coming from the same
breeding of MRSA.
The MRSA are 23 samples and have been isolated from the same dairy cow breeding.
Methicillin-resistance
The strains were cultured on Mueller Hinton Agar (Oxoid, Milan). Four- five single colonies were piked up and inoculated
on Trypticase Soy Broth (TSB, Oxoid, Milan) to obtain a torbidity of 0.5 McFarland in 2-8 h at 37°C. An aliquote, 0.01
ml, was diluted in 10 ml of saline solution and 3 ml were distributed on a Mueller Hinton Agar plate (Mantel, 1967).
On this plate a nitrocellulose strip containing Methicillin (E-test, Oxoid, Milano) was put on to determine the Minimum
Inihibition Concentration (MIC) expressed in µg/ml. The cultures were incubated at 35°C for 24 h and the S. aureus
strains were considered resistant (MRSA) if they show an inihibition equal or superior to 16 µg/ml.
The presence of mecA gene was put in evidence using PCR (Vos e coll., 1995).
DNA extraction was obtained with QIAmp tissue Kit (Quiagen, Hilden, Germany). The amplification of mecA gene was
conducted using the primers mecA1 (5’-AAA ATC GAT GGT AAA GGT TGG C) and mecA2 (5’- AGT TCT GCA GTA
CCG GAT TTG C) that evidence a PCR product of 533bp (Rohlf, 1993). The DNA amplification was realized following
the Ungeheuer procedure (1994).
The electrophoresis of DNA was realized on 2% of agarose gel, coloured with ethidium-bromide and photographed under
exposition of UV rays.
Pulsed-field gel electrophoresis (PFGE)
The strains were characterized using the macrorestriction method with Sma I (Celbio, Milano) resolved with pulsed
electrophoresis (Zabeau & Vos, 1993). Bacteria were grown into 10 ml di Trypticase Soy Broth (Oxoid, Milano) at 37° for
24 h, centrifuged at 2000 x g for 10 min. and the pellet obtained resuspended in PIV buffer [NaCl 1M, Tris-HCl 10mM,
pH 7.6 (Celbio-Pierce, Milano)]. An aliquote of 0.5 ml, of the last suspencion, were mixed with an equal amount of Incert
Agarose (low melting) 1% (FMC - SPA div. BIOSPA, Milano) to create the plugs. To each plug was added 1 ml of lysis
solution [Tris-HCl 10 mM, pH 7.5, NaCl 50 mM, EDTA 100 mM, pH 7.5, Na-Deoxycholate 0.2%, Na-lauroyl-sarcosina
0.5%, Lysozima 5mg/ml, Lysostaphin 25 µl/ml (Sigma-Aldrich, Milano)] and were put in incubation at 37°C for 24 h
under shaker. The lysis solution was changed with a digestion proteic buffer [EDTA 0.5 M, pH 8.0, Na-lauroyl-sarcosina
1%, Proteinase K 0.5 mg/ml (Sigma-Aldrich, Milano)] and incubated at 50°C for 48 h under shaker. The were washed
using TE [Tris HCl 10 mM, pH 7.5, EDTA 1mM, pH 8.0] e PMSF [Phenyl-methyl-sulphonyl-fluoride (Celbio, Milano)
20 mg/ml in isopropanol] and further trhee times using TE. Finally the plugs were submitted to enzymatic digestion in a
misture of steril H2O, spermidine (1 mM), SmaI 100U (Celbio, Milano) for a final volume of 250 µl, for 24 h at 25°C and
utilized for pulsed electrophoresis on 1% Fast Lane agarose gel (FMC - SPA div. BIOSPA, Milano) at 14°C in TBE buffer
(Tris-Borato EDTA, pH 8.5) autoalgorictim for 24 h. The standard used was Lambda Ladder (Biorad Lab., Hercules, Ca,
USA). The PFGE was carried out using CHEF Mapper sistem (Biorad Lab., Hercules, Ca, USA). The electrophoretic
patterns have been acquired using a telecamera (Gel-Doc 1000, Biorad Lab.) into the software Molecular Analyst Finger
Printing (Biorad) and analyzed with MA Fingerprinting programme (Biorad Lab.) to generate a dendrogram of similarity
(Zabeau & Vos, 1993).
The coefficient of similarity (SAB) were directly calculated by software. The SAB values varied from 0 to 1, where 0 showed
that patterns were not correlated and 1 that patterns were closely correlated.
Extraction of bacterial genomic DNA and AFLP assay
Bacteria grew up on Staphylococcus medium agar (Oxoid) at least 16 h at 37°C. Single colony was used to inoculate 10
ml of TSB (Oxoid) and then incubated at 37°C for 24 h. Genomic DNA was extracted according the following procedure
(Cuteri e coll., 2002). Cells were harvested from the broth cultures by centrifugation at 3000 × g for 15 min. The pellet
was re-suspended in 0.1ml of TE buffer (10 mM Tris, 1 mM EDTA, pH 8 – Sigma Aldrich, Milan, Italy) with lysozima
(5mg/ml – Sigma Aldrich, Milan, Italy) and lysostaphyn (50µl/ml of a solution 100 µg/µl – Sigma Aldrich, Milan, Italy).
The mixture was incubated for 1h at 37°C. 0.5ml of GES (guanidine thiocyanate 0.5 M, EDTA 0.1 M – Sigma Aldrich,
Milan, Italy) was added at room temperature for 10 min. Then 0.25ml of ammonium acetate 7.5 M was added and the
mixture were maintained on ice for 10min. 0.5ml of chloroform-isoamyl alcohol (24:1) (Sigma Aldrich, Milan, Italy)
was added to the suspension, mixed and centrifuged at 13000 × g for 10 min at room temperature. The upper phase was
collected and DNA was precipitated by addition of 0.7 cold isopropanol (Sigma Aldrich, Milan, Italy) and centrifuged
for 5 min at 13000 x g. The DNA was re-suspended in 0.2 ml of TE and re-precipitate with 0.5 ml of cold ethanol. DNA
sample was air dried prior of suspension in 0.5 ml of TE buffer.
DNA samples were treated with 1μl of RNAse (10 μg/ml) at 37°C for 30 min. DNA was extracted with an equal volume of
chloroform-isoamyl alcohol, vortexed and centrifuged for 5 min at 11000 x g. The upper phase was collected and a double
volume of 90 % (v/v) ethanol was added, mixed and placed at –20°C for 45 min. DNA was pelletted by centrifugation
for 10 min at 11000 × g. The DNA pellet was washed with an double volume of 70 % (v/v) ethanol and dissolved in 50
206
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
μl of TE.
The quality of the DNA was checked by electrophoresis in a 1% agarose gel containing ethidium bromide (0.5 µg/ml
– Sigma Aldrich, Milan, Italy) in 1 X TBE (89 mM Tris-HCl, 89 mM boric acid, plus 2 mM EDTA). DNA was quantified
using the DNA λ (MBI Fermentas).
The final concentration of the DNA was adjusted to 0.5 μg in 30 µl of final volume.
AFLPs have been generated according to the protocol of Keygene, Inc. (Janssen e coll., 1996; Vos e coll., 1995). Briefly,
the genomic DNA (0.5 μg) was digested with 5 U EcoRI and 5 U MseI (New England Bio Labs Inc.). For the ligation of
the adapters, 5 pmol of EcoRI adapter and 50 pmol of MseI adapter and 1 U of T4 DNA ligase (Amersham Biosciences)
were added. The primers used (Gibco BRL) in the pre-amplification step included the respective restriction enzyme and the
adapter sequence plus one extension base for each primer (A for Eco and G for Mse). The product was used as the template
for selective amplification, using primers with an extension of an additional two bases; in this case the EcoRI primer
was fluoresceine-labelled. Eight µl of modified formamide dye (98% formamide and 10 mM EDTA with bromophenol
blue) was added to the total reaction. An aliquot (6 µl) of each reaction product was heated for 5 min at 95°C and then
analyzed on 6 % denaturing polyacrylamide (19:1) gels with 7 M urea in 1 X TBE buffer. Electrophoresis was performed
at a constant power, 95 W, for approximately 2.15 h on a Genomix LR apparatus (Beckman Instruments). The same
equipment was used to obtain the fluorescent images of the gel after the run.
Data analysis
The presence/absence data from the AFLP samples were used to calculate genetic similarities for all possible pair wise
comparisons of individuals. Genetic similarities (GS) was calculated on all bands using the Dice coefficient (Dice, 1945).
The similarity matrices were subjected to a cluster analysis using the unweighted pair-group method with arithmetic
average algorithm (UPGMA). The matrix-correspondence test (Mantel, 1967) was conducted to compare the similarity
matrix with the cophenetic matrix (cophenetic correlation) to examine the goodness of dendrogram fit to the data. The
analyses were performed using the NTSYS.PC package version 1.8 (Rohlf, 1993).
The genetic structure of S. aureus strains was assessed used analysis of molecular variance, AMOVA (Excoffier e coll., 1992),
based on an Euclidean distance matrix between all pairs of multilocus phenotypes. The AMOVA was used to estimate
variance components for AFLP phenotypes and for partitioning the variation between resistant and susceptible strains
and within each ones. Significance levels for variance component estimates are computed by non-parametric permutation
procedures. AMOVA analyses were conducted with the Arlequin software (Schneider e coll., 1997).
Results
The 33 isolate of Staphylococcus aureus showed homogenous chemical-metabolic characters.
Among the 33 strains 23 were Methicillin-resistant (MRSA).
Ten MRSA strains, in which it has been verified the presence of the gene mecA using PCR in order to confirm the results
obtained with E-test and Sceptor System, and 5 MSSA strains have been submitted to PFGE.
As resulted from PFGE, the study of the genomic similarity of the different strains, visualized by dendrogram (Fig. 1), has
shown that the MRSA and MSSA strains were different.
Among MRSA, PFGE put in evidence that two strains could be consider genetically identical and others two probably
correlate.
For as regards AFLP the presence/absence data was used to generate a matrix of genetic similarities (GS) calculated by the
Dice coefficient. The average similarity for all samples was 0.4667 ± 0.239. From the GS data a cluster analysis following
the UPGMA was executed and the results were used to construct the dendrogram represented in figure 2. According
to Rohlf (1993), who consider good value of the cophenetic correlation between 0.8 and 0.9 and very good >0.9, the
goodness of our value of the cophenetic correlation (r=0.9799; P= 0.002) can be considered very good. As showed by
the dendrogram, all the samples resulted as a single genotype. At the GS level of 0.8 is possible to recognize 7 different
genotypes and 2 clusters grouping respectively others 6 and 2 genotypes.
The analysis of molecular variance (AMOVA) among strains MRSA and MSSA and within them revealed that the major
component of total variation was due to variation within strains (82.12%), while variance among strains was responsible
for 17.88% of the total variation.
Conclusion
One of the microorganisms mainly diffused in nature and responsible of diseases, both in man and animals, is Staphylococcus
aureus that often induce infections of difficult solution during therapy (Cuteri e coll., 2002).
The indiscriminate use of antibiotics has induced Staphylococcus aureus to modify its genomic structure and to produce,
from the mecA gene, a protein, PBP2a, that have low affinity for beta-lactamic antibiotics and consequently the appearance
of methicillin-resistant strains (Cuteri e coll., 2002). One of the problems to face is the choice of a method of identification
of staphylococci strains. MRSA strains are not easy identifiable not even with the international set of phagi and therefore
it has been thought opportune to replace the conventional methods with molecular biology, like the PFGE or the PCR
that using the primers mecA1 and mecA2, identifies a sequence of 533 bp, specific for MRSA strains (Perez-Roth e coll.,
20019.
Pulsed field gel electrophoresis (PFGE) carried out on the 33 strains has demonstrated a genomic differentiation among
MSSA and MRSA except for two strains that resulted indistinguishable and two probably correlate and placed the S.
aureus isolated from different animals in the same pulsotypes.
The AFLP technique consists in the DNA digestion with two restriction enzymes and restriction halfsite-specific adaptors
ligation to all restriction fragments, followed by selective amplification of these fragments with two PCR primers that
have corresponding adaptor- and restriction-site-sequences as their target sites; finally the PCR products are analysed on a
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
207
polyacrylamide gel (Cuteri e coll., 2002; Zabeau e coll., 1993).
The selectivity is obtained by the amplification of a subset of fragments only because primers contain at their 3’-end one
or more selective bases which are complementary to nucleotides flanking the restriction sites.
The low level of similarity found between different S. aureus strains implies high levels of genetic diversity. Results from
this type of phylogenetic analysis become evident when the microrganisms studied are genetically very different. While
the strains isolated from animals were collected homogeneously in a limited time period they nevertheless show a different
genomic composition. The test results do not specify if the genomic variation was correlated with the genes of virulence
and antibiotic resistance or with non-essential genes.
The same conclusion could be deduced from the AMOVA analysis of AFLP results in which the value of among-strain
variation was not very high, but significant and no differentiation between the MRSA and the MSSA strains was found.
Several factors play a role in the genetic differences of S. aureus such as the presence of many plasmids in each
strain, the conjugation transfer mechanism and the transposon-like inverted repeats flanking the esotoxin genes which
facilitates a high frequency of DNA re-arrangements.
The results of survey, also conditionated from a modest number of strains, they confirm the presence of MRSA in the
bovine and show the great genomic variability also to the inside of methicillin-resistant strains which could spread from the
animals in the environment involving other animals beyond the man.
Moreover, to demonstration of the complex somatic structure of S. aureus, an opposite behavior between the homogeneity
expressed from the chemical-metabolic analysis and the genomic inequality is found, that it represents the element that
better characterizes the bacterium.
Finally, AFLP could be considered more accurate than PFGE to obtain an epidemiological map of S. aureus in a herd.
References
Agodi A, Campanile F, Basile G, Viglianisi F, Stefani S. (1999) Phylogenetic analysis of macrorestriction fragments as
a measure of genetic relatedness in Staphylococcus aureus: the epidemiological impact of methicillin resistance. Eur. J.
Epidemiol. 15:637-642.
Cuteri V, Mazzolla R, Valente F, Merletti L, Valente C. (2002) Applicazione della elettroforesi pulsata (PFGE) a stipiti
meticillino-resistenti di Staphylococcus aureus isolati dall’uomo e dagli animali. Le infezioni in medicina 1:25-30.
de Jonge BLM, Tomasz A. (1993) Abnormal peptidoglycan produced in a methicillin-resistant strain of Staphylococcus
aureus grown in the presence of methicillin: functional role for penicillin-binding protein 2A in cell wall synthesis.
Antimicrob. Agents. Chemother. 37:342-346.
Devriese LA. (1975) Epidemiology of methicillin-resistant Sthaphylocuccus aureus in dairy herds. Res. Vet. Sci. 19:2327.
Dice LR. (1945) Measures of the amount of ecological association between species. Ecology 26:297-302.
Excoffier L, Smouse P, Quattro J. (1992) Analysis of molecular variance inferred from metric distances among DNA
haplotypes: application to human mitochondrial DNA restriction data. Genetics 131:479-491.
Janssen P, Coopman R, Huys G, Swings J, Bleeker M, Vos P, Zabeau M, Kersters K. (1996) Evaluation of the DNA
fingerprinting method AFLP as a new tool in bacterial taxonomy. Microbiology 142:1881-1893.
Mantel N. (1967) The detection of disease clustering and a generalized regression approach. Cancer Res. 27:209-220.
Pattanayak D, Srinivasan K, Mandaokar AD, Shukla A, Balla R, Kumar PA. (2000) AFLP fingerprinting and genotypic
characterization of some serovars of Bacillus thuringiensis. World. J. Micr. Biotech. 16:667-672.
Pérez-Roth E, Claverie-Martìn F, Villar J, Méndez-Alvarez S. (2001) Multiplex PCR for simulataneous identification of
Staphylococcus aureus and detection of methicillin and mupirocin resistance. J. Clin. Microbiol. 39:4037-4041.
Rohlf FJ. (1993) NTSYS.PC. Numerical taxonomy and multivariate analysis system. Version 1.8. Applied Biostatistics
Inc., New York.
Schneider S, Kueffer JM, Roessli D, Excoffier L. (1997) Arlequin Version 2.0: a software for population genetic data
analysis. Genetic and Biometry Laboratory, University of Geneva, Switzerland.
Scott GM, Thompson R, Malone-Lee J, Ridgeway GL. (1988) Cross-infection between animals and man: possible feline
transmission of Staplylococcus aureus infection in human. J. Hosp. Infect. 12:29-34.
Vos, P, Hogers R, Bleeker M, Rejans M, van de Lee T, Hornes M, Frijters A, Pot J, Peleman M, Kuiper M, Zabeau M.
(1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23:4407-4414.
Wei Wu S, de Lencastre H, Tomasz A. (2001) Recruitment of the mecA gene homologue of Staphylococcus sciuri into a
resistance determinant and expression of the resistant phenotype in Staphylococcus aureus. J. Bacteriol. 183:2417-2424.
Wei HL, Chiou CS. (2002) Molecular subtyping of Staphylococcus aureus from an outbreak associated with food handler.
Epidemiol. Infect. 128:15-20.
