PROTEIN What - Istituto Zooprofilattico Sperimentale del Piemonte
Transcript
PROTEIN What - Istituto Zooprofilattico Sperimentale del Piemonte
IZSTO Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d’Aosta VI WORKSHOP DEL LABORATORIO NAZIONALE DI RIFERIMENTO (NRL) PER GLI STAFILOCOCCHI COAGULASI POSITIVI COMPRESO S.AUREUS 12 / 13 Dicembre 2013 Analisi in silico e relazione tra enterotossine stafilococciche e tossine ipotetiche in silico analysis and relation between SEs and HPs Guerrino Macori National Reference Laboratory for Coagulase Positive Staphylococci including S.aureus – Torino IZSTO Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d’Aosta VI WORKSHOP DEL LABORATORIO NAZIONALE DI RIFERIMENTO (NRL) PER GLI STAFILOCOCCHI COAGULASI POSITIVI COMPRESO S.AUREUS 12 / 13 Dicembre 2013 in silico analysis and relation between SEs and HPs Summary - Definition of bioinformatic - What is done, units information, scale overview - Databases - Some practices • Reverse vaccinology • Hypotetical proteins and SEs - Conclusion What is Bioinformatics/computational biology? A marriage between biology and informatic VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 What is done in bioinformatics? R&D - Nucleotide and aminoacid sequences, protein domains and protein structures - models Development of new algorithms for large data sets Development and implementation of tools that enable efficient access and management of different types of information VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 “A prerequisite to understanding the complete biology of an organism is the determination of its entire genome sequence” Fleischmann et al. 1995 Whole Genome sequencing (linear sequence of DNA base units – A T C G-) Human genome: 3.12 10*9 bp Whole genome → exponential data → bioinformatic to organize and collect 2000-2001 VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Post-genomic era Is the Sequence sufficient to understand biological function of the organisms? Bioinformatic to analyze in rational manner the genomic data VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 What “units of information” do we deal with bioinformatics? • DNA • RNA • PROTEIN • Sequence • Structure • Evolution • Pathways • Interactions • Mutations Biological data used: • DNA - Genome • RNA - Transcriptome • PROTEIN - Proteome VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 What “units of information” do we deal with bioinformatics? • DNA • RNA • PROTEIN • Simple Sequence Analysis • Database searching • Pairwise analysis • Regulatory Regions • Gene finding • Whole Genome Annotations • Comparative genomics (Species and strains e.g. oldest methods as PFGE) >gi|8886401|gb|AF162269.1| DNA sequences CCCACTCCTCCATCTCACAAACACTTCTCTATACCCAACAATCCCTTTTACAATCCCTGCTCATTTAGTCAA AATGGTCAAGATTGCTGCTATCATCCTCCTCATGGGCATTCTCGCCAATGCTGCCGCCATCCCTGTCATT TCAACACCCAAATTACAGAGCCAACCGGCGAGGGCGACCGTGGGGACGTGGCCGAC VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 What “units of information” do we deal with bioinformatics? • DNA • RNA • PROTEIN •Splice Variants •Tissue specific expression •Structure •Single gene analysis •Experimental data/thousands genes simultaneously (DNA chips, microarray, expressione arrays) VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 What “units of information” do we deal with bioinformatics? • DNA • RNA • PROTEIN • Proteome of an organism • 2D gels • Mass spectromy • Structure: 2D/3D/4D VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Protein analysis: scale overview Organismo Genome (Mb) Genes E. coli 464300 (4300) S. cerevisiae 13,5 (6000) Drosophila melanogaster 165 (13600) Arabidopsis thaliana 119 (25500) Homo sapiens 3300 (30000/40000) S.aureus 2,84 (2700 VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Protein analysis: scale overview Organismo Genome (Mb) Genes E. coli 464300 (4300) S. cerevisiae 13,5 (6000) Drosophila melanogaster 165 (13600) Arabidopsis thaliana 119 (25500) Homo sapiens 3300 (30000/40000) S.aureus 2,84 (2700 VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Protein