i telomeri - Università Politecnica delle Marche

Commenti

Transcript

i telomeri - Università Politecnica delle Marche
UNIVERSITA POLITECNICA DELLE MARCHE
Facoltà di Medicina e Chirurgia
Scuola di Dottorato in Biotecnologie Biomediche – 11° ciclo
OMEOSTASI DEI TELOMERI NELLE
SINDROMI MIELODISPLASTICHE
Dottoranda
Dott.ssa Eleonora Berardinelli
Tutor
Prof. Pietro Leoni
INDICE
I
ABBREVIAZIONI
III
SOMMARIO
VI
1. INTRODUZIONE
1
1.1. I TELOMERI
1
1.1.1. Scoperta dei Telomeri
1
1.1.2. Struttura E Lunghezza Dei Telomeri Umani
3
1.1.2.1. Il t-loop e le shelterin
3
1.1.2.2. La lunghezza dei telomeri nelle cellule normali
4
1.1.2.3. La lunghezza dei telomeri e l’invecchiamento cellulare
6
1.1.3. La Telomerasi
7
1.1.3.1. Subunità ad RNA (hTR) della telomerasi
8
1.1.3.2. Proteine associate ad hTR
9
1.1.3.3. Subunità catalitica (hTERT) della telomerasi
10
1.1.3.4. Proteine associate ad hTERT
11
1.1.4. Regolazione Dell’attività Della Telomerasi Umana
1.1.4.1. Caratteristiche del gene hTR e sua regolazione trascrizionale
11
12
1.1.4.2. Caratteristiche del gene hTERT e sua regolazione trascrizionale 14
1.1.4.3. Regolazione epigenetica della trascrizione di hTERT
18
1.1.4.4. Ruolo del signalling sulla regolazione di hTERT
20
1.1.4.5.Meccanismo alternativo di allungamento dei telomeri (ALT)
21
1.2. LE SINDROMI MIELODISPLASTICHE
25
1.2.1. Presentazione Clinica
26
1.2.2. La Diagnosi
28
1.2.2.1. Sangue periferico e midollo osseo
28
1.2.2.2. Analisi citogenetica
30
1.2.2.3. Analisi molecolare e mutazioni puntiformi
32
1.2.2.4. Modificazioni epigenetiche
33
1.2.2.5. Citometria a flusso
37
1.2.2.6. Esame istologico del midollo
38
1.2.3. Classificazioni Delle Sindromi Mielodisplastiche
1.2.3.1. Classificazione FAB
38
38
I
1.2.3.2. Classificazione World Health Organization 2001
41
1.2.3.3. Classificazione World Health Organization 2008
40
1.2.4. Fattori Prognostici
43
1.2.4.1. International Prognostic Scoring System
42
1.2.4.2. Cariotipo
44
1.2.4.3. Età
44
1.2.5. Nuovi Fattori Prognostici
45
1.2.5.1. LDH
45
1.2.5.2. Conta piastrinica
46
1.2.5.3. Fibrosi midollare
47
1.2.5.4. Trasfusione dipendenza
47
1.2.5.5. WHO based Prognostic Scoring System
47
1.3. TELOMERI E TELOMERASI NELLE PATOLOGIE ONCOLOGICHE 48
1.3.1. Malattie Con Disordini Dei Telomeri E Cancro
48
1.3.2. Telomeri E Telomerasi Nelle Neoplasie Ematologiche
50
1.3.3. Telomeri E Telomerasi Nelle SMD E Nelle LAM
51
2. SCOPO DELLA TESI
54
3. MATERIALI E METODI
55
3.1. PAZIENTI
55
3.2. PREPARAZIONE DEL CAMPIONE
57
3.3. ANALISI DELLA LUNGHEZZA DEI TELOMERI
57
3.4. ANALISI DELL’ATTIVITÀ TELOMERASICA
59
3.5. ANALISI DELL’ESPRESSIONE GENICA
61
3.6. ANALISI DEL CICLO CELLULARE
65
3.7. ANALISI STATISTICA
65
4. RISULTATI
65
4.1. LUNGHEZZA DEI TELOMERI
66
4.2. ESPRESSIONE DI hTERT
68
4.3. ATTIVITÀ TELOMERASICA
71
4.4. ESPRESSIONE DEI FATTORI DELLA TRASCRIZIONE
73
4.5. CICLO CELLULARE
78
5. DISCUSSIONE
79
6. BIBLIOGRAFIA
84
II
ABBREVIAZIONI
AA
Anemia Aplastica
AAM
Agoaspirato midollare
ALT
Alternative Lengthening of Telomeres
AP
APB
Alkaline phosphatase
ALT-associated PML bodies
bHLHZ
Basic helix-loop-helix zipper
BL
Burkitt's Lymphoma
BSA
CB
Bovine serum albumin
Crisi Blastica
CDR
Commonly deleted region
CMML
Chronic Myelomonocytic Leukaemia