Zabeau M, Vos P. (1993) Selective restriction fragment amplification: a general method for DNA fingerprintings. European
Patent Application 0:534-858.
Zadoks R, van Leewen W, Barkema H, Sampimon O, Verbrugh H, Schukken YH, van Belkum A. (2000) Application of
pulsed-field gel electrophoresis and binary typing as tools in veterinary clinical microbiology and molecular epidemiologic
208
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
analysis of bovine and human Staphylococcus aureus isolates. J. Clin. Microbiol. 38:1931-1939.
Figure 1. PFGE: dendrogram of similarity
Figure 2. Dendrogram obtained from cluster analysis of the AFLP data of the 15 S. aureus strains.
MSSA strains are in red, MRSA in black
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
209
ANAPLASMOSI E BABESIOSI DEL BOVINO, RECENTI OSSERVAZIONI CLINICOEPIDEMIOLOGICHE EFFETTUATE NELL’ITALIA DEL SUD
Ceci L., Carelli G., Petazzi F., Sasanelli M., de Caprariis D., Febbraio G., Greco B., Lagrasta R., Lacinio R.
Università degli Studi di Bari , Facoltà di Medicina Veterinaria, Dipartimento di Sanità e Benessere degli Animali
Sezione di Clinica Medica, Strada per Casamassima km 3 – Valenzano (Ba) Italia
Gli autori riportano i risultati di un’indagine clinico-epidemiologica trasversale e longitudinale condotta in tre regioni
dell’Italia meridionale: Puglia, Basilicata e Calabria
Nell’ambito delle tre regioni sono state selezionate a random, in 8 distretti sanitari (AUSL), 150 allevamenti bovini; in
ciascun allevamento sono state scelte a caso 10 femmine adulte per un totale di 1500 animali. Gli animali sono stati
sottoposti a visita clinica e a prelievo di sangue.
Su tutti i campioni di sangue intero in EDTA è stato effettuato l’esame emocromocitometrico completo. Sul siero è stata indagata
la presenza di anticorpi verso Anaplasma marginale e Babesia bigemina mediante test ELISA.
Si è proceduto inoltre alla raccolta delle zecche sottoponendo a controllo il 50% degli animali campionati.
Nell’ambito dei 150 allevamenti è stato riscontrato un alto livello di infezione, con il 94.7% di positività per A.marginale e il 98%
per B.bigemina. Dei 1.500 bovini testati il 55.6% degli animali è risultato sierologicamente positivo per A. marginale e il 59.4%
per B. bigemina. L’esame emocromocitometrico ha mostrato in 365 animali (24.3%) gradi differenti di anemia.
Per effettuare lo studio epidemiologico longitudinale sono stati scelti due allevamenti di bovine da latte, denominati A e B, nei
quali negli anni precedenti erano stati riscontrati casi di anaplasmosi e/o babesiosi. La ricerca è stata condotta per 24 mesi dal
mese di maggio 1999 al mese di aprile 2001. Nei due allevamenti, situati in Puglia, costituiti da circa 140 animali ciascuno, sono
stati scelti a random 20 animali di cui 10 vitelli, tra 0 e 3 mesi di età, e 10 manze, tra 12 e 18 mesi di età. Sui 20 animali sono
stati eseguiti mensilmente, oltre al controllo clinico, gli esami ematologici, comprese le indagini microscopiche per evidenziare
eventuali emoparassiti. Sul siero è stata indagata la presenza di anticorpi verso Anaplasma marginale e Babesia bigemina mediante
test ELISA. Contemporaneamente è stata effettuata la raccolta bimensile delle zecche.
Nell’allevamento A, tra giugno e luglio 1999, 7 manze su 10 monitorate, hanno sviluppato una anaplasmosi clinica di
lieve entità, con un’anemia con valori di ematocrito (Hct) compresi tra 16,7% e 20,9%. Complessivamente nel suddetto
allevamento, nel periodo maggio 1999-aprile 2001, sono stati osservati 28 casi clinici.
Nell’allevamento B si sono verificati casi clinici di anaplasmosi, in 6 delle 10 manze monitorate, dopo il parto. Per la gravità
dei sintomi è stato necessario effettuare la terapia con tetracicline. Altri 8 casi clinici (4 anaplasmosi e 4 infezioni miste)
sono stati osservati tra gli altri animali dell’allevamento.
Nei due allevamenti sono stati riscontrati nel corso dell’indagine 42 casi clinici riconducibili alle malattie emoparassitarie.
Questi risultati indicano che l’anaplasmosi e la babesiosi del bovino rappresentano un’importante realtà clinicaepidemiologica per le regioni meridionali. L’alta prevalenza e l’alta incidenza riscontrata, probabilmente comuni a tutte
le zone temperate del Mediterraneo, devono essere tenute in debita considerazione dagli operatori del settore, sia ai fini
diagnostici, per orientare una corretta diagnosi eziologica e di conseguenza una specifica terapia, sia al fine di migliorare le
prestazioni zootecniche, attraverso opportune strategie di controllo.
BOVINE ANAPLASMOSIS AND BABESIOSIS, RECENT EPIDEMIOLOGICAL AND PATHOGENETIC
FINDINGS IN SOUTHERN ITALY
The results of a cross-sectional and longitudinal clinical and epidemiological survey are reported.
The survey was carried out in three regions of southern Italy (Apulia, Basilicata and Calabria) where 150 cow farms were
randomly selected in 8 Local Health Districts; 10 adult females were randomly chosen from each farm, thus totalling 1500
animals. Physical examination was performed on all the cows and blood samples obtained.
Complete blood cell counts were run on all the samples of whole blood kept in EDTA. ELISA tests were performed to
measure the anti-Anaplasma marginale and anti- Babesia bigemina antibodies. Fifty percent of the sampled animals were
controlled to collect ticks.
A high infection rate was found on the 150 farms with a positivity of 94.7% for A.marginale and of 98% for B.bigemina.
Of the 1500 animals tested, 55.6% exhibited seropositivity for A. marginale and 59.4% for B. bigemina. The blood tests
revealed varying degrees of anaemia in 365 (24.3%) of the animals.
Two dairy cow farms (A and B) where cases of anaplasmosis and/or babesiosis had been reported in previous years were
chosen for the longitudinal epidemiological study. The farms were located in Apulia and housed approximately 140
animals each; the study lasted 24 months, from May 1999 to April 2001. Twenty animals were randomly chosen from the
two farms: 10 calves (0-3 months old) and 10 females (12 – 18 months old). Each month, physical examinations and blood
tests were performed on the 20 animals and blood samples were examined microscopically for haemoparasites . ELISA tests
were performed to measure the serum levels of anti- Anaplasma marginale and anti- Babesia bigemina antibodies. Finally,
ticks were collected every two months.
In June-July 1999, 7 of the 10 cows monitored on farm A developed mild clinical anaplasmosis, exhibiting anaemia with
PCV values ranging from 16.7 to 20.9%. From May 1999 to April 2001, a total of 28 clinical cases were observed on the
farm amongst the monitored and non-monitored animals.
On farm B, clinical cases of anaplasmosis were observed in 6 of the 10 cows after calving. Due to the severity of symptoms,
tetracycline therapy was instituted. Other 8 clinical cases (4 with anaplasmosis and 4 with mixed infections) were reported
amongst the other cows on the farm.
A total of 42 clinical cases due to haemoparasitic disease were thus registered during the survey.
These findings suggest that bovine anaplasmosis and babesiosis are important clinical and epidemiological realities in
southern Italy. The high prevalence and incidence found are probably similar to those of other temperate regions of the
Mediterranean. They should be taken into due consideration by veterinarian practitioners and farmers alike to correctly
detect the causative agent involved and thus institute specific treatment, and also to improve productive performance
through adequate control strategies.
210
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ECOGRAFIA BIDIMENSIONALE E DOPPLER DELLA MAMMELLA DI PECORA E CAPRA:
OSSERVAZIONI PERSONALI.
De Majo M., Pugliese M., Niutta P.P.
Dipartimento di Scienze Mediche Veterinarie – Facoltà di Medicina Veterinaria – Università degli Studi di Messina.
Riassunto
Attraverso l’esame ecografico dell’apparato mammario è possibile l’esame morfologico del parenchima ghiandolare, del
seno ghiandolare, della cisterna e del canale del capezzolo; nella vacca, tale indagine, è risultata particolarmente utile nella
diagnosi di lesioni ostruttive della cisterna del latte e del canale del capezzolo. Obiettivo della nostra ricerca è stato la
valutazione ecografica e Doppler della mammella di pecora e capra in lattazione. Gli esami ecografici sono stati condotti
su cinque pecore, di razza Pinzerita, Comisana e Sarda, e cinque capre Derivate di Siria, utilizzando un Kontron Iris 440
dotato di sonda settoriale meccanica duplex di 7.5 MHz. Il parenchima mammario presenta una struttura omogenea
nella quale i dotti lattiferi appaiono come strie anecogene confluenti nel seno ghiandolare, anch’esso anecogeno con pareti
irregolari; il passaggio dalla cisterna del latte al seno del capezzolo è delimitato da pliche di tessuto aggettanti nel lume. Con
approccio caudo-craniale è risultata agevole l’esplorazione del linfonodo mammario, dell’arteria pudenda esterna, delle aa.
mammarie mediale e laterale e della vena mammaria mediana. La velocità massima sistolica, in a. mammaria, raggiunge i
50 cm/s mentre la velocità telediastolica è sui 10 cm/s; l’indice di resistività (IR) è risultato intorno a 0.60-0.70. Si ritiene
che l’esame ecografico della mammella dei piccoli ruminanti in produzione lattea possa fornire dati interessanti nella
caratterizzazione delle lesioni ma anche durante e dopo terapia specifica.
B-MODE AND DOPPLER ULTRASONOGRAPHY OF THE MAMMARY GLAND OF THE SHEEP AND
GOAT: PERSONAL OBSERVATIONS.
Summary
Udder ultrasonography makes it possible to differentiate morphological structures such as the glandular parenchyma, the
gland cistern, the teat cistern, the teat canal and the gland sinus. In the cow, this examination has proved particularly useful
in diagnosis of stenosis of the teat and the gland cistern. Our research aimed to use bi-mode and Doppler ultrasonography
to evaluate the state of the udder in sheep and goats during the lactation period. Ultrasonography was carried using a
Kontron Iris 440 equipped with a duplex mechanical sectorial 7.5 Mhz. The glandular parenchyma has a homogeneous
structure in which the milk ducts appear as anechoic bands, joining in the gland sinus, which too is anechoic and has
irregular contours. The crossing of the gland cistern to the teat sinus is bordered by small projections of tissue. From a
caudal-cranial position, it is possible to explore the mammary lymphnode, the external pudendal artery, the medial and
lateral mammary arteries and the medial mammary vein. The maximum systolic blood flow in the mammary artery is
of 50 cm/s., while the telediastoic blood flow is about 10 cm/s.; the resistivity index (RI) is between 0.60 and 0.70.We
believe that ultrasonography examination of the udder in small ruminants during the lactation period can supply useful
data for the characterization of lesions, but also during and after specific therapy.
Parole chiave: ultrasonografia, mammella, pecora, capra.
Key words: Ultrasonography, mammary gland, sheep, goat.
Introduzione
In medicina veterinaria, fondamentalmente per ragioni economiche, l’indagine ecografica e quella radiologica sono le
tecniche di diagnostica per immagini maggiormente utilizzate. L’esame ultrasonografico risponde in modo eccellente ad
alcune condizioni preminenti di scelta applicativa: non è invasivo né per il paziente che per l’operatore; è ripetibile; è
di facile applicazione pratica, in quanto non necessita di particolare predisposizione dei locali e, grazie alle attrezzature
portatili, utilizzabile anche in azienda; gli ecografi sono divenuti nel tempo sempre meno costosi rispetto ad altre
attrezzature di diagnostica per immagini.
L’ecografia (dal greco eco=suono e grafia=scrivere), sfrutta, a fini diagnostici, la registrazione degli echi ricevuti dalle
strutture di differente impedenza acustica attraversate dagli ultrasuoni; le caratteristiche dell’eco differiscono a seconda
del tipo di materia attraversata.
La prima applicazione nella storia della tecnologia ad ultrasuoni si è avuta in ambito militare, successivamente fu utilizzata
in campo civile, per misurare le profondità ed i profili dei fondali marini attraverso la registrazione dell’intensità dell’eco
riflesso, tale strumento prese il nome di sonar.
Per la produzione e la ricezione degli ultrasuoni vengono sfruttate le proprietà piezoelettriche di alcuni cristalli (quarzo,
zirconio o titanio) che hanno la capacità di entrare in vibrazione ad altissima frequenza se vengono sottoposti a determinati
impulsi elettrici. Al contempo, producono essi stessi un campo elettrico misurabile qualora vengano “urtati” dagli
ultrasuoni riflessi (echi). Di fatto, al contempo, il cristallo può funzionare da generatore e da ricevitore di ultrasuoni.
Negli animali da compagnia, l’ecografia è praticamente utilizzabile nella diagnosi di modificazioni strutturali a carico di
quasi tutti gli organi e apparati, sia nella medicina interna che nella chirurgia. Nella specie equina, la diagnosi ecografica
fa oggi parte integrante dell’esame ginecologico della cavalla e diventa sempre più importante per la diagnosi e la prognosi
delle patologie tendinee e legamentose, specialmente nei cavalli sportivi. Nella specie bovina l’ecografia è un mezzo
diagnostico essenziale nella pratica ostetrica ginecologica. Sempre in questa specie, nella vacca da latte, l’ecografia della
mammella consente l’esame morfologico del parenchima ghiandolare, del seno ghiandolare, della cisterna e del canale del
capezzolo (Cartee, 1986; Trostle, 1998; Dinc, 2000). Tale indagine è particolarmente utile, integrata all’esame clinico,
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
211
per valutare la struttura e l’estensione di un processo infiammatorio e nella identificazione di lesioni ostruttive del seno e
del canale del capezzolo (Saratsis, 1991).
Nella presente esperienza, visto che le strutture mammarie si prestano molto bene alla esplorazione ultrasonografica
e considerata la notevole importanza zooeconomica e sanitaria di tale organo anche nei piccoli ruminanti, abbiamo
effettuato l’esame ecografico della mammella nelle specie ovina e caprina.
Materiali e metodi
Gli esami ecografici, effettuati prima della mungitura del mattino, sono stati condotti su cinque pecore, di razza Pinzerita,
Comisana e Sarda, e cinque capre Derivate di Siria. Dei dieci soggetti esaminati, cinque mostravano un apparato
mammario con caratteri di normalità all’esame fisico e con normale produzione lattea, in due soggetti, con produzione
lattea assente ormai da tempo, l’esame clinico mostrava alla ispezione una notevole riduzione del volume mammario e
alla palpazione una aumentata consistenza, negli ultimi tre soggetti si evidenziava alla ispezione la presenza di formazioni
nodulari superficiali con tendenza alla fistolizzazione, l’esame di palpazione confermava la presenza di noduli profondi.
L’apparecchio utilizzato è stato un Kontron Iris 440 dotato di sonda settoriale meccanica duplex di 7.5 MHz, con zona
focale tra 4 e 7 cm, capace di una esplorazione massima fino a 10 cm di profondità; l’esame Doppler è stato condotto con
volume campione di 4 mm e filtro regolato su 50 Hz, per l’esame di flussi a bassa velocità.
Le ecografie sono state condotte sia con l’animale in stazione che in decubito laterale destro, effettuando scansioni
longitudinali e trasversali dell’organo, a partire dalla base del capezzolo e spostando la sonda verso la base della mammella.
Per l’esame del capezzolo è stato utilizzato un distanziatore al fine di portarlo nella zona focale della sonda.
Con approccio caudo-craniale è risultata agevole l’esplorazione del linfonodo mammario, delle arterie mammarie e delle
vena mammaria mediana.
L’esplorazione Doppler ha permesso la valutazione morfologica dei flussi arterioso e venoso, la misurazione della velocità
massima sistolica (Vmax sistolica) e della velocità massima diastolica (Vmax diastolica) nonché di ottenere l’indice di
resistività (IR) del flusso arterioso.
Risultati
ASPETTI ECOGRAFICI FISIOLOGICI: Il parenchima mammario presentava una struttura omogenea con echi fini,
molto simili a quelli prodotti dal parenchima epatico, in cui si identificavano piccoli dotti anecogeni che confluivano
nella cisterna mammaria (Fig.1). La cisterna del latte appariva come una cavità a pareti irregolari con pliche di tessuto
aggettanti in cavità e contenuto liquido con piccoli echi puntiformi e più o meno brillanti (Fig.2). Il passaggio tra cisterna
mammaria e seno del capezzolo veniva identificato da un anello della mucosa che si presentava come una struttura
iperecogena e che divideva le due cavità a contenuto liquido. Il capezzolo presentava uno strato esterno iperecogeno; uno
strato intermedio ipoecogeno; uno strato interno più ecogeno (Fig. 3).