analysis: scale overview and databases Transcription and translation folding VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 ORF-Finder • Nucleotide sequences → translation (any frame) ORF (Open Reading Frame) discover • ORF: proteic sequence with right lenght for an average protein (> 70-100 aa). • Genome scanned by software for Hypotetical proteins (Hps): possible but not verified VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Protein analysis: scale overview and databases HPs and Functional SEs domain Highlight the similarities and differences of functionally important sites Derive a structural alignment Detect evolutionary relationships can not be perceived by the sequence VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Protein analysis: databases GenBank www.ncbi.nlm.nih.gov nucleotide sequences Ensembl www.ensembl.org human/mouse genome (and others) PubMed www.ncbi.nlm.nih.gov literature references NR www.ncbi.nlm.nih.gov protein sequences SWISS-PROT www.expasy.ch protein sequences InterPro www.ebi.ac.uk protein domains OMIM www.ncbi.nlm.nih.gov genetic diseases Enzymes www.chem.qmul.ac.uk enzymes PDB www.rcsb.org/pdb protein structures KEGG www.genome.ad.jp metabolic pathways VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 NCBI databases VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Proteic sequences databases • Less data than nucleotidic sequences; • Rarely protein seq come from sequencing; • Obtained for nucleotidic seq tradution; www.expasy.org VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Practice • Reverse vaccinology • in-silico analysis and relation between staphylococcal enterotoxins and hypothetical toxins: a prediction study for Staphylococcus aureus VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Practice Reverse vaccinology First genomic approach for the development of a vaccine: The Reverse Vaccinology applied to Neisseria meningitidis Immunogenicity testing in animal models Vaccine VACCINE DEVELOPMENT Express recombinant proteins 1-2 years In silico vaccine candidates Computer Prediction Start From the Whole Genome Sequence VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Practice Reverse vaccinology First genomic approach for the development of a vaccine: The Reverse Vaccinology applied to Neisseria meningitidis ORF prediction on the partial genomic sequence (ORF Finder) Homology searches for all the predicted ORFs (PSI-BLAST, FASTA) Hits found (function assigned) Enzyme, cytoplasmic localization Already known Neisseria antigen No hits found (hypothetical proteins) Homology to bacterial surfaceassociated proteins Localization prediction (PSORT, SignalP, TMPRED) -Secreted -Outer membrane SELECTED DISCARDED -Inner membrane -Periplasmic -Lipoproteins VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 cytoplasmic Practice in-silico analysis and relation between staphylococcal enterotoxins and hypothetical toxins: a prediction study for Staphylococcus aureus Background Staphylococcus aureus carries a large repertoire of virulence factors, including over 40 secreted proteins and enzymes that it uses to establish and maintain infections. • toxic shock syndrome toxin (TSST) • Panton-Valentine leukocidin (PVL) • the exfoliative toxins A and B (ETA and ETB) • the family of staphylococcal enterotoxins A and B (SEA and SEB) and food poisoning S.aureus may produce 21 different SEs - excluding variants species VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Background S.aureus may produce 21 different SEs Toxin Molecular Mass (kDa) Emetic Activity Crystal Structure Solved Gene Accessory genetic element classical Staphylococcal Enterotoxins (SEs) SEA SEB SEC SED SEE 27:01:00 28:04:00 27.5–27.6 26:09:00 26:04:00 yes yes yes yes yes yes yes yes yes no ΦMu50a sea seb sec sed see pZA10, SaPI3 SaPIn1, SaPIm1, SaPImw2, SaPIbov1 pIB485-like Φsab seg seh sei ser ses set egc 1 (v Saβ I); egc 2 (v Saβ III); egc 3; egc 4 MGEmw2/mssa476 seh /seo egc 1 (v Saβ I); egc 2 (v Saβ III) ); egc 3 pIB485-like; pF5 pF5 pF5 selu selv selj selk sell selm seln