CMN
Cellule Mononucleate
DAP
Death Associated Protein Kinase
DC
Discheratosi Congenita
DDIT 3
DNA-damage-inducible-transcript 3
DKC1
Discheratina
DIG
Digoxigenin
DLCL
Diffuse Large Cell Lymphoma
DNMT
DNA Methyltransferase
dNTP
Deoxy-nucleotide triphosphate
EDTA
FAB
Ethylenediaminetetraacetic acid
French American British
FC
Fase Cronica
FISH
Fluorescent In Situ Hybridization
FL
Follicular Lymphoma
GAPDH
GEP
Glyceraldehyde 3-phosphate dehydrogenase
Gene Expression Profiling
HAT
Histone Acetyl Trasferase
HDAC
Histone Deacetylase
HMT
Histone Methyltransferase
hnRNA
Heterogeneous nuclear ribonucleoproteins
HPV
Human Papilloma Virus
III
hTERT
Human Telomerase Reverse Trascriptase
hTERT-AT
hTERT-All Trascripts
hTERT-FL
hTR
hTERT-Full Length
Human Telomerase RNA Component
IM
Imatinib
IPSS
Intenational Prognostic Scoring System
ISCN
International System for human Cytogenetic Nomenclature
IWGM-MDS
International Working Group on Morphology of Myelodysplastic Syndrom
LAL
Leucemie Acute Linfoblastiche
LAM
Leucemia Mieloide Acuta
LINE-1
Long Interspersed Nucleotipe Elements-1
LLC
Leucemia Linfatica Cronica
LMMC
Leucemia Mielomonocitica Cronica
LnH
MAPK
Linfoma Non-Hodgkin’s
Mitogen-Activated Protein Kinase
MBP
Metal Binding Proteins
MCL
Mantle Cell Lynphoma
MEKK1/ JNK Mitogen-Activated Protein Kinase Kinase Kinase 1/C-Jun-NH2-Kinase
MM
Mieloma Multiplo
MZF-2
Myeloid Zinc Finger Protein 2
MZL
Marginal Zone Lymphomas
NF-Y
Nuclear Factor-Y
NCBI
National Center for Biotechnology Information
OD
Optical Density
p53 o tp53
Tumor Suppression Protein 53
PBS
Phosphate Buffered Saline
PCR
PKC
Polymerase Chain Reaction
Protein Kinase C
PLT
Platelets
PML
Promyelocytic Leukaemia Nuclear Bodies
PMN
Polymorphonuclear Neutrophil
RA
Refractory Anemia
RAEB-1
Refractory Anaemia with Excess of Blasts-1
IV
REAB-2
Refractory Anaemia with Excess of Blasts-2
RAEB-T
Refractory Anaemia with Excess of Blasts in Transformation
RARS
Refractory Anaemia with Ring Sideroblasts
RCMD
Refractory Cytopenia with Multilineage Displasia
RCUD
Refractory Cytopenia with Unilinear Displasia
RN
Refractory Neutropenia
RT
Refractory Thrombocytopenia
SDS
Sodium Dodecyl Phosphate
SEER
Surveillance Epidemiology and End Results
SMD
Sindromi Mielodisplastiche
SMD-AR
Sindromi Mielodisplastiche-Alto Rischio
SMD-BR
Sindromi Mielodisplastiche-Basso Rischio
snoRNA
Small nucleolar RNA
SNP-A
Single Nucleotide Polymorfism-A
SPSS
Statistical Package for the Social Sciences
SSC
Saline Sodium Citrate
TAE
Tris-Acetate EDTA Buffer
TBP
TATA-box binding protein
TEP1
Telomerase associated protein 1
TFs
Transcription Factors
TMM
Telomere lenght maintenance mechanism
TRAP
Telomere Repeat Amplification Protocol
TRF
Telomere Rescriction Fragments
TRF1
Telomere Repeat Binding Factor 1
TRF2
Telomere Repeat Binding Factor 2
TSA
Trichostatin A
VPM
Volume Piastrinico Medio
WHO
World Health Organization
WPSS
WHO based Prognostic Scoring System
WT-1
Wilm’s Tumor 1
V
SOMMARIO
I telomeri sono delle strutture altamente conservate situati nella parte terminale dei
cromosomi degli eucarioti, sono formati da sequenze di DNA (TTAGGG)n ripetuto in tandem
e da proteine ad esse associate. Le regioni telomeriche sono implicate in molteplici funzioni
biologiche.