Il flusso delle aa. mammarie era un flusso bifasico con un picco sistolico, più elevato e un secondo diastolico. La velocità
massima sistolica (Vmax sistolica), mediamente rilevata, è stata sui 50 cm/s e la velocità massima diastolica (Vmax
diastolica) intorno ai 10 cm/s. L’indice di resistività (IR) è risultato con valori compresi tra 0.60-0.70 (Fig. 4). In figura 5
è stato riportato il flusso della vena mammaria, caratterizzato da un segnale a bassa velocità e non pulsatile.
Il linfonodo appariva come una struttura nodulare, ipoecogena ed omogenea, con limiti ben identificabili (Fig. 6).
ASPETTI ECOGRAFICI PATOLOGICI: Nei soggetti con mastite cronica, l’aspetto del parenchima mammario
appariva disomogeneo, con maggior presenza di punti iperecogeni di dimensioni differenti riconducibili a tessuto fibroso
(Fig. 7). Contemporaneamente, per assenza di funzionalità degli acini ghiandolari, non si riscontravano né i dotti
galattofori né la cisterna mammaria. Il linfonodo presentava zone centrali iperecogene con margini che rimanevano
ancora ben identificabili. Il flusso ha mostrato un incremento della velocità diastolica e l’IR ha mostrato valori più bassi
di quelli fisiologici (Fig. 8).
In corso di mastite cronica nodulare si riscontrava una disomogeneità del parenchima per la presenza di aree iperecogene.
Sono risultate evidenti aree nodulari di differenti dimensioni, di aspetto ipoecogeno con presenza di echi interni
iperecogeni disomogenei, che erano riconducibili ad ascessi (Fig. 9).
Considerazioni e Conclusioni
L’approccio ecografico per la valutazione della mammella nella specie ovina e caprina è risultato abbastanza agevole e, la
possibilità di condurre l’esame con animale in stazione lo rende sicuramente effettuabile anche in ambito aziendale.
Il parenchima mammario possiede, in condizioni fisiologiche, una struttura che ben si presta all’esame ecografico
grazie anche al contrasto offerto dal latte all’interno della cisterna e del seno del capezzolo. Viceversa, il riscontro di
un parenchima più ecogeno e privo di dotti galattofori orienta la diagnosi verso una forma di mastite cronica con
grave compromissione funzionale a causa della sostituzione del tessuto fibroso a quello ghiandolare. Come evidenziato,
l’indagine ultrasonografica si presta in modo eccellente alla diagnosi di lesioni nodulari di tipo ascessuale situate anche in
profondità. Di buona qualità sono anche le immagini del linfonodo sopramammario e dei vasi dell’organo.
Per lo studio del capezzolo e del canale del capezzolo, si concorda con le esperienze di Franz (2001) che indica la necessità
di utilizzare sonde a frequenza molto elevata (12 MHz) previa immersione del capezzolo in acqua. Infatti l’uso di un
distanziatore, costituito nella nostra esperienza da un guanto monouso ripieno di gel, non assicura la stessa qualità
d’immagine dello studio in bagno d’acqua.
La possibilità di effettuare l’esame con animale in stazione, in un momento antecedente la mungitura, ne consente una
applicazione pratica. A tal riguardo, ovviamente sono da utilizzare attrezzature di tipo portatile dotate di sonde che, per
un buon esame del parenchima, non devono avere frequenza inferiore ai 5 MHz, meglio se di 6.5 – 7.5 MHz, di tipo
lineare o convex.
L’ecografia, per le sue caratteristiche di non invasività e di ripetibilità è un esame da considerarsi di utile applicazione nella
212
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
valutazione dell’entità ed estensione di processi patologici a carico del parenchima mammario anche nei piccoli ruminanti
in produzione lattea, come pure, potrebbe avere importanti applicazioni nella valutazione della risoluzione delle affezioni
infettive del parenchima mammario a seguito di terapia specifica.
Anche lo studio della flussimetria dei vasi mammari in diverse condizioni sia fisiologiche che patologiche potrebbe fornire
interessanti spunti di ricerca anche in medicina veterinaria.
INDICE FOTOGRAFIE
Fig. 1
Fig.2
Fig. 3
Fig. 4
Fig. 5
Fig. 6
Fig.1- Parenchima mammario: struttura omogenea con echi lineari, molto simile al parenchima epatico; i dotti galattofori si identificano
come piccole strie anecogene che confluiscono nella cisterna mammaria. Fig. 2- La cisterna appare come una struttura liquida con echi
fini corrispondenti al latte. Fig.3– Capezzolo: strato esterno iperecogeno; uno strato intermedio ipoecogeno; uno strato interno più
ecogeno. Fig. 4 - Il flusso delle aa. mammarie è un flusso bifasico con un primo picco sistolico, più elevato e un secondo diastolico.
Vmax sistolica è stata mediamente sui 50 cm/s e Vmax diastolica intorno ai 10 cm/s. L’indice di resistività (IR) è risultato con valori
compresi tra 0.60-0.70, indicativo di un flusso a bassa resistenza. Fig. 5 – Il flusso della vena mammaria è caratterizzato da un segnale
a bassa velocità. Fig. 6 – Il linfonodo sopramammario appare come una struttura nodulare, ipoecogena ed omogenea, con limiti ben
identificabili.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
213
Fig. 7
Fig. 8
Fig. 9
Fig. 7 - In corso di mastite purulenta cronica, il parenchima mammario mostra un aspetto disomogeneo, con maggior presenza di punti
iperecogeni di dimensioni differenti riconducibili a tessuto fibroso. Fig. 8 – Il flusso ha mostrato valori di IR più bassi di quelli fisiologici.
Fig. 9 - Mastite purulenta cronica con focolai nodulari asessuali: disomogeneità parenchimale per presenza di fitte aree iperecogene.
Sono evidenti aree nodulari di differenti dimensioni, di aspetto ipoecogeno con presenza di echi interni iperecogeni. Tali lesioni sono
riconducibili ad ascessi.
Bibliografia
1) CARTEE, R. E.,IBRAHIM, A.K. & MCLEARY, D. (1986) B-mode ultrasonography of the bovin udder and teat. Journal of the
American Veterinary Medical Association 188, 1284-1287
2) TROSTLE S.S., O’BRIEN R.T. (1998) Ultrasonography of the bovine mammary gland. Comp. Cont. Educ. Pract. Vet. Vol.20, pp.
S64-S71.
3) DINC D.A., SENDAG S., AYDIN I. (2000) Diagnosis of teat stenosis in dairy cattle by real time ultrasonography. Vet. Rec., Sep 2;
147(10): 270-272.
4) SARATSIS P. (1991) Diagnostic of teat stenosis in cattle using ultrasound tomography. Dtsche Tierarzti Wochenschr. Vol 98: pp.
456-458.
5) S. FRANZ, M. HOFMANN-PARISOT, W. BAUMGARTNER, G. WINDISCHBAUER, A. SUCHY, B. BAUDER (2001)
Ultrasonography of the teat canal in cows and sheep. Veterinary Record 149, 109-112
214
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Aspetti Farmaco-Epidemiologici in Medicina Veterinaria: esperienze sul territorio
ASPECT OF VETERINARY PHARMACO-EPIDEMIOLOGY: FIELD TEST
Niutta P.P., Licitra G*., De Domenico A., Pugliese A.
Dipartimento di Scienze Mediche Veterinarie – Università degli Studi di Messina
*Azienda Unità Sanitaria Locale n.7- Regione Sicilia
Riassunto
Gli Autori riportano i risultati e le considerazioni di uno studio farmaco-epidemiologico effettuato nell’area territoriale
di pertinenza del Servizio Veterinario di un’Azienda Unità Sanitaria Locale (A.U.S.L.) del Servizio Sanitario Nazionale
(S.S.N.) italiano, nell’anno 2002.
Lo scopo dello studio è stato quello di effettuare una verifica sull’impiego del farmaco negli animali da reddito, considerando:
numero delle prescrizioni; qualità/quantità dei farmaci utilizzati, in relazione alla specie animale considerata ed al gruppo
farmacologico d’appartenenza; dosaggi e durata dei trattamenti chemio-antibiotici e/o antiparassitari; tempi di sospensione;
errori e/o omissioni nell’effettuare le prescrizioni; reazioni avverse (ADRs). In base al rapporto quali/quantitativo delle
molecole utilizzate ed al rapporto animali trattati/animali presenti sul territorio è stato possibile valutare, inoltre, lo stato
sanitario del patrimonio zootecnico preso in esame.
Lo studio è stato effettuato prendendo in esame la copia delle ricette pervenute al Servizio Veterinario dell’A.U.S.L di
riferimento, a norma del decreto legislativo n° 119 e successive modifiche. Durante l’anno 2002 sono state prodotte
n.375 ricette, a fronte di un patrimonio zootecnico costituito da: n.28.653 ovi-caprini, n.13.000 suini, n.1.600 equini,
n.3.257.500 volatili.
Parole chiave: Farmaco, farmacoepidemiologia, ricetta, salute animale
Summary
The Authors report the results and considerations of a pharmaco-epidemiological study carried out in the Local Veterinary
Health Authority ( A.U.S.L. ) of National Health Service ( SSN ), in the year 2002. The aim of the study was to evaluate
control and use of veterinary drugs in food animals, considering these aspects: number of prescriptions; the type and
quantity of veterinary drugs used grouping the various products in relation to species; dosage and period of treatment for
antibiotic and/or antiparasitic drugs; withdrawal times; errors and/or omissions in making out prescriptions; reported case
of ADRs. On the basis of the quality and quantity of veterinary drugs used and the ratio of treated animals/animals present
in the area, it was possible to investigate animal health status. For the study, we used the copies of prescriptions consigned
to the AU.S.L. as required by the Legislative Decree N° 119/92 and its subsequent modifications.The total number of
prescriptions received in 2002 was 375. The numbers of animal in this year was: 28.653 sheep and goats, 13.000 swine,
1.600 equines, 3.257.500 avian species.
Key words: drugs, pharmaco-epidemiology, prescription, animal health.
Introduzione
Nell’ultimo decennio l’aumentato impiego di farmaci negli animali da reddito al fine di controllare alcune entità nosologiche
(uso terapeutico) o limitarne l’insorgenza (uso profilattico), ha reso necessario un più attento e regolamentato sistema di
controllo sul consumo di queste sostanze. Per raggiungere questo obbiettivo si è provveduto attraverso l’emanazione del
D.Lgs n. 71 del 9 aprile 2003 “Attuazione delle direttive 2000/37/CE e 2001/82/CE concernenti medicinali veterinari”, a
perfezionare il sistema di farmaco-vigilanza, modificando alcuni articoli del D.Lgs n.119 del 27 gennaio 199. In particolare,
in questo ultimo decreto vengono riportate alcune note relative alle reazioni avverse ed all’efficacia del trattamento: “i
medici veterinari ed i farmacisti devono riferire tempestivamente di eventuali effetti collaterali e di sospette diminuzioni di
efficacia di farmaci somministrati agli animali, di norma entro sei giorni lavorativi o entro tre giorni lavorativi se trattasi di
gravi effetti collaterali sugli animali e/o uomo”.
Ancora nello stesso decreto viene istituito il Sistema Nazionale di farmaco-vigilanza, avente lo scopo di raccogliere e
valutare scientificamente le informazioni utili per la vigilanza dei medicinali veterinari.
Il sistema tiene conto, inoltre, di tutte le informazioni relative alla diminuzione di efficacia dei medicinali, all’uso improprio,
alla validità dei tempi di sospensione ed agli eventuali problemi ambientali causati dall’uso dei farmaci.
Le informazioni raccolte sono correlate ai dati di vendita e prescrizione di medicinali veterinari e sono interpretate alla luce
delle linee guida emanate dalla Commissione Europea. Tale sistema fa capo al Ministero della Salute, Direzione Generale
della Sanità Pubblica Veterinaria, degli Alimenti e della Nutrizione, ed è costituito dalla stessa Direzione e dai Centri
regionali di farmaco-vigilanza.
La Direzione promuove e coordina, in collaborazione con l’Istituto Superiore di Sanità, studi e ricerche sull’utilizzazione dei
medicinali, sull’epidemiologia e predispone controlli ordinari e straordinari attraverso il prelievo di campioni dal circuito
distributivo.
La Direzione mantiene i necessari rapporti con l’Agenzia Europea per i medicinali denominata “EMEA”, con i Centri
Nazionali di farmaco-vigilanza degli altri Stati membri, con gli Organismi internazionali, con le Regioni e le Province
autonome. I Centri regionali di farmaco-vigilanza si avvalgono degli Istituti Zooprofilattici e delle Facoltà Universitarie di
Medicina Veterinaria o di altri centri specializzati.
In un sistema di farmaco-vigilanza così sviluppato, riteniamo utile ed efficace valutare la diffusione del farmaco all’interno
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
215
di una popolazione animale destinata ai fini produttivi: farmaco-epidemiologia.
Questa disciplina pur alquanto attuale in medicina umana (6; 7), in medicina veterinaria non è stata ancora completamente
riconosciuta.
Lo studio farmaco-epidemiologico è considerato un fattore indicativo della salute di una popolazione presa in esame (2; 5),
tanto più veritiero quanto più ampio risulta il campione.
Considerato che, le indagini farmacoepidemiologiche da noi effettuate nell’anno 1997, facevano emergere l’insufficienza
del numero di prescrizioni rispetto al numero di animali presenti sul territorio, nonchè la presenza di innumerevoli
errori di compilazione delle ricette (4), abbiamo voluto approfondire tale studio al fine di fornire un aggiornamento
relativo all’applicazione in campo del D.L. 119. A tale scopo abbiamo proseguito le ricerche presso la medesima Azienda
Unità Sanitaria Locale considerata precedentemente, prendendo in esame le prescrizioni relative all’anno 2002 riferite ad
ovicaprini, equini, suini e volatili.
Materiali e metodi
Nel territorio dell’ A.U.S.L. oggetto della nostra indagine il patrimonio zootecnico preso in esame contava n°28.653 ovicaprini, n°13.000 suini, n°1.600 equini, n°3.257.500 volatili.
Il numero di copie delle ricette pervenute al Servizio Veterinario, per le specie considerate, ammontava a 375; per
l’interpretazione di tali dati è stato utilizzato il software di archiviazione presente nella A.U.S.L. che ha reso possibile
estrapolare i seguenti dati: a) rapporto animali trattati/presenti; b) tipo e numero di principi attivi prescritti; c) errori di
compilazione delle ricette; d) segnalazione di reazioni avverse ai farmaci da parte dei veterinari.
Dalle categorie zootecniche presenti in archivio (Tab.1) si è proceduto alla realizzazione di categorie ristrette (Tab.1.1),
unendo in gruppo gli ovicaprini, i suini, gli equini, gli avicoli ed in “altre” le rimanenti specie.
Risultati
Nell’anno 2002, sono pervenute all’A.U.S.L. 375 ricette di cui 26 riguardavano gli ovi-caprini, 127 i suini, 92 gli equini
e 130 gli avicoli. Nella tabella 2 vengono riportati il numero di animali trattati farmacologicamente, il rapporto animali
trattati/animali presenti nel territorio.
Nelle specie considerate sono state impiegate principalmente otto classi di farmaci, ed in particolare: antibiotici, vitamine,
anestetici sedativi, analgesici/antinfiammatori, ormonali, antiparassitari, analettici respiratori, ruminativi digestivi; inoltre
sono state somministrate altre molecole: caolino, mepiramina maleato, pectina ed idrossido di alluminio.
In tabella 4 viene riportato il numero di prescrizioni raggruppate per classe di appartenenza per le diverse specie.
In tabella 4.1 il valore percentuale sul totale dei farmaci prescritti raggruppati per classe di appartenenza, che viene
rappresentato nel grafico 1.
In tabella 5 vengono riportati tutti i principi attivi che risultano prescritti nelle ricette, raggruppati per categoria farmaceutica,
in relazione alla specie trattata.
In tabella 6 vengono riportati gli errori e/o omissioni nella compilazione della ricetta.
In merito alle reazioni avverse non è risultata agli atti alcuna segnalazione.
Considerazioni e Conclusioni
Lo studio farmacoepidemiologico effettuato nell’ A.U.S.L di riferimento, consente di avere una chiara visione dell’incidenza
annuale del farmaco negli allevamenti relativamente alle specie considerate ed effettuare alcune considerazioni.
Da una valutazione comparativa con una precedente ricerca, il numero di ricette prescritte risulta discretamente aumentato:
104 nel 1997 e 375 nel 2002 (5).
Il rapporto tra il numero di animali presenti sul territorio ed il numero di ricette prescritte (per singola specie) può
rappresentare un parametro interessante per una rapida interpretazione delle prescrizioni effettuate. Nel 1997 in alcuni
dell’A.U.S.L. n°7 di Ragusa, risultava una sola ricetta per i 6.500 ovicaprini presenti, 1 per 9 equini, 1 per 475 suini, ed
1 per 3800 volatili (5), invece nel 2002 venivano registrati i seguenti dati: 1 per 1.102, 1 per 17, 1 per 102, 1 per 25.057
rispettivamente per gli ovicaprini, equini, suini e volatili. Il rapporto appena considerato potrebbe essere indicato come
“indice di prescrizione medico veterinaria”.