selo selp selq egc 2 (v Saβ III); egc 3 egc 4 pIB485-like; pF5 SaPIbov1, SaPI5 new types Staphylococcal Enterotoxins (SEs) SEG SEH SEI SER SES SET 27:00:00 25:01:00 24:09:00 27:00:00 26:02:00 22:06 yes yes weak yes yes weak yes yes yes no no no Staphylococcal Enterotoxins-like proteins (SEls) SEl U SEl V SEl J SEl K SEl L SEl M SEl N SEl O SEl P SEl Q 27:01:00 nd 28:05:00 26:00:00 26:00:00 24:08:00 26:01:00 26:07:00 27:00:00 25:00:00 nd nd nd nd no Nd Nd Nd Nd No no no no yes no no no no no no SaPIn1, SaPIm1, SaPImw2, SaPIbov1 egc 1 (v Saβ I); egc 2 (v Saβ III) egcegc 1 (v1 Saβ I); egc 2 (v2 Saβ III);III); egcegc 3; egc (v Saβ I); egc (v Saβ 3; 4 egc 4; MGEmw2/mssa476 seh /seo ΦN315, ΦMu3A SaPI5 VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Background: ‘‘hypothetical proteins’’: • protein that is predicted to be expressed from an Open Reading Frame, but for which there is no experimental evidence of translation • • Substantial fraction of proteomes There is so far no classification, proteins predicted from nucleic acid sequences and that have not been shown to exist by experimental protein chemical evidence. Similarity between S.aureus 13 well known deposited SEs and 50 HPs through following databases: SEA - SEB – SEC – SED – SEG – SEI – SEH – SEK – SEL – SEM – SEN – SEO - SEQ 1. Expasy's Protparam: computation of various physical and chemical parameters for a given entered sequence protein - http://web.expasy.org/protparam/ 2. NCBI Conserved Domains: search for Conserved Domains within a coding nucleotide sequence- http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi 3. PROTEIN DATA BANK - PDB The PDB archive contains information about experimentally-determined structures of proteins, and allows to visualize and align the most similar known structures - http://www.rcsb.org/pdb/home/home.do VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 47/50 HPS have at least one conserved domain The instability index (I.I.) (provides an estimate of the stability of HPs in a test tube) classified 32 protein as stable Within stable HPs: 6 HPs show conserved domain homologies with SEs Staphylococcal/Streptococcal toxin, Oligonucleotide Binding (OB)-fold domain Staphylococcal/Streptococcal toxin and β-grasp domain 6 HPs result unknown function and belonging family of S.aureus uncharacterized proteins: 4 sequences match with an high E-value to well-known proteins (E-value connects the score of an alignment between a user-supplied sequence and a database sequence) VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Background Experimentally-determined structures of the 4 Sequences with the high E-value matched (NCBI Access and Protein code are shown) gi446958341 (1TS2) gi501167136 (1I4G) gi446958339 (1Q1L) gi446958340 (1TS5) “in-silico” analysis of the important functionally domains and protein families demonstrate that 6 of the 50 HPs reveals relation as the same family of SEs. This would provide useful solution for the identification of many hypothetical proteins in databases and prediction of their possible involvement in the mechanisms of foodborne illness. VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Two example: biosequences alignment and algorithmic solutions But we must always remember that: The methods utilized (algorithm for example and modeling) allow you to find the "best" alignment efficiently but do not guarantee that the result is biologically true If the biological sense matchs with function The gene seq of a protein is less conserved than secondary structure, tertiary and quaternary in the course of evolution. two effects: Homologous proteins can have very different sequence and then produce alignments with a low similarity score. If the similarity between two protein sequences is high (statistically significant) is quite reasonable to assume that among them there is a relationship of functional homology. VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013 Grazie Grazieper perl’attenzione l’attenzione VI Workshop NRL – CPS including S.aureus - Torino, 12-13 dicembre 2013