Per gli ovi-caprini ed i suini è stato notato un aumento considerevole nel numero delle prescrizioni, invece una diminuzione
per gli equini ed i volatili.
Questa diminuzione probabilmente, per i volatili, è da imputarsi alla tipologia di allevamento ed al numero elevato di
soggetti presenti nelle aziende avicole, dove vengono previsti trattamenti profilattici sulla quasi totalità degli animali,
utilizzando così una ricetta per un elevato numero di capi (1:25057 animali presenti sul territorio).
Il rapporto animali trattati animali presenti, confrontato con i risultati di studi precedenti non è facilmente interpretabile
(tab. 2-3).
Gli antibiotici sono risultati i farmaci più prescritti in tutte le specie; 25.23% negli ovicaprini (al pari delle vitamine)
91.67% nei volatili, 71.43% negli equini, il 52.02% nei suini. I principi attivi ad azione antibiotica somministrati agli
ovicaprini risultano appartenere a svariati classi, così come per gli avicoli, mentre nei suini si osserva la maggiore prescrizione
di specialità medicinali contenenti neomicina, seguita dalla diidrostreptomicina; quest’ultima molto utilizzata anche negli
equini, ai quali viene somministrata pure benzilpenicillina.
Le uniche prescrizioni di vitamine riguardano gli ovicaprini, così come le sostanze ormonali.
Tra i farmaci ad azione antinfiammatoria si è notata la tendenza a prescrivere FANS al posto dei glucocorticoidi, che dai
precedenti studi, risultavano maggiormente prescritti. Ancora dalla nostra indagine, risulta un discreto farmaco-uso di
antiparassitari (ivermectina e praziquantel), cosa che in passato non era stata registrata (Tab 4-4.1-5) Non sono presenti agli
atti ricette illeggibili ma gli errori di compilazione o meglio, le omissioni sono ancora numerose e riguardano in maggior
misura la “posologia e la durata del trattamento” ed i “tempi di sospensione” (Tab. 6). Verosimilmente queste omissioni
216
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
sono da imputare a scarsa cura nella compilazione delle ricette.
I campi “categoria, marca auricolare e tatuaggio, box, razza, sesso”, non sono stati presi in considerazione in quanto non
archiviati nel database; per quanto riguarda le voci “posologia e durata del trattamento” e “tempi di sospensione”, per il
calcolo delle omissioni è stato considerato errore ogni volta che alla singola specialità medicinale prescritta, non veniva
attribuita la rispettiva posologia, durata del trattamento e tempi di sospensione; i valori riscontrati possono sembrare
elevati, ma, considerata l’alta percentuale di singole ricette con prescrizione di più farmaci, tale valore risulta in modo
percentuale alle omissioni per ogni specialità prescritta (tab. 6).
Il non aver riscontrato alcuna segnalazione di effetti indesiderati da farmaco negli animali, ci porta a rimarcare le probabili
cause alla base delle mancate segnalazioni:
- scarsa sensibilizzazione alle problematiche inerenti la farmacoterapia da parte dei medici veterinari;
- difficoltà nel rilevare la causalità tra farmaco utilizzato ed effetto collaterale;
- possibili interferenze derivanti dall’utilizzo di più farmaci, contemporaneamente e non;
- mancanza di dati relativi al paziente o l’erronea interpretazione di alcuni segni clinici da parte del proprietario;
- timore del veterinario ad andare incontro a problemi burocratici o sanzioni;
- tendenza a segnalare all’informatore farmaceutico piuttosto che agli organi competenti.
Sulla base di questo fenomeno si evince la necessità e il dovere di rafforzare i controlli sul consumo di sostanze farmacologiche
in animali adibiti a produzioni zootecniche coinvolgendo le Autorità Sanitarie.
Per far ciò è necessario trovare strategie d’intervento a costi contenuti, per incrementare le segnalazioni senza, di conseguenza,
aumentare quelle false positive così come è stato fatto in Medicina Umana (1).
Riteniamo utile promuovere approfondimenti scientifici riguardo la farmacoepidemiologia, la farmacovigilanza ed il
corretto uso dei farmaci che rappresentano gli strumenti attraverso i quali è possibile valutare costantemente il rapporto
rischio-beneficio, garantendo così la sicurezza sull’utilizzazione del farmaco veterinario, supportando permanentemente i
Medici Veterinari attraverso un’educazione sanitaria continua che, rafforzando l’informazione, dia al farmaco la doverosa
importanza.
Sarebbe inoltre opportuno istituire una “cabina di regia” che funga da osservatorio farmaco epidemiologico capace di
monitorare costantemente i principi attivi somministrati agli animali da reddito presenti sul territorio, permettendo ,nel
tempo, una efficacie comparazione dei dati sviluppati atta a valutare in maniera approfondita l’utilizzo del farmaco sugli
animali da reddito che ricordiamo, quasi ogni giorno, ci troviamo sulla tavola sotto forma di carne o derivati.
Bibliografia
1 Caputi A. P. et al., (1997) “Le reazioni avverse ai farmaci: segnalazioni e sistemi di sorveglianza del Ministero della
Sanità” Professione Sanità Pubblica e Medicina Pratica. Anno 4 n° 2: 6-11;
2 Chauvin C. et al. (2002) “Pharmaco-epidemiology and economics should be developed more extensively in veterinary
medicine”. J. vet. Pharmacol. Therap. 25, 455-459. 2002;
3 Lawson D.H. (1984) “Pharmacoepidemiology: a new discipline”. Medical Jurnal. 289, 940-941.1984;
4 Pugliese et al. (1999) “Farmaco-epidemiologia in una ASL del SSN” 2° Congresso Nazionale della Società Italiana
di Diagnostica di Laboratorio Veterinaria (S.I.Di.L.V.) e 1° Congresso Nazionale dell’Associazione Italiana di
Epidemiologia Veterinaria;
5 Pugliese et al. (2000) “Pharmacoepidemiology in sicilian local health authority (ASL) 8th International Congress
Mediterranean Federation for Health and Production of Ruminants (Fe.Me.S.P.Rum.);
6 Scott D.M. & Pedersen,C.A. (2000) An outcome research (pharmacoeconomics/pharmacoepidemiology) course for
pharmD students. American Journal of Pharmaceutical Education. 64, 114-115;
7 Vray, M., Szafir, D., Jallion, P. & les participants à la table ronde , n°3 del Giens XVI (2001) Pharmaco-épidémiologie:
identification des besoins, bases de données, critères de qualità des études. Thérapie. 56, 349-353;
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
217
TABELLE
�����
CATEGORIE ZOOTECNICHE
AGNELLI
AGNELLONI
ANATRE
API
ASINI
ARIETI
ANGUILLE
BECCHI
BROILER (POLLI)
CAPRE
CINGHIALI
CANI
CAPRETTI/CAPRETTONI
CAVALLI
FARAONE
FAGIANI
GALLINE OVAIOLE
GALLETTI
GRASSI
GATTI
LATTONZOLI
MAGRONI
MAGRONCELLI
MONTONI
MULI/BARDOTTI
CASTRATI
ORATE
PECORE
PICCIONI
PESCI
PULEDRI
QUAGLIE
SCROFE
SCROFETTE
SPIGOLE
STRUZZI
SUINETTI
TACCHINI
UOVA DI MUGGINE
VERRI
COD
AG
AL
AN
AP
AS
AT
AU
BE
BR
CA
CI
CN
CP
CV
FA
FG
GA
GL
GR
GT
LA
MA
MG
MO
MU
OC
OR
PE
PI
PS
PU
QU
SC
SF
SP
ST
SU
TA
UM
VE
CAT. RISTRETTA
OV
OV
VO
ALTRE
EQ
OV
ALTRE
OV
VO
OV
SD
ALTRE
OV
EQ
VO
VO
VO
VO
SD
ALTRE
SD
SD
SD
OV
EQ
OV
ALTRE
OV
VO
ALTRE
EQ
VO
SD
SD
ALTRE
VO
SD
AV
ALTRE
SD
���� ���
OVI-CAPRINI
VOLATILI
EQ
EQUIDI
SD
SUINI
ALTRE ALTRE
OV
VO
218
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
�
Tab.2 ������ ����
TOTALE RICETTE 2002
TOTALE ANIMALI NEL
TERRITORIO
TOTALE ANIM. TRATTATI
RAPPORTO % ANIMALI
TRATTATI/PRESENTI
375
Tab.3 ������ ���� ���
TOTALE RICETTE
TOTALE ANIMALI NEL
TERRITORIO
RAPPORTO % ANIMALI
TRATTATI/PRESENTI
104
OVICAPRINI
26
SUINI EQUINI AVICOLI
127
92
130
�����
�����
����
�������
2041
2308
221
2198680
7,12
17,75
13,81
67,5
OVICAPRINI
1
SUINI EQUINI AVICOLI
12
40
10
6500
5700
363
38000
-
1,8
33,6
15,6
Tab. 4
N° PRESCRIZIONI PER
CLASSE
FARMACOLOGICA
�����������
��������
���������� ��������
�����������
���������������
��������
�����
���������������
����������
�����������
���������� ���������
% sul totale dei farmaci
prescritti
�����������
��������
���������� ��������
�����������
���������������
��������
�����
���������������
����������
�����������
���������� ���������
OVI
SUINI EQUINI AVICOLI
CAPRINI
28
28
18
103
85
17
4
12
25
15
10
7
3
17
34
15
3
2
22
2
2
Tab. 4.1
OVISUINI EQUINI AVICOLI
CAPRINI
25,23
52,02
71,43
91,67
25,23
16,22
8,59
3,36
10,81
9,01
6,31
2,7
12,63
2,7
1,8
1,01
8,59
17,17
12,61
8,33
12,61
�
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
219
Tab. 5
CATEGORIA FARMACEUTICA
OVI
PRINCIPIO ATTIVO
CAPRINI
ANTIBIOTICI
��������� �������
�
SUINI
EQUINI AVICOLI
��
�
�
���������������� ����������
�
�
�
�
������������������� �������
�
��
��
�
�����������������
������������
�
�
�
�
��
�
�
�
������������
�
�
�
�
�������� ����
����������� � ��������
�
�
�
�
�
�
�
�
����������������
�
�
�
�
����������������
����������� ����������
�
�
�
�
�
�
�
�
�������������� ����������
�
�
�
�
������������� �������
�
�
�
�
������������������� ����
������������ ����������
�
�
�
�
�
�
�
�
��������� �������
�
�
�
�
����������� � ���������
�
�
�
�
ANALGESICI + ANTINFIAMMATORI
������������� ������
�
��
��������
�
�
��������
�
�
�������������� ����������
�
�
�
�
�
�
�
�
�
�
ANTIPARASSITARI
������������
�
�����������
�
��
��
�
��
�
�
�������� ��
�������� �
�����������
�������� �
������������
�������� ���
VITAMINE
�
�
�
�
��
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
������������ ����
������������
ORMONALI
�
�
�
�
�
�
�
�
�
�
�
�
����������
�
220
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Tab. 5
OVI
CATEGORIA FARMACEUTICA
CAPRINI
PRINCIPIO ATTIVO
ANESTETICI SEDATIVI
SUINI
EQUINI AVICOLI
����������
��
��
�
�
��������� ����������
�
�
�
�
���������� ����������
�
�
�
�
�
�
�
RUMINATIVI - DIGESTIVI
�������������������
�
ANALETTICI RESP�
�������� ����������
�
�
�
�
������������
�
�
�
�
�������
�
�
�
�
���������� ������
�
��
�
�
�������
�
�
�
�
��������� �� ��������� �������
�
�
�
�
ALTRI
GRAFICO 1
� ����� ������ �� ������� ����������� ��� ������ ��� ������� ����������� ����� ������ ������������
��������
��������������������������
�����
���������� �����������
�����������
���������� ��������
��������
���������������
���������� ���������
����
���
���
���
���
���
���
���
���
���
��
�����������
�����
������
�������
�
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
221
Tab. 6
VOCI ERRATE/OMESSE NELLA
%
COMPILAZIONE DELLA RICETTA
CATEGORIA
*
CONFEZIONE/QUANTITA'
1.64
MARCA AURICOLARE E TATUAGGIO BOX
*
NUMERO ANIMALI
4.5
POSOLOGIA E DURATA DEL TRATTAMENTO 177.64**
RAZZA
*
RICETTE ILLEGIBILI
0
SESSO
*
SPECIE
4.43
TEMPI DI SOSPENSIONE
82.5***
N.B. il totale degli errori è stato calcolato sul totale delle ricette pervenute, di tutte le specie animali.
* non sono stati presi in considerazione, in quanto non presenti nel database
** Per il calcolo delle omissioni è stato considerato errore ogni volta che al singolo farmaco non veniva attribuita la posologia
e la durata del trattamento, il valore può sembrare elevato, ma se si considera l’alta percentuale di singole ricette con
prescrizione di più farmaci, tale valore risulta in modo percentuale alle omissioni per ogni farmaco prescritto.
*** Per il calcolo delle omissioni è stato considerato errore ogni volta che al singolo farmaco non veniva attribuito il relativo
tempo di sospensione, il valore può sembrare elevato, ma se si considera l’alta percentuale di singole ricette con prescrizione
di più farmaci, tale valore risulta in modo percentuale alle omissioni per ogni farmaco prescritto.
���� �
INDICE DI PRESCRIZIONE MEDICO VETERINARIA
Ragusa-1997 (5)
TOT N° ANIMALI TOT N° RICETTE RAPPORTO
OVI-CAPRINI
6500
1
6500
EQUINI
363
40
9
SUINI
5700
12
475
VOLATILI
38000
10
3800
���� �
INDICE DI PRESCRIZIONE MEDICO VETERINARIA
Ragusa 2002
TOT N° ANIMALI TOT N° RICETTE RAPPORTO
OVI-CAPRINI
28653
26
1102,04
EQUINI
1600
92
17,39
SUINI
13000
127
102,36
VOLATILI
3257500
130
25057,69
��
222
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
PROTIDOGRAMMA DEL SECRETO LACRIMALE NEL BUFALO (Bubalus bubalis)
TEAR PROTEIN ELECTROPHORESIS OF BUFFALO (Bubalus bubalis)
Montalbano R.M., Gruppillo A., Pugliese M., Incardona A., Di Pietro S.
Dipartimento di Scienze Mediche Veterinarie, Università di Messina
Parole chiave: elettroforesi; lacrime; bufalo
Key words: electrophoresis; tear; buffalo
Riassunto
La prima linea di difesa dell’occhio nei confronti di patogeni esogeni, è rappresentata dalle numerose componenti della
frazione proteica lacrimale. Tali componenti sono infatti in grado di esercitare un’azione antibatterica sia specifica che
aspecifica, rispettivamente Ig, Lisozima e Lattoferrina. Considerato l’importante ruolo che tali sostanze svolgono nel
mantenere l’integrità anatomo-funzionale dell’apparato visivo, in particolare della cornea e della congiuntiva, abbiamo
ritenuto interessante valutare in questo studio l’assetto proteico lacrimale di bufali, allo scopo di ottenere dei parametri
fisiologici di riferimento. Lo studio è stato condotto su 15 femmine di bufalo, allevate presso l’azienda Velo di Torregrotta
(Me), di età compresa tra 6 e 11 anni.
Il campione lacrimale, prelevato da entrambi gli occhi, è stato sottoposto ad elettroforesi in gel d’agaroso per la separazione,
l’identificazione e la quantificazione delle singole frazioni proteiche. In particolare, sono state determinate specificatamente
albumina, lattoferrina ed immunoglobuline; la migrazione proteica ha inoltre permesso di individuare sulla striscia di gel
ulteriori bande, verosimilmente correlate alla presenza di frazioni proteiche con peso molecolare diverso.
Summary
The first kinds of the ocular defence against the external pathological agents are the numerous portions of the protein
fractions present in the tear fluid. They, in fact, are able to show a specific and a no specific antimicrobial activity with
Ig, lisozime and lactoferrin. These substances play a very important role to maintain the anatomic-functional integrity of
the eye, particularly of the cornea and the conjunctiva. So we considered very interesting to evaluate in this study the tear
protein pattern of the buffalo, with the aim to obtain the reference physiological parameters. The study is performed on 15
buffalos, females, with age ranged from 6 to 11 years, reared at the Velo’s farm in Torregrotta (Me), Italy. The tear sample,
token on both eyes, is subjected to the agarose gel electrophoresis to obtain the separation, the identification and the
amount of every protein fractions. Particularly, albumin, lactoferrin and immunoglobulin are determined; the migration
of the tear protein allowed to identify other bands on the gel’s strip, correlated probably to the presence of the protein
fractions with different molecular weight.
Introduzione
Nel corso degli ultimi anni l’allevamento del bufalo in Italia ha registrato una notevole espansione, raggiungendo livelli
considerevoli soprattutto nei territori del centro-sud, con una concentrazione massima di aziende (95%) in Campania e
Lazio (dati ISTAT 1995) (4). Il patrimonio bufalino nazionale, infatti, è divenuto una sicura fonte economica alternativa
alle attività industriali e zootecniche; la bufala mediterranea italiana viene allevata principalmente per la produzione del
latte, dal quale vengono ottenuti diversi prodotti della trasformazione, primo fra tutti la mozzarella. Accanto alla filiera del
latte si sta affermando sempre più anche la produzione della carne di bufala, che sembra, in prospettiva, offrire interessanti
sviluppi commerciale (4). Le conoscenze scientifiche su questa specie animale sono state effettuate in gran parte in paesi
tropicali (Asia ed Egitto) ma è con una certa prudenza che le conoscenze acquisite in questi paesi possono essere trasferite
alla realtà italiana, considerato che il bufalo mediterraneo, seppur simile costituzionalmente alle razze orientali, è sottoposto
a differenti condizioni ambientali e di management aziendale (2, 8, 9, 12).
L’aumentato interesse nei confronti del bufalo ha comportato un impegno sempre maggiore nell’ambito della medicina
specialistica, negli ultimi anni, infatti, sono state condotte numerose ricerche sul bufalo mediterraneo, relative all’assetto
ematologico ed ematochimico per lo studio patogenetico di determinate malattie infettive che possono interessare la specie,
nonché sull’assetto endocrino-metabolico, al fine di meglio definire alcune peculiarità metaboliche della razza (2,3,8,9,12) .
Tuttavia, scarse risultano in letteratura le indagini riguardanti le peculiarità morfo-strutturali e funzionali dell’apparato oculare
del bufalo mediterraneo e le poche ricerche prodotte riguardano esclusivamente le specie allevate nei paesi tropicali.
Nell’ambito di un progetto di ricerca volto a valutare le caratteristiche anatomo-funzionali dei diversi distretti oculari
nel bufalo mediterraneo (Bubalus bubalis); in questa nota, l’attenzione viene rivolta allo studio dei meccanismi difensivi
dell’occhio, organo a diretto contatto con l’ambiente esterno e come tale coinvolto in diversi processi infettivi. Più
specificatamente, obiettivo della presente indagine è studiare l’assetto proteico lacrimale della specie bufalina, il cui ruolo
difensivo contro la crescita e la diffusione di patogeni sulla superficie oculare risulta di grande importanza ai fini della
prevenzione di alcune malattie.
Materiali e metodi
Lo studio è stato condotto su 16 bufali, 11 femmine adulte di età compresa tra 6 e 11 anni, e 5 vitelli, 3 femmine e 2
maschi, di circa 2 mesi di età. Gli animali venivano allevati allo stato semibrado, in ambiente confinato, presso un’azienda
ubicata nella provincia di Messina, con indirizzo produttivo di latte destinato alla trasformazione. Al momento dell’esame
tutti gli animali, in buone condizioni di salute, non presentavano a livello dell’apparato oculare alcun sintomo clinico
riferibile a patologie specifiche né a lesioni secondarie a malattie sistemiche, come evidenziato dalla visita specialistica
condotta sul campione in oggetto. Introdotti all’interno di un travaglio, previa contenzione della testa con l’ausilio di
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
223
corde, su ciascun soggetto veniva effettuato il prelievo di circa 30 µl di lacrime, utilizzando una pipetta munita di puntale
posta a livello del sacco congiuntivale ventrale di ciascun occhio, tangenzialmente alla mucosa stessa. Il materiale prelevato,
posto in provette Eppendorf, veniva trasportato in laboratorio, per essere congelato fino all’espletamento dell’esame per
la valutazione del pool proteico lacrimale. Sul fluido lacrimale scongelato veniva eseguito l’esame spettrofotometrico per
valutarne il contenuto proteico medio e, successivamente, veniva effettuata l’indagine elettroforetica (FastRep Helena®) al
fine di discriminare e quantificare le singole frazioni proteiche contenute nel liquido lacrimale. La migrazione anodica su
piastra in gel d’agaroso, dopo colorazione della striscia con blu di metilene, permetteva di individuare le proteine lacrimali
sotto forma di bande a diversa intensità cromatica; il tracciato elettroforetico utilizzato come campione di riferimento
era il siero ematico ottenuto dagli stessi animali. Attraverso lo studio del grafico relativo a ciascuna migrazione foretica è
stato possibile ottenere la concentrazione media (± la deviazione standard) delle singole proteine identificate sulla striscia,
espressa in percentuale rispetto alla quantità totale di proteine contenute nel fluido lacrimale. I dati quantitativi delle
singole componenti proteiche sono stati analizzati statisticamente attraverso la valutazione del test t di Student, prendendo
in esame le differenze eventualmente esistenti tra soggetti di età diversa, adulti e vitelli rispettivamente, e considerando
statisticamente significativi i valori con p<0.05.
Risultati
La migrazione su striscia in gel d’agaroso ha permesso di identificare diverse bande con intensità cromatica variabile,
corrispondenti ad altrettante frazioni proteiche contenute nel campione lacrimale in esame (Fig.n°1); nella Fig. n°2 viene
riportato un grafico “tipo” relativo alla migrazione elettroforetica delle proteine lacrimali di bufalo, nel quale viene indicata
la concentrazione media di ogni frazione proteica, espressa in percentuale sul valore proteico totale, che per tale specie
animale è stato calcolato in 7 g/dl. Attraverso il confronto tra il tracciato foretico lacrimale e quello sierico di riferimento è
stato possibile individuare la banda cromatica relativa alla migrazione dell’albumina lacrimale, che essendo di derivazione
sierica, assume la medesima posizione sulla striscia di gel in entrambi i campioni.
La frazione albuminica è presente nella concentrazione di 6,42±4,36% (media +/- deviazione standard) e si presenta sulla
striscia sotto forma di una banda cromatica debolmente colorata, individuabile a livello della parte anodica della stessa.
In prossimità della porzione apicale corrispondente all’anodo vengono evidenziate deboli bande di colore blu, in numero
variabile da due a tre nei diversi soggetti, corrispondenti a proteine a basso peso molecolare e carica elettrica negativa,
indicate come proteine acidiche a migrazione rapida (PMR); la concentrazione media di queste frazioni proteiche si attesta
intorno a valori di 2,29±2%. Tra queste bande viene individuata la frazione leggera della lattoferrina. Tali frazioni proteiche
risultano assenti nei tracciati lacrimali relativi ai soggetti giovani.
Proseguendo nell’esame della striscia elettroforetica, è possibile evidenziare una netta banda cromatica localizzata in
corrispondenza dell’estremità anodica dell’ampia zona di migrazione delle globuline, le cui caratteristiche fanno ipotizzare
si tratti con ogni probabilità della frazione ad elevato peso molecolare della lattoferrina, con una concentrazione media nei
soggetti esaminati di 1,88±7,56%.
In prossimità del punto di semina del campione lacrimale, da entrambi i lati, in direzione anodica e catodica è stata
evidenziata un’ampia zona di migrazione proteica caratterizzata da bande ipercromatiche. Dalla comparazione con
il siero di riferimento viene identificata zona relativa alla migrazione delle globuline con una concentrazione media di
71,89±6,86%.
Nel tracciato elettroforetico lacrimale del bufalo non viene messa in evidenza, in prossimità del polo catodico della striscia
di gel, la banda riferibile al lisozima.
Inoltre dall’analisi dei dati ottenuti non è stata evidenziata alcuna differenza statisticamente significativa tra le diverse
componenti proteiche lacrimali esaminate nei bufali adulti e nei vitelli, eccezion fatta per le proteine a migrazione rapida,
che risultavano assenti nei soggetti giovani, presentando una differenza statistica altamente significativa ( p ≤ 0,01).
Siero
LT pes.
ALB
PMR LT. Legg
Lacrime
GLOBULINE
Fig. n°1 – Striscia di gel: migrazione elettroforetica di siero e lacrime di bufalo
224
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Fig. n°2 - Grafico tipo relativo alla migrazione elettroforetica di lacrime di bufalo
Considerazioni e Conclusioni
Dall’analisi dei protidogrammi lacrimali effettuati negli animali oggetto del presente studio si evince che il pattern proteico
lacrimale del bufalo presenta delle differenze significative in relazione all’età dei soggetti esaminati. In particolare, nei vitelli
non sono state individuate le bande cromatiche corrispondenti alle proteine a migrazione rapida . In accordo con i dati
bibliografici l’assenza di tali frazioni potrebbe essere spiegata con una comparsa tardiva di tali sostanze a livello del secreto
lacrimale. Difatti alla nascita le lacrime contengono quasi esclusivamente proteine sieriche e soltanto in seguito compaiono
le proteine secrete dalle ghiandole lacrimali (10). Questo fenomeno potrebbe comportare una aumentata sensibilità del
segmento oculare esterno dei vitelli rispetto agli adulti..
Relativamente alla lattoferrina, suddivisa in due porzioni con caratteristiche biochimiche differenti, la concentrazione
totale elevata riscontrata testimonia l’importanza di tale molecola nella protezione aspecifica della superficie oculare, in
quanto è in grado di effettuare una ’intensa attività batteriostatica e battericida (1, 7, 10, 11).
Il mancato riscontro sul tracciato elettroforetico del lisozima, lascia presagire un’azione protettiva vicariante della lattoferrina,
supportata da altre sostanze proteiche presenti nel fluido lacrimale quali transferrina, ceruloplasmina, α1-antitripsina, α1amilasi e α2-macroglobulina, che conferiscono all’occhio un’ulteriore attività difensiva di tipo non immunitario, attraverso
meccanismi enzimatici o di deplezione di ioni metallici (5,6).
La standardizzazione di mappe proteiche lacrimali riproducibili potrebbe consentire di individuare processi patologici a carico
del segmento oculare esterno, in quanto alcune affezioni di questo distretto determinano variazioni nella concentrazione
proteica lacrimale che si traducono in modificazioni del tracciato elettroforetico con incremento, diminuzione o scomparsa
di una o più bande cromatiche, in relazione all’interessamento di una o più categorie proteiche. È innegabile, quindi che
attraverso questo sistema di indagine, sia possibile effettuare uno studio patogenetico di alcune entità nosologiche che
colpiscono l’apparato oculare e che prevedono nel loro determinismo anche variazioni qualitative e quantitative del pool
proteico lacrimale.
Ne deriva l’importanza dello studio dell’apparato oculare anche in questa specie animale, con particolare attenzione ai
meccanismi difensivi di tale organo, nell’ottica di salvaguardare la salute animale in ogni suo aspetto, non tralasciando
quello economico, considerato che l’allevamento bufalino, come altri comparti del settore zootecnico, tende ad ottenere
elevati livelli di qualità e salubrità dei prodotti aziendali, che risultano imprescindibili da una condizione clinica ottimale
del singolo individuo.
In conclusione, i risultati della presente indagine forniscono, a nostro parere, dei valori di base relativi alla composizione
proteica delle lacrime di bufali clinicamente sani. Tali valori, considerati i modesti riferimenti bibliografici sull’argomento,
possono essere indicati come parametri di riferimento per una valutazione quali-quantitativa dell’assetto proteico lacrimale
nella specie in oggetto. Sulla base di quanto detto non è possibile escludere che le modificazioni del contenuto proteico
lacrimale potrebbero svolgere un ruolo di indicatore precoce dello stato clinico dell’apparato oculare; infatti, attraverso la
comparazione di tracciati lacrimali fisiologici e patologici potremmo identificare eventuali correlazioni tra modificazioni
proteiche ed evoluzione della malattia in atto. Inquadrata in quest’ottica, l’esecuzione di protidogrammi lacrimali può
rappresentare un valido ausilio nella diagnosi precoce, nella prognosi e nel follow-up terapeutico delle lesioni del segmento
oculare esterno.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
225
--Bibliografia
1)
Banyard M.R.C. & McKenzie H.A., The fractionation and characterization of bovine tear proteins, especially lactoferrin,
Molecular and Cellular Biochemistry, 47:115-124, 1982.
2) Bertoni G., Lombardelli R., Piccioli Capelli F., Bartucci F., Amici A., Agricoltura e Ricerca 153, 87-98, 1994a.
3) Ciaramella P., De Luna R., Aspetti di patologia metabolico-nutrizionale nel bufalo, Atti V Congresso FeMeSPRum, Ozzano
Emilia, pp.51-64, 1997.
4) Galero G., Finalmente il Centro di Referenza Nazionale per la bufala, Bubalus bubalis II, 2002, pp.27-30.
5) Gionfriddo J.R., Davidson H., Asem E.K., Krohne S.G., Detection of lysozime in llama, sheep and cattle tears, AmJVetRes,
vol.61(10), pp.1294-1297, 2000.
6) Gionfriddo J.R., Melgarejo T., Morrison E.A., Alinovi C.A., Asem E.K., Krohne S.G., Comparison of tear proteins of llamas
and cattle, AmJVetRes, vol.61(10), pp.1289-1293, 2000.
7) Kijlstra A., Kuizenga A., Van Der Velde M., Van Haeringen N.J., Gel electrophoresis of human tears reveals various form of
tear lactoferrin, Curr Eye Res, 8(6):581-8, 1989.
8) Oliva G., Tranquillo A., Persechino A., Acta Med Vet 35, 207-217, 1989.
9) Persechino A., Oliva G., De Luna R., D’Amore L., Acta Med Vet 35, 219-228, 1989
10) Steindler P., Il sistema lacrimale – Fabiano Editore, pp.44-54, 2000.
11) Yu R.H., Schryvers A.B., Bacterial lactoferrin receptors: insights from characterizing the Moraxella bovis receptors, Biochem
Cell Biol, 80(1):81-90, 2002.
12) Zicarelli L., Avallone L., Salvatore M., Pizzuti G.P. Comportamento di alcune costanti ematiche nella bufala in gravidanza e
lattazione, Atti SISVET 40, 569-572, 1986.
226
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ELEMENTI DI SEMIOLOGIA OCULARE NEI BUFALI
Ocular semeiology in the buffalo
Incardona A., Di Pietro S., Montalbano R.M., Gruppillo A., Pugliese A.
Dipartimento di Scienze Mediche Veterinarie – Università di Messina
Parole chiave: semiologia; occhio; bufali
Key words: semiology; eye; buffalo
Riassunto
Nell’ambito della medicina degli animali da reddito, a differenza di quanto avviene per gli animali da compagnia, l’interesse
per le affezioni oculari è piuttosto limitato in quanto subordinato all’impatto economico sia individuale, come nel caso
dell’epitelioma spinocellulare, sia collettivo, cheratocongiuntive infettiva. Però l’occhio con i suoi annessi rappresenta
una struttura relativamente facile da esaminare ed i quadri patologici che si possono riscontrare rappresentano spesso
un prezioso aiuto nella diagnosi di numerose patologie a carattere generale o più specificatamente in quelle alterazioni
del sistema nervoso che possono avere ripercussioni anche sull’apparato oculare. Sulla base di quanto affermato risulta
importante condurre frequenti visite dell’apparato oculare anche in questi animali da reddito. Nel presente lavoro gli
Autori riportano i risultati di esami oftalmologici condotti su 10 bufale di sesso femminile, di età compresa tra 6 e 11
anni, allevate nella provincia di Messina. Mediante la strumentazione specialistica si è proceduto ad effettuare una attenta
valutazione dei diversi segmenti oculari, nonché ad applicare i test diagnostici utilizzati di routine.
Con i risultati del presente lavoro si ritiene di fornire degli elementi di semiologia oculare del bufalo, la cui presenza sul
territorio nazionale ha visto negli ultimi anni una crescita esponenziale, ma che non è stato particolarmente indagato
riguardo agli aspetti inerenti l’oftalmologia.
Summary
In the large animals medicine, on the contrary of the small animals, the interest to the ocular pathologies is very little
because of the economic loss that they can determine, both individual (e.g. ocular mass) and general (e.g. infectious
kerato-conjunctivitis). Nevertheless the eye is a structure easy to examine and the encountered pathologies frequently
represent a valid aid in the diagnosis of the nervous system alterations that can determine secondary problems of the eye.
So it is very important to perform frequent ocular examinations in large animals too. In this study the Authors report
the results of the ocular examination conduced on 10 buffalos, females, with age ranged from 6 to 11 years, reared in the
province of Messina (Italy). Using the specific instruments it was possible to effect an accurate evaluation of the different
ocular segments and to apply the various diagnostic test. With the results of this study the Authors believe to obtain the
semeiological data of the buffalo’s eye. The breeding of this large animal is became very diffuse in Italy during last years
but the ocular pathologies are not much considered.
Introduzione
Nel corso degli ultimi decenni si è assistito ad un crescente interesse da parte degli imprenditori zootecnici verso
l’allevamento bufalino.
Diversi fattori quali minore costo di gestione aziendale rispetto all’allevamento di bovine da latte ad alta produzione,
maggiore capacità da parte del bufalo di utilizzare foraggi più grossolani e quindi meno costosi, aumento della richiesta
di mercato dei prodotti della trasformazione del latte di bufala, uniti alla rusticità di questo animale hanno spinto diversi
allevatori a convertire le loro aziende da bovine a bufaline.
All’incremento numerico dei capi si è associato un progressivo cambiamento della tipologia di conduzione aziendale,
passando da allevamenti di tipo prevalentemente brado o semi-brado, a sistemi di tipo intensivo. Quanto verificatosi nel
tempo, oltre a determinare l’incremento della produzione lattea, ha permesso da un lato la riduzione dell’incidenza di
malattie tipiche quali “barbone bufalino”, afta epizootica, oesophagostomiasi ed altre parassitosi epatiche e gastrointestinali,
dall’altro la comparsa di patologie tipiche dell’allevamento intensivo quali: brucellosi, mastiti, malattie virali quali IBR,
BVD, RSV nonché patologie metaboliche (Ciaramella P. & De Luna R., 1997; Persechino A., 1997; Fenizia D., 1997).
Il sistema di allevamento in stabulazione ha permesso di monitorare lo stato di salute degli animali e di rilevare più
agevolmente eventuali alterazioni morfo-funzionali a carico dei diversi organi ed apparati, tra questi anche quello oculare.
La crescente attenzione da parte di chi ha investito su questa specie animale nei riguardi dell’intera sfera sanitaria, ai fini
di un miglioramento del benessere che si traduca in aumenti della produttività, ha spinto il nostro gruppo di ricerca, già
impegnato negli ultimi anni in lavori sull’apparato oculare di ruminanti domestici e selvatici, ad intraprendere uno studio
volto alla valutazione di alcuni elementi di semiologia oculare nel bufalo. Questo interesse nasce anche dalla consapevolezza
che per poter effettuare una adeguata valutazione clinica di un qualsiasi organo od apparato è fondamentale la conoscenza
di quei parametri fisiologici specie-specifici. Lo studio dell’occhio delle razze bufaline autoctone consente di approfondire
le conoscenze relative ad alcune patologie specifiche d’organo o sistemiche che, se trascurate, potrebbero impedire il
raggiungimento di elevati standard di protezione sanitaria, al fine di ottimizzare le performance produttive del singolo
individuo e migliorare, in tal modo, il trend economico aziendale.
Materiali e metodi
Il presente lavoro è stato condotto nell’azienda zootecnica Velo di Torregrotta (ME). Il campione era costituito da 20 soggetti di
sesso femminile di età compresa tra 6 ed 11 anni che non presentavano segni di patologie oculari in atto o pregresse.
Le indagini preliminari sono state condotte in condizioni di luce naturale, in modo da esaminare la posizione e la
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
227
simmetria dei globi, nonché gli annessi oculari (ciglia, palpebre, membrana nittitante e congiuntiva). Dopo questa
prima fase gli animali sono stati trasferiti in gruppo all’interno dei locali mungitura dove sono stati rilevati i valori
dello Schirmer Tear Test per la produzione lacrimale e della pressione oculare mediante tonometria per applanazione
(Tonopen XL), previa instillazione nel fornice congiuntivale di un collirio anestetico a base di ossibuprocaina cloridrato
allo 0,4%. L’esame è proseguito in ambiente semi-oscuro e, previo contenimento della testa dell’animale con delle corde,
sono stati valutati inizialmente le reazioni alla minaccia ed il riflesso fotomotore, quindi si è proceduto all’ispezione del
segmento anteriore osservando la cornea, la sclera, la camera anteriore, l’iride e la pupilla tramite un transilluminatore,
un oftalmoscopio diretto ed una lampada a fessura; infine, dopo midriasi farmaco-indotta, è stato esaminato il cristallino
ed il fondo oculare mediante oftalmoscopia diretta ed indiretta.
Risultati
Lo schema di conduzione della visita oculistica riprende quanto riportato per l’esame obiettivo particolare dell’occhio nei
grossi animali.
Gli occhi dei bufali, come in tutti gli erbivori da preda, sono posti ai due lati della testa. L’orbita è di tipo chiuso, cioè
completamente circondata dalla struttura ossea formata da: lacrimale, frontale, temporale e zigomatico, per dare più
protezione all’occhio e come rinforzo per il cranio durante i rituali per gli accoppiamenti e le lotte tra i maschi (Foto n°1).
Le palpebre sono costituite da cute sottile provvista di corti peli ed il margine libero della palpebra superiore è dotato
di ciglia lunghe e robuste, meno evidenti in quella inferiore (Foto n°2); la fessura palpebrale, particolarmente ampia,
garantisce un ottimo campo visivo; la congiuntiva palpebrale appare di colorito rosato mentre la congiuntiva sclerale,
fatta eccezione per la zona perilimbare che può presentarsi pigmentata, risulta trasparente e lascia intravedere i vasi
sottostanti.
La cornea in questi animali, perfettamente diafana, appare lucida ed omogenea e, così come accade per molti animali da
pascolo, ha una forma ellittica con diametro maggiore disposto in senso orizzontale, fattore questo che insieme all’ampia
fessura palpebrale aumenta il campo visivo (Foto n°2).
Lo Schirmer Tear Test, effettuato in entrambi gli occhi dei soggetti esaminati prima di procedere all’esame strumentale
delle diverse strutture oculari, fornisce un valore medio di 22,37 ± 5,44 (deviazione standard) mm/sec.
Il riflesso fotomotore, diretto e consensuale, con un tempo di reazione di pochi secondi, ha fornito valori sovrapponibili
a quelli riscontrati nel bovino.
L’esame strumentale del distretto anteriore dell’occhio ha permesso di evidenziare la camera anteriore discretamente
profonda e le peculiarità morfo-strutturali dell’iride. Quest’ultima, di colore nocciola-castano, presenta un foro pupillare
disposto orizzontalmente rispetto al piano sagittale dell’occhio, a forma di ellisse in condizioni di miosi e di rettangolo
con angoli smussi in midriasi. Sul margine superiore della pupilla si evidenziano i cosiddetti “corpora nigra” (Foto n°3).
I rilievi tonometrici eseguiti su entrambi gli occhi hanno dato un valore medio di 20,12 ± 3,44 (deviazione standard)
mm/Hg.
A completamento della visita oculistica l’esplorazione del fondo oculare, previa midriasi farmaco indotta ottenuta in 2030 minuti, ha permesso di osservare le strutture morfologiche tipiche della specie in esame. La vascolarizzazione retinica
in questa specie animale è costituita dal circolo venoso del nervo ottico, posto al centro della papilla, dal quale si dipartono
3 o 4 vene primarie di grosso calibro e di colore rosso scuro. Dalla periferia del disco ottico emergono altrettante arterie
di calibro minore e di colore più chiaro che, pur decorrendo parallelamente alla rete venosa, assumono una distribuzione
più irregolare ed un decorso più tortuoso. La vena e l’arteria superiore si distinguono rispetto agli altri vasi in quanto
decorrono intrecciate; arteriole addizionali si irradiano dal disco ottico, provvedendo all’irrorazione dell’intera superficie
retinica. Lungo il decorso dei vasi di calibro maggiore si evidenziano anastomosi ad angolo retto, che contribuiscono
all’irrorazione sanguigna delle varie porzioni di retina.
La zona tapetale, presente a livello dei quadranti dorsali, mostra variazioni cromatiche che vanno dal giallo al blu, e risulta
uniformemente costellata da punti rossi ben evidenti, rappresentanti un numero elevato di sottili capillari..
I quadranti retinici ventrali sono occupati della zona non tapetale, uniformemente pigmentata e di colore marrone
scuro. A questo livello, in posizione eccentrica, si trova il disco ottico, di forma rotondeggiante e di colore giallo più o
meno intenso, circondato da un anello pigmentato completo che ne rende più netti i margini rispetto al tessuto retinico
circostante. Al centro del disco ottico in tutti i soggetti da noi esaminati è stata osservata una zona di colorito biancastro,
procedente nel vitreo, vestigia dell’arteria ialoidea (Foto n°4).
Foto n°1
228
Foto n°2
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Foto n°3 -
Foto n°4
Considerazioni e Conclusioni
I risultati della presente indagine necessitano di alcune considerazioni.
Il significato ontogenetico della posizione laterale dei globi oculari è da ricercare nella necessità, per questi animali, di
avere una visione più ampia possibile per difendersi dai predatori naturali; infatti, questo ruminate presenta un campo
visivo di circa 330° che, pur non raggiungendo i 360°, gli consente ugualmente la visione dell’intero arco dell’orizzonte.
Tuttavia, questa ottica “panoramica”, ma perlopiù monoculare, fondamentale nella percezione tempestiva di eventuali
predatori, va a scapito della visione stereoscopica che, con la sovrapposizione dei due campi visivi, permette una
migliore valutazione degli spazi e delle profondità.
La presenza dei corpora nigra a livello del margine superiore della pupilla sembra sia necessaria per svolgere una
funzione di “filtro” nei confronti dei raggi luminosi, mentre alcuni Autori attribuiscono ad essi, nella specie equina,
anche la capacità di produrre umore acqueo (Sack W.O., 1992).
E’ da rilevare che nel corso delle nostre indagini non sono emerse eterocromie a carico del tessuto irideo, come invece
riportato da altri Autori (Misk N.A., et al., 1998) in questa specie animale, a testimonianza della necessaria cautela
nell’assumere come attendibili i risultati delle ricerche svolte su razze bufaline orientali, non allevate sul territorio
italiano.
La semeiologia dell’apparato oculare nei bufali, così come avviene per la maggior parte degli animali da reddito, risulta
attualmente limitata principalmente da problemi di ordine economico; l’interesse degli allevatori nei confronti delle
patologie a carico di tale distretto risulta legato, infatti, all’impatto economico che le stesse possono avere sul bilancio
aziendale. Tuttavia, se da un lato è innegabile l’ottica utilitaristica di chi investe danaro su animali da reddito, d’altro
canto è altrettanto vero che gli occhi ed i loro annessi sono delle strutture direttamente investigabili che, oltre a
patologie proprie, possono riferire segni di patologie di natura sistemica.
Quanto sopra sottolinea l’importanza della conoscenza dei sintomi oculari per il medico veterinario, quale ausilio
diagnostico per svariate patologie.
In conclusione, è bene sottolineare che il presente lavoro, scarsamente supportato sul territorio nazionale da analoghe
ricerche, a nostro avviso fornisce importanti elementi di semiologia oculare nel bufalo che possono rappresentare dati
di riferimento per quanti si confrontano quotidianamente con gli aspetti sanitari di questo poderoso ruminante, il cui
numero tende ad aumentare nel tempo, vista la crescita esponenziale degli allevamenti bufalini sul nostro territorio.
Bibliografia
1)
2)
3)
4)
5)
Ciaramella P. & De Luna R., Aspetti di patologia metabolico-nutrizionale nel bufalo, Atti V Congresso FeMeSprum,
Ozzano Emilia (BO), pp. 51-64, 1997.
Fenizia D., Le più frequenti patologie entero-respiratorie a carattere infettivo dei vitelli bufalini in Campania, Congresso
FeMeSprum, Ozzano Emilia (BO), pp. 35-48, 1997.
Misk N.A., Semieka M.A., Fathy A., Heterochromia iridis in water buffaloes (Bubalus bubalis), Veterinary
Ophthalmology, 1, 195-201, 1998.
Persechino A., Aspetti di patologia della sfera genitale, neonatale e metabolico-nutrizionale nel bufalo, Congresso
FeMeSprum, Ozzano Emilia (BO), pp. 7-9, 1997.
Sack W.O., Guide to the dissection of the horse, VI ed.- Veterinary Textbooks, Ithaca, New York., pp. 175-182, 1992.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
229
UMORE ACQUEO DELL’OVINO: TRACCIATO ELETTROFORETICO (STUDI
PRELIMINARI).
---------------------OVINE HUMOUR AQUEOUS: ELECTROPHORETIC PATTERN (PRELIMINARY STUDIES).
---------------------Gargano V., Santangelo L., Domina F., Niutta P.P., Pugliese A.
Dipartimento Scienze Mediche Veterinarie - Università degli Studi di Messina
Riassunto
La valutazione quali-quantitativa dell’assetto proteico dell’umore acqueo rappresenta oggi un elemento di sicuro interesse
ai fini diagnostici e prognostici di alcune malattie che coinvolgono il segmento anteriore dell’occhio: uveite, cataratta,
glaucoma.
Contrariamente a quanto avviene in medicina umana, in ambito veterinario ancora poche sono le note bibliografiche a
riguardo.
Scopo del presente lavoro è stato quello di tracciare, attraverso un’ indagine elettroforetica, il profilo proteico dell’umore
acqueo di ovini clinicamente sani, al fine di acquisire dei valori quali-quantitativi di riferimento della specie in
questione.
Le nostre indagini sono state condotte su un campione significativo di animali, prelevando, in fase di macellazione,
immediatamente dopo lo stordimento e prima della iugulazione, circa 80 μl di umore acqueo da ciascuno occhio.
Tramite migrazione elettroforetica su gel di Agaroso (Fast Rep Helena) è stato possibile ottenere la separazione,
l’identificazione e la quantificazione delle singole frazioni proteiche presenti nei campioni di umore acqueo processati.
L’analisi dell’elettroferogramma ha permesso di riconoscere n° 6 frazioni proteiche, disposte sulla striscia in relazione al
proprio peso molecolare: albumina, transferrina, aptoglobina, ceruloplasmina, α2 macroglobulina, immunoglobuline.
Ritenendo i dati ottenuti preliminari e necessari di ulteriori approfondimenti, gli Autori hanno effettuato alcune
considerazioni sull’importanza delle indagini nelle specie da reddito.
Summary
The aqueous humour is produced by the ciliary body epithelium through active and passive processes. It’s a transparent
fluid almost lacking in cells that has important functions like nutrition of lens and cornea and the maintenance of a
constant I.O.P.
From the clinical point view, the proteic fractions have an important role because their quali-quantitative variations can
modify the function of aqueous humour.
The aim of this study is to analyse, by the electrophoresis, the proteic fractions of the aqueous humour of the sheep,
obtaining values of reference in physiological conditions.
A significant sample of animals was examined, and about 80 μl of aqueous humour were taken from each animal. The
evaluation of proteins was determined by electrophoretic technique on agarose gel (Fast REP Helena).
Characteristic protein bands relative to albumin, immunoglobulins, lisozime and other proteins were detected on the
strip in a position corresponding to their molecular weight.
The results of our study are basic parameter useful to evaluate the qualitative and quantitative composition of the proteic
fraction of the aqueous humour, and they could be a diagnostic and prognostic instrument in some disease of the anterior
segment of the eye.
Premessa
Sulla scia di precedenti indagini effettuate dal nostro gruppo di ricerca sulle variazioni quali-quantitative dell’umore
acqueo in animali di specie bovina, elementi di supporto allo studio di alcune malattie sistemiche, le cui ripercussioni
determinano alterazioni patologiche del distretto anteriore (cheratiti, cheratouveiti, opacamenti della lente ed aumento
della pressione endobulbare), riportiamo in questa nota le indagini preliminari sull’assetto proteico del suddetto secreto
in ovini clinicamente sani.
Per quanto l’argomento sia particolarmente attenzionato in medicina umana, al momento, non abbiamo lo stesso riscontro
in medicina veterinaria.
Disporre di questi dati consentirebbe di approfondire lo studio diagnostico e prognostico già avviato in modo da ampliare
le conoscenze nell’ambito della patologia d’organo ed, eventualmente, correlare questa sintomatologia ad alterazioni di
natura sistemica.
Infatti, ad esempio, come è stato dimostrato nell’uomo, l’umore acqueo di pazienti glaucomatosi contiene concentrazioni
significativamente più alte di proteine totali ed in particolare della frazione �, rispetto a occhi di soggetti normali, presi
come controllo 5, 8.
Prima ancora di addentrarci nella descrizione delle metodologie operative e degli obiettivi che si intende raggiungere,
consideriamo interessante soffermarci sulla funzione di questo umore e sull’importanza delle alterazioni che possono
essere riscontrate.
L’umore acqueo, liquido trasparente, quasi privo di cellule, riempie completamente la camera anteriore, dando consistenza
al bulbo oculare e assicurando il nutrimento di importanti strutture quali lente e cornea 4.
Secreto dai processi ciliari, situati in camera posteriore, attraversa lo spazio irido-lenticolare e raggiunge la camera anteriore
dove subisce un continuo rimescolamento con movimenti da parete a parete e moti circolatori di convezione termica,
ascendenti verso l’iride e discendenti verso la cornea, originati dalla differenza di temperatura delle due strutture 4. La
230
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
principale via di drenaggio è rappresentata dall’angolo irido-corneale.
Questo liquido ipertonico rispetto al plasma è costituito principalmente da anioni (cloro, bicarbonato, lattato, ascorbato,
fosfato), cationi (sodio, potassio) e sostanze non elettrolitiche (anidride carbonica, urea, glucosio, albumina, transferrina,
aptoglobina, ceruloplasmina, α2 macroglobulina, immunoglobuline) 2, 7, 8, 10.
La forza esercitata da questo fluido sulla tunica corneo-sclerale, “pressione intraoculare” (I.O.P.), viene fisiologicamente
mantenuta a livelli pressoché costanti, in quanto all’aumento della pressione, corrisponde una diminuzione della
produzione.
Tale umore, inoltre, contiene diversi fattori di crescita che svolgono azioni chemotattiche e/o mitogene per fibroblasti e
cellule infiammatorie 4.
L’elettroforesi, tecnica di laboratorio relativamente semplice, rapida e riproducibile, che si basa sul principio della ionoforesi,
ha permesso di ottenere la separazione e la determinazione quantitativa e qualitativa delle principali frazioni proteiche
di tale fluido 1.
Il sistema elettroforetico con gel d’agaroso consta di quattro componenti fondamentali: la proteina che migra, la soluzione
tampone, un campo elettrico e un mezzo stabilizzante (gel d’agaroso) con carica negativa 1.
La velocità di migrazione appare legata a diversi fattori intrinseci alla molecola proteica stessa: peso molecolare, ingombro
sterico, carica elettrica e punto isoelettrico 6, 9.
Tali caratteristiche biochimiche stabiliscono l’esatta posizione della proteina lungo la striscia di gel.
Materiali e metodi
Le nostre indagini sono state condotte nel marzo 2003 presso il Frigomacello del Comune di Messina, su un campione di
n° 8 ovini, 5 maschi e 3 femmine, di età compresa tra gli 8 e i 16 mesi e prossimi alla macellazione.
I soggetti, tutti in ottime condizioni di salute, sono stati sottoposti a controllo oftalmologico, da cui non si evidenziava
alcuna alterazione patologica a carico dei diversi distretti oculari.
Il prelievo di umore acqueo, nella quantità di 80μl da ciascun occhio, è stato possibile dopo lo stordimento e prima della
iugulazione dei soggetti.
Con un ago da insulina (27 Gauge), cui abbiamo preventivamente raccordato una siringa da 2,5 ml per avere un calibro
maggiore e vincere la pressione negativa, siamo entrati in camera anteriore attraverso il limbo; procedendo parallelamente
all’iride e, facendo molta attenzione a non perforare quest’ultimo, abbiamo aspirato la quantità di umore acqueo necessaria
per eseguire le nostre indagini.
I campioni, subito dopo il prelievo, sono stati mantenuti a temperatura di refrigerazione e successivamente congelati per
una settimana.
Dopo scongelamento l’analisi elettroforetica delle proteine è stata effettuata con un metodo a migrazione anodica su
piastra in gel d’Agaroso (Fast Rep Helena).
Al fine di individuare le diverse componenti proteiche è stato utilizzato, come campione di riferimento, un protidogramma
di siero di ovino e quindi una migrazione foretica in parallelo dei due fluidi organici, assumendo come riferimento la
migrazione dell’albumina serica lungo la striscia di gel. In tal modo è stato possibile individuare, sulla stessa, le bande
relative alle diverse frazioni costituenti il pool proteico dell’umore acqueo in tale specie animale.
Per eseguire l’indagine elettroforetica sono state effettuate n°3 semine di umore acqueo; la migrazione è avvenuta in 16
minuti a 400 Volts e 70mÅ.
Risultati
L’elettroforesi dell’umore acqueo ha consentito di riconoscere la presenza sulla striscia di gel d’Agaroso di n° 6 bande corrispondenti
ad altrettante frazioni: albumina, transferrina, aptoglobina, ceruloplasmina, α2 macroglobulina e γ globuline.
La mobilità elettroforetica di tali frazioni proteiche dipende dal peso molecolare, dall’ ingombro sterico, dal punto
isoelettrico e principalmente dalla carica elettrica, per cui l’albumina (la più negativa) migra verso l’anodo, l’aptoglobina,
la ceruloplasmina, l’α2 macroglobulina e la transferrina (tutte con carica negativa intermedia), migrano in posizione
centrale, mentre la γ globuline (le meno negative) verso il catodo. Da ciò si evince che la mobilità elettroforetica è
maggiore nelle particelle con più elevata carica negativa. Si noti che, nella striscia di gel, solo le � globuline si collocano a
destra del punto d’origine, poichè hanno una bassa carica negativa e quindi la forza elettrostatica è insufficiente a vincere
l’elettrosmosi (non migrano verso l’anodo positivo).
Tutte le altre frazioni proteiche, con carica negativa in grado di vincere l’elettrosmosi, sono attratte verso l’anodo, migrando
alla sinistra del punto d’origine e distribuendosi, in relazione al loro peso molecolare, lungo la striscia di gel.
Una volta ottenuta la concentrazione totale delle proteine presenti in tale fluido (1,48 g/dl), abbiamo potuto valutare la
quantità, espressa in percentuale ed in g/dl, delle singole frazioni nell’umore acqueo (Fig.2).
La comparazione tra il tracciato elettroforetico delle proteine sieriche e di quelle dell’umore acqueo di ciascun animale ha
permesso di identificare con sicurezza la zona di migrazione dell’albumina che, essendo di derivazione sierica, assume la
medesima posizione in entrambi i tracciati.
Dal grafico relativo alla migrazione delle proteine (fig.1), l’albumina appare come una banda omogenea e simmetrica.
Tale frazione proteica ha un peso molecolare di 69000 D, con una concentrazione di 27,43 +/- 0,51 %, mentre in g/dl
risulta 0,406.
Per quanto riguarda le frazioni proteiche che migrano a destra dell’albumina, noi riteniamo di identificarle, sulla base del
loro peso molecolare, nelle seguenti bande (tab. 1) :
- transferrina (79/90.000 D), 14,99 +/- 0,81%, (0,222 g/dl);
- aptoglobina (86/300.000 D), 10,46 +/- 0,48%, (0,155 g/dl);
- ceruloplasmina (151.000 D), 13,06 +/- 0,71%, (0,193g/dl);
- α2 macroglobulina (760.000 D), 9,34 +/- 0,43%, (0,138 g/dl);
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
231
- γ globuline (150/900.000 D) 24,72 +/- 0,52 %, (0,366 g/dl).
��������
� � ��������������
��������������
�������������
� ���������
������������
�
Fig. n° 1- Elettroferogramma tipo di umore acqueo ovino. In alto a destra viene riportata una striscia di gel
d’Agaroso.
��������
����
�
����
��������
������
����� ��� ����
�����
������������
���������
����� ��� ����
�����
�����������
����������
����� ��� ����
�����
��������������
�������
����� ��� ����
�����
�� ��������������
�������
���� ��� ����
�����
� ���������
�����������
����� ��� ����
�����
�������� ������
���
���
����
Tab. n° 1- Peso molecolare e concentrazione in % e g/dl delle singole frazioni proteiche.
Considerazioni e conclusioni
Prima di effettuare debite considerazioni sui risultati preliminari ottenuti nella presente ricerca è bene sottolineare�il ruolo
significativo che queste proteine oculari (umore acqueo) possono avere nello studio patogenetico di determinate entità
nosologiche.
Difatti le variazioni di concentrazione di tali proteine rappresentano un segnale importante nelle affezioni del segmento
anteriore dell’occhio e non si esclude che esse stesse possano eventualmente essere messe in relazione a patologie
sistemiche.
Ricordiamo che il fegato è il principale organo deputato a sintetizzare la maggior parte delle proteine, eccezion fatta per
le gamma globuline che originano dalle plasmacellule.
Dall’analisi dei risultati ottenuti sugli animali oggetto del nostro studio, che non presentavano alcuna alterazione
dell’apparato oculare, si evidenziano, come riportato nel tracciato tipo, situazioni quali-quantitative degne di
riferimento.
Per meglio interpretare i valori ottenuti ed il significato di questi parametri, nell’ambito di uno studio sulle variazioni
patologiche, facciamo un breve cenno sulle principali funzioni delle frazioni proteiche rilevate.
232
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Albumina: proteina che fornisce il maggior contributo alla pressione oncotica, attraverso l’ esame elettroforetico abbiamo
evidenziato una concentrazione alquanto elevata; sintetizzata dal fegato, tale proteina assume un ruolo importante nel
trasporto di numerose sostanze: ormoni, acidi grassi, steroidi, farmaci, bilirubina non coniugata,rame, nichel e soprattutto
calcio.
Transferrina: migra nell’area � ed assicura il trasporto di ferro e zinco; aumenta nelle anemie ferroprive e diminuisce
nei processi flogistici e nelle forme tumorali; rappresenta un importante marker per la valutazione dell’integrità fisica e
funzionale della barriera sangue-acqueo.
Aptoglobina: appartiene ad un gruppo di proteine plasmatiche che hanno la capacità di combinarsi con l’emoglobina
libera e svolge una funzione importante nei processi di ossigenazione delle strutture intraoculari. Proteina viscosa, con
caratteristiche intermedie fra globuline e albumine, migra nell’area dell’�2. Una bassa aptoglobinemia può essere indicativa
di emolisi intravasale; aumenta nelle infiammazioni acute e croniche, nelle neoplasie e nelle nefrosi.
Ceruloplasmina: sulla striscia di gel d’agaroso, presenta una mobilità elettroforetica uguale a quella dell’ �2 macroglobulina
nonostante il suo peso molecolare sia notevolmente inferiore;
dotata di debole attività ossidasica, aumenta nelle infezioni acute, nelle neoplasie e nelle flogosi.
�2 Macroglobulina: proteina ad alto peso molecolare, il cui ruolo non è ancora stato chiarito; possiede attività antiproteasica
ad ampio spettro, aumenta nel diabete e nella sindrome nefrosica.
� Globuline: a differenza delle precedenti frazioni proteiche sintetizzate a livello epatico, sono molecole sintetizzate dalle
plasmacellule e dai linfociti e sulla striscia di gel appaiono come una stretta banda che di solito si colora intensamente
nelle zone � e �. Sono definite anticorpi, ossia proteine capaci di legarsi a strutture molecolari antigeniche e, poichè sono
specifiche per un solo determinante antigenico, sono presenti in elevate concentrazioni.
Dopo aver passato in rassegna le funzioni delle frazioni proteiche registrate nell’umore acqueo degli animali oggetto
della nostra indagine, senza tralasciare dal considerare gli aspetti quantitativi delle stess, quali parametri di riferimento,
riteniamo doveroso sottolineare l’importanza dei dati ottenuti e le possibili correlazioni a seguire le ricerche.
Pertanto possiamo concludere considerando che i dati riportati nel presente lavoro, per quanto preliminari, costituiscono
comunque degli elementi di base nello studio di entità nosologiche in continua evoluzione, che meritano certamente di
maggiori approfondimenti.
In quest’ottica riteniamo di aver apportato un ulteriore e fattivo contributo ad un filone di ricerche già avviato, ma che
dovrà in futuro interessare anche altre specie animali, per valutare sempre meglio e con tecniche più innovative questo
fluido ancora così poco esplorato.
Bibliografia
1.
2.
Cawley L. P. – Elettroforesi ed immunoelettroforesi – Piccin Editore Padova, 1975
Goralska M ., Harned J., Grimes A. M., Fleisher L.N., Mc Gahan M . C.- Mechanism by which ascorbic acid increases ferritin
levels in cultured lens epithelial cells.- Exp. Eve. Res. 1997 Mar; 64 (3) : 413-21.
3. John M., Glaesser D.- Concentrations of serum albumin and nonesterified fatty acids in bovine aqueous humour with regard to the
fatty acid sensitivity of bovine lens epithelial cells.- Ophthalmic Res 2000 Jul-Aug; 32 (4) : 151-6.
4. Kalsy J., Raichrur H., Patwardhan A. D. – Study of aqueous humour in anterior uveitis – Indian J Ophtalmol 1990 Jan-Mar;
38 (1):20-3
5. Lee I. S., Yu Y. S., Kim D. M., Youn D. H., Kim J. Q. – Detection of specific proteins in the aqueous humour in primary openangle glaucoma – Corean J Ophatlmol 1990 June; 4 (1):1-4
6. Rohde E., Tomlison A.J., Johnson D.H., Naylor S.- Comparison of protein mixtures in aqueous humour by membrane
preconcetration - capillary electrophoresis – mass spectrometry.- Electrophoresis. 1998 Oct.; 19 (13): 2361-70.
7. Schmut O., Zirm M. – Determination of bovine aqueous humour proteins – Albrecht Von Graefes Arch Klein Exp Ophtalmol
1975; 194 (1):61-3
8. Tripathi R.C., Borisuth N.S., Tripathi B.J., Gotsis S.S.- Quantitative and qualitative analysis of transferrin in aqueous humour
from patients with primary and secondary glaucomas.- Invest Ophthalmol Vis Sci 1992 Sep; 33 (10): 2866-73.
9. Yu T.C., Okamura R.- Comparative study of native proteins in aqueous humour and serum detection of characteristic aqueous
humour proteins.- Jpn J Ophthalmol 1987; 31 (2): 235-48.
10. Zagari F. – Il trattamento delle endoftalmiti – Bollettino di oculistica 2002 Maggio-Giugno 3:465-476
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
233
pagina bianca lasciata intenzionalmente
POSTER
VENERDÌ 23 MAGGIO 2003
SABATO 24 MAGGIO
XI Congresso
Internazionale
della Federazione
Mediterranea
Sanità
e Produzione
Ruminanti
Fe.Me.S.P.Rum
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
235
236
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
ELENCO POSTER
INTERACCIONES ORGÁNICAS DE LOS METALES ESENCIALES (COBRE Y CINC) EN EL
GANADO OVINO DE RAZA SEGUREÑA DE LA REGIÓN DE MURCIA.
Barba C, Montes AM, Gutiérrez-Panizo C, Cerón JJ.
EFFETTO DELL’INTEGRAZIONE ALIMENTARE SULLE CAPACITA’ DI MANTENIMENTO DELLE
RISERVE ENERGETICHE NEL PERIPARTO E SULLE PRODUZIONI IN CAPRE D’ANGORA
Beghelli D., Trabalza Marinucci M., Acuti G. , Moscati L., Battistacci L.,
EFFECTIVENESS OF TILMICOSIN IN THE TREATMENT OF PULMONARY INFECTIONS
IN YOUNG CALVES
Calò M., Giofrè F., Pintimalli A., Martino D., Naccari F.
L’ABIGEATO E LA CONTRAFFAZIONE DEI MARCHI AURICOLARI IN OVINI SARDI:
OSSERVAZIONI MEDICO-LEGALI, CLINICHE E LEGISLATIVE.
Cubeddu G.M. Pintori G., Coda S. Manconi M.
VALUTAZIONE DEL COMPORTAMENTO ALIMENTARE IN AGNELLI MERINOS:
PREFERENZE ALIMENTARI CON L’IMPIEGO DI ALIMENTI SEMPLICI
D’Alessandro A.G., Quaranta A., Frate A., Colella G.E., Martemucci G., Casamassima D.
FARMACOCINETICA, RESIDUI NEL LATTE ED EFFICACIA TERAPEUTICA DEL
MARBOFLOXACIN IN ALCUNE PATOLOGIE DI ORIGINE BATTERICA DELLE PECORE.
NOTA I: CINETICA EMATICA E RESIDUI NEL LATTE.
Farca A.M., Pollicino P., Panichi M., Mattoni M., Cavana P., Romboli S.
NIVELES DE MICROMINERALES EN OVEJAS DE “TIERRA DE CAMPOS”, LEÓN (ESPAÑA)
González Montaña Jr, Martín Alonso Mj, Alonso Díez Aj, Torío Álvarez R, Rejas López J.
CAMBIOS ELECTROLÍTICOS ASOCIADOS A LA ADICIÓN DE PREBIÓTICOS EN
TERNEROS DE CEBO EN FASE DE CRECIMIENTO.
ELECTROLYTE CHANGES IN RELATION TO ADDITION TO PREBIOTICS IN BEEF CALVES
Hernández J; Pereira V; Méndez J ; López Alonso M. ; Miranda M.; Benedito JL ; Castillo C
INFLUENZA DELLA TECNICA DI ALLEVAMENTO SUGLI ASPETTI QUANTI-QUALITATIVI
DELLA PRODUZIONE DI LATTE NEGLI OVINI
Laudadio V. & Dario C.
EFFETTO DELL’ INTEGRAZIONE CON VITAMINE ED OLIGO-ELEMENTI SULLA
PRODUZIONE QUANTI-QUALITATIVA DI LATTE IN PECORE AL PASCOLO
Laudadio V., Petrera F., Ciruzzi. B.
RAPID DETECTION OF MYCOBACTERIUM TUBERCULOSIS COMPLEX AND
MYCOBACTERIUM AVIUM COMPLEX, IN BOVINE BIOLOGICAL SAMPLES BY NESTED
REAL-TIME PCR
Liciardi M. , Crobeddu S., Solinas F.,, Piras V., Orrù G.
CADMIUM AND LEAD ACCUMULATION IN BEEF AND DAIRY CATTLE IN NW SPAIN
M. López Alonso , F. Prieto Montaña , P García Partida , M. Miranda, C. Castillo , J. Hernández , J. L. Benedito 1
PRATICHE DI ALIMENTAZIONE NELL’ALLEVAMENTO CAPRINO ESTENSIVO
MEDITERRANEO
Marongiu M. L., Santucci P. M., Branca A), Bomboi G., Floris B.
“EFECTOS DEL 17-α-ETINILESTRADIOL SOBRE EL EQUILIBRIO HIDROELECTROLÍTICO
EN TERNEROS” “EFFECTS OF THE 17-α-ETHINYLESTRADIOL ON HYDROELECTROLITIC
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
237
BALANCE IN CALVES”
Pereira V; Castillo, C; Hernandez J; Lopez Alonso, M; Vilariño, O; Benedito JL
IL PROFILO SIEROPROTEICO NELLA CAPRA JONICA.
Petazzi F. , Rubino G.T., Giordano G., Pieragostini E.
QUALE SCENARIO PER LA ZOOTECNIA DA LATTE NELLA MURGIA BARESE?
Pieragostini E., Bramante G., Roma R., Sorrentino A.
STUDIO ELETTROFORETICO DI UNA VARIANTE DELLA CASEINA αS2 NEL LATTE OVI NO.
Di Luccia A., Bramante G., Pieragostini E., Caroli A.
QUALITA’ DELLA CARNE DI VITELLONI ALLEVATI CON SISTEMA BIOLOGICO
Preziuso G., Russo C.
DISTRIBUTION OF EIMERIA SPECIES IN BOVINE FARMS FROM AN AREA OF THE
SOUTHERN ITALIAN APENNINES
Rinaldi L., Veneziano V., Santaniello M., Schioppi M., Musella V., Cringoli G.
NIVELES DE COBRE Y CINC EN LECHE DE VACAS PARDO-ALPINAS EXPLOTADAS EN
CONDICIONES SEMIEXTENSIVAS
Ríos-Granja MA, Pérez-García CC, García-Rodríguez MB, Cano-Rábano MJ, Diez-Prieto I.
LA MALATTIA DELLA IENA INDOTTA DA IPERVITAMINOSI A
INTERACCIONES ORGÁNICAS DE LOS METALES ESENCIALES (COBRE Y CINC) EN EL
GANADO OVINO DE RAZA SEGUREÑA DE LA REGIÓN DE MURCIA.
Barba C, Montes AMª, Gutiérrez-Panizo C, Cerón JJ
Facultad de Veterinaria. Universidad de Murcia, 30100, Espinardo, Murcia, España.
Resumen
En el estudio de los metales en el organismo animal es importante considerar los esenciales, que al ser fundamentales para el
desarrollo orgánico son habitualmente utilizados en la producción animal, pero suministrados en exceso pueden ser nocivos.
Estos metales son habitualmente añadidos a dietas animales para optimizar la producción y conseguir fuentes de minerales
para la alimentación humana, introduciendo así elementos traza en la cadena trófica. En este trabajo determinamos los
niveles de Cu y Zn en hígado y riñón de 20 ovejas de raza segureña mediante espectrofotometría de absorción atómica
de llama. Las concentraciones medias en hígado y riñón (mg/kg peso fresco) de Cu fueron 138,02 y 3,24 y de Zn 52,72
y 19,51. Con el fin de estudiar las interrelaciones metálicas en el organismo animal se comprobó su distribución normal,
se representaron gráficamente, y se estudió la correlación. El hígado ovino acumula mayores cantidades de Cu y Zn
que el riñón, consecuencia de su mayor carácter bioacumulativo y su importancia en el metabolismo metálico, además
encontramos grandes variaciones individuales posiblemente relacionadas con la capacidad de metabolización de cada
animal. Por un lado, existe una relación positiva entre los niveles de Cu en hígado y riñón, experimentando variaciones
individuales en la misma dirección. Por otro lado, los niveles de Zn en estos órganos también se relacionan positivamente.
Cu y Zn son dos metales esenciales que compiten en el organismo a muchos niveles, y este antagonismo competitivo se ve
reflejado en la relación inversamente proporcional existente entre sus concentraciones hepáticas y renales.
ESSENTIAL TRACE ELEMENTS RELATIONSHIP INTO THE ANIMAL ORGANISM IN ADULT
SHEEP SLAUGHTERED IN SE SPAIN.
Summary
It is important to take into account the essential metals in ruminant production, which beside being necessary for organic
performance, can also be acutely toxic in certain concentrations. So that, trace amount of these metals were usually added
in animal feeding to optimise the production and to reach a source of trace elements for human diet. But significant
amounts of the ingested metals were excreted by the animals to the environment and the metals were introduced in the
food chain.The Cu and Zn measurement by flame atomic absorption spectrometry has been carried out in this study
to determine the levels in liver and kidney from healthy segureña sheep. On the one hand, in mg/kg fresh weight, the
mean Cu concentrations were 138,02 and 3,24; on the other hand, Zn levels were 52,72 and 19,51, in liver and kidney
respectively. Cu and Zn concentrations found in livers were higher than concentrations found in kidneys, because the
liver has an important role in metal metabolism, and it is an important organ for the accumulation of metals. A positive
relationship was found between Cu concentrations in liver and in kidney, and the same with Zn. Moreover, the antagonism
between Cu and Zn was shown by the negative correlations between both metals in different organs, so that on increasing
one of them, the levels of the other metal in the organism decrease.
INTERACCIONES ORGÁNICAS DE LOS METALES ESENCIALES (CU Y ZN) EN GANADO
OVINO DE RAZA SEGUREÑA DE LA REGIÓN DE MURCIA.
Barba C, Montes AMa, Gutiérrez-Panizo C, Cerón JJ.
Facultad de Veterinaria, Universidad de Murcia, 30100, Espinardo, Murcia, España.
Introducción
Dentro del grupo de los metales y sus compuestos, es importante considerar los esenciales, ya que son necesarios para el
desarrollo adecuado del organismo pero en exceso pueden llegar a ser tóxicos. Dentro de este grupo, Cu y Zn son importantes
por sus múltiples funciones biológicas que los hacen indispensables para la vida. De modo que sus desequilibrios en la dieta
y las interacciones con otros minerales provocan alteraciones del rendimiento productivo e incluso problemas clínicos.
Es importante tener en cuenta que estos metales son habitualmente añadidos a las dietas animales para optimizar la
producción siendo además fuente de minerales para la alimentación humana. El problema es que sólo una pequeña fracción
de los elementos suplementados aparece en los productos animales, mientras que cantidades significativas son excretados
por el animal, por lo que al utilizar purines y excrementos animales como abono, al tiempo que beneficia a los cultivos
también los contamina, introduciendo elementos traza en la cadena trófica (JONG TSENG, 1998).
Dada la importancia de la producción ovina en la Región de Murcia, en concreto, la raza segureña por el tipo de explotación
extensiva y semiextensiva en que se desarrolla, el ganado ovino es una especie animal que se encuentra directamente
expuesta a la contaminación ambiental.
Material y métodos
Elección de los animales de estudio. Los animales fueron seleccionados en el matadero de un lote de ovejas de raza
segureña sanas a la inspección ante y postmortem procedentes de una zona agrícola poco industrializada. Se tomaron
muestras de 20 hembras entre 5 y 6 años.
Elección del tipo de muestras. La elección de hígado y riñón como órganos de estudio se debe a que ambos son
acumuladores de metales y por tanto son un buen indicador de la exposición del animal a los metales y del carácter agudo
o crónico de la misma.
Procesamiento de las muestras. Las muestras se procesaron por digestión ácida utilizando ácido nítrico concentrado 65%
y peróxido H 30%.
Determinación de Cu y Zn. Los análisis se realizaron mediante espectrofotometría de absorción atómica (EAA) de llama.
Control de calidad analítico. Para controlar la fase experimental se introdujo un material de referencia certificado (Pig
Kidney CRM 186) en cada serie analítica, sometido al mismo procedimiento que las muestras hasta su análisis. Para
detectar interferencias y efectos de matriz se utilizó el método de calibración de adiciones estándar. Para evitar las posibles
fuentes de variación se siguió el programa recomendado por la FAO European cooperative network on trace elements
(KUMPULAINEN, 1987).
Resultados y discusión
Las concentraciones medias de Cu y Zn encontradas en hígado y riñón de ganado ovino aparecen en la Tabla 1.
Tabla 1. Niveles de Cu y Zn en ovejas segureñas de la Región de Murcia.
NIVELES DE METALES ESENCIALES (mg/kg peso fresco)
TEJIDO
n
Cobre a
Hígado
20
138 ± 112,4 (8,5-396,5)
Riñón
20
3,2 ± 0,6 (1,9-3,9)
a media ± desviación estandar (mínimo-máximo)
Cinc a
52,7 ± 19,3 (39,3-101,6)
19,5 ± 1,7 (17,2-23,4)
La distribución de Cu y Zn en cada órgano y sus variaciones se representaron en el gráfico dónde se muestra que los niveles
de metales en riñón son constantes en todos los animales del mismo grupo mientras que los niveles de metales en hígado
sufren grandes variaciones individuales en función de la capacidad de metabolización de cada animal. Por otro lado también
observamos que el hígado es el principal órgano para el almacenamiento de metales y esto se debe a la función que desempeña
en el metabolismo metálico. En el caso del Cu, los altos niveles encontrados tienen su explicación en que los rumiantes no
tienen un mecanismo de control efectivo sobre el almacenamiento del Cu en el hígado (MILLER et al, 1993).
Fig. 1. Distribución de cobre y cinc en hígado y riñón de 20 ovejas
de raza segureña (media ± intervalo de confianza 95%).
En cuanto a las interacciones entre los metales en el organismo animal se ha realizado un estudio de correlación con las
concentraciones existentes en cada órgano (tabla 2) dónde observamos que los valores absolutos de los coeficientes de
correlación no son en ningún caso menores de 0,6, lo que sugiere que existe una relación entre Cu y Zn en los diferentes
órganos animales. Además si tenemos en cuenta el símbolo de los coeficientes podemos estudiar la dirección de las relaciones,
de modo que los coeficientes negativos tienen su explicación en el antagonismo existente entre Cu y Zn, y por otro lado,
al correlacionar el mismo metal en distintos órganos encontramos siempre coeficientes positivos con lo que se evidencia
}claramente que niveles mayores de un metal en un organismo provocan que se almacene en mayor proporción en todos
sus órganos diana, demostrando así una relación directamente proporcional.
Tabla 2. Coeficientes de correlación (nivel signif.) de las concentraciones de Cu y Zn presentes en hígado y riñón de los
animales muestreados.
ELEMENTO/MUESTRA
CU/HÍGADO
CU/RIÑÓN
0,379* (0,05)
ZN/HÍGADO
-0,301 (0,099)
ZN/RIÑÓN
-0,441* (0,026)
* significativo al 0,05. ** significativo al 0,01.
240
CU/RIÑÓN
ZN/HÍGADO
-0.550** (0,006)
-0.130 (0,292)
0,295 (0,103)
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
Los resultados de correlación entre los niveles de Cu en hígado y de Cu y Zn en riñón son significativos en el nivel 0.05
y esto indica que existe una relación lineal entre estos elementos en estos tejidos. Además, también encontramos entre el
Cu en riñón y el Zn en hígado una correlación significativa al nivel 0.01, lo que indica una relación fuertemente lineal
entre estas dos variables. En un estudio de correlación similar realizado por Langlands et al (1987) entre Cu y Zn en ovejas,
obtuvieron correlaciones significativas al 0,05, pero en ningún grupo encontraron una relación inversa entre Cu y Zn,
además de que la relación lineal existente entre los niveles de metales fué menor que la obtenida en este estudio.
Conclusiones
En base a los niveles de metales obtenidos, comprobamos que el hígado ovino acumula mayor cantidad de Cu y Zn que
el riñón, consecuencia de su mayor carácter bioacumulativo y su función en el metabolismo metálico. Por otro lado, los
niveles bien de Cu o de Zn en hígado y riñón se comportan de manera similar y aumentan o disminuyen conjuntamente
en ambos órganos. Y además, hemos observado como son metales esenciales que compiten en el organismo a muchos
niveles y el antagonismo competitivo se refleja en la relación inversamente proporcional existente entre sus concentraciones
hepáticas y renales.
Bibliografía
JONG TSENG, Y. 1998. Impact of trace element nutrition of animals on the food chain. United States Department of Agriculture,
Agricultural Research Service, Nutrition Research Unit.
KUMPULAINEN, J. y PAAKKI, M. 1987. Analytical quality control program used by the trace elements in foods and diets subnetwork of the FAO European Cooperative network on trace elements. Fresenius J. Anal. Chem. 326: 684-689.
LANGLANDS, J.P.; DONALD, G.E. y SMITH, A.J. 1987. Analysis of data collected in a residue survey: copper and zinc concentrations
in liver, kidney and muscle in Australian sheep and cattle. Aust. J. Exp. Agric. 27: 485-491.
MILLER, J.K.; RAMSEY, N. y MADSEN, F.C. 1993. Elementos vestigiales. En CHURCH, C.D. (ed). El Rumiante: fisiología digestiva
y nutrición. pp. 391-457. Ed. Acribia. Zaragoza.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
241
EFFETTO DELL’INTEGRAZIONE ALIMENTARE SULLE CAPACITA’ DI MANTENIMENTO
DELLE RISERVE ENERGETICHE NEL PERIPARTO E SULLE PRODUZIONI IN CAPRE
D’ANGORA
Beghelli D., Trabalza Marinucci M.*, Acuti G. #, Moscati L.°, Battistacci L.°,
Fac. di Med. Vet., Via Circonvallazione 93/95, 62024 Matelica (MC)
* Dip. di Tec. e Biotec. delle Prod. Anim., Fac. di Med. Vet.,Via S. Costanzo, 29 06126 Perugia
# Dottorato di ricerca
° Istit. Zoop. Sperim. dell’Umbria e delle Marche, Via Salvemini 1, 06126 Perugia
Tel. 0039 737 403438 Fax 0039 737 789213
[email protected]
Summary
The aim of this research was to investigate the effects of different diets (control diet based on mixed hay either alone or
supplemented with Vicia faba minor) on peripartum energy/protein balance and productions of Angora goats. Twenty-six
Angora goats (either lactating, “L”, or non-lactating, “A”), aged 2 to 5 years and weighing 33.1 ± 9.2 kg, were allocated
by randomised block design to receive one of two dietary treatments after parturition. One group, kept as a control (C),
was fed mixed hay ad libitum and a mineral-vitamin supplement; goats had access to grass pasture for at least seven hours
per day. The remaining goats (T) were fed the basal diet supplemented during lactation with 300 g/head/day of horse
bean (Vicia faba var. minor). Periodically, blood samples pre– and post-lambing were collected for total protein, albumin,
glucose, urea, triglycerides, beta hydrossibutirrate, non esterified fatty acids and cholesterol determinations. The variations
of body condition score (BCS) and body weight (PV) of goats and kids were registered. Diet T increased total protein
(mmol/l 78.8±1.1 vs 75.6± 1.0; P< 0.05) and urea concentrations (mmol/l 7.1±0.2 vs 5.5±0.2; P< 0.001) in both L and
A goats. Furthermore, in group A, diet T induced an improvement of goats’ BCS (P< 0.001); in group L the effect of
supplementation only resulted in an higher PV of kids (P<0.001).
Introduzione
Negli ultimi anni si è assistito ad un crescente interesse nei riguardi della diversificazione dei sistemi produttivi a favore di
tutte quelle produzioni non in eccedenza nell’ambito dell’Unione Europea (Shahjalal e coll., 1992). La capra d’angora è, tra
gli animali produttori di fibra pregiata, una delle specie con il più elevato rapporto tra qualità del vello prodotto e peso vivo
(Nixon e coll., 1991). Come per le pecore da lana, una nutrizione sbilanciata influisce significativamente sulle caratteristiche
quali-quantitative del mohair e sulle variazioni ponderali degli animali. La produzione di mohair ed il peso vivo sono suscettibili
di essere migliorati, tramite adeguate integrazioni alimentari, in periodi caratterizzati dalla disponibilità di foraggi scadenti;
d’altra parte questo comporta inevitabilmente un aumento dei costi di gestione. Una migliore conoscenza delle relazioni esistenti
tra capacità d’ingestione, nutrizione e produzione di mohair è, quindi, fondamentale per aumentare la produttività e, nello
stesso tempo, razionalizzare gli investimenti. Nel lungo periodo le variazioni nella produzione di mohair e di peso vivo e la
somministrazione di integrazioni alimentari risultano correlate positivamente (McGregor e Hodge, 1989). Tuttavia, i processi
fisiologici che controllano l’incremento di peso vivo e la crescita della fibra differiscono. Per tale motivo modificazioni del piano
alimentare a corto termine possono avere effetti di durata ed ampiezza diverse sui parametri ponderali e su quelli caratteristici della
fibra, nonché comportare possibili squilibri di natura metabolica. L’obiettivo di questa sperimentazione è stato appunto quello
di verificare l’effettiva validità, sia in termini di mantenimento delle riserve energetiche che di miglioramento della qualità delle
produzioni, di integrazioni alimentari nella fase critica della lattazione e dell’accrescimento dei capretti.
Materiale e metodi
Lo studio è stato condotto in un’azienda privata situata su un’area collinare nel comune di Umbertide (PG) nel periodo: Dicembre
2001-Giugno 2002. Per la sperimentazione sono state utilizzate 26 capre d’angora femmine di età compresa tra i 2 e i 5 anni, di
cui 18 a 7-21 giorni dal parto (L) e 8 in asciutta non gravide (A). Gli ani