Le sindromi mielodisplastiche (SMD) rappresentano un insieme di disfunzioni clonali delle
cellule staminali emopoietiche caratterizzate da displasia, ematopoiesi inefficace che
coinvolge una o più linee di maturazione delle cellule mieloidi e da un elevato rischio di
progressione in leucemia acuta mieloide (LAM). In questo studio sono stati analizzati la
lunghezza dei telomeri (TFR), l’attività telomerasica (AT) e l’espressione dei geni hTERT, cmyc, mad1 e p53 nel midollo osseo di pazienti affetti da SMD (n=109), da LAM (n=47) e nei
controlli (n=24). Sono stati suddivisi i pazienti affetti da SMD in due gruppi sulla base dello
score IPSS: pazienti SMD-BR (IPSS basso ed intermedio-1, n=83) e pazienti SMD-AR (IPSS
intermedio-2
ed
alto,
n=20).
Sono
stati
analizzate
separatamente
le
leucemie
mielomonocitiche croniche (LMMC, n=8) e le LAM. La TFR era minore nelle SMD rispetto
ai controlli (p<0.001); tra le SMD la TFR era superiore nelle SMD-BR rispetto alle SMD-AR
(p<0.01), tali dati dimostravano un’accentuata erosione dei telomeri con il progredire della
malattia. I pazienti mostravano un’espressione di hTERT e un’attività telomerasica molto
eterogenee e non si evidenziavano differenze significative. Il gene mad-1 era iperespresso
nelle SMD rispetto ai controlli (p<0.01). L’espressione di c-myc aumentava nel gruppo delle
SMD-AR e nelle LAM (p<0.05 e p<0.01, rispettivamente). Il gene p53 era espresso allo
stesso livello dei controlli in tutti i gruppi di pazienti analizzati. In conclusione l’omeostasi
della regione telomerica, in particolare la lunghezza dei telomeri e l’espressione di alcuni
fattori della trascrizione coinvolti nella sua regolazione, come c-myc e mad-1, potrebbero
essere utilizzati in futuro per stratificare i pazienti in accordo con il sistema di classificazione
del rischio di progressione della sindrome mielodisplastica.
VI
1. INTRODUZIONE
1.1 I TELOMERI
1.1.1 Scoperta Dei Telomeri
I telomeri sono strutture specializzate formate da un complesso di DNA non codificante e
proteine la cui principale funzione è quella di proteggere le estremità dei cromosomi lineari
(de Lange et al., 1990). Sono stati osservati per la prima volta negli anni ‘30-‘40 del secolo
scorso grazie al lavoro indipendente di Herman Müller e Barbara McClintock. Il primo,
irradiando cromosomi di Drosophila melanogaster ai raggi X, notò come le estremità dei
cromosomi irradiati, a differenza del resto del genoma, non presentassero alterazioni quali
delezioni ed inversioni. Ciò grazie alla presenza di una cappello protettivo che Müller stesso
denominò prima "gene terminale" e quindi telomero, dai vocaboli greci "telos" (termine) e
"meros" (parte, Müller 1938). La McClintock descrisse invece come, in Zea mays, la rottura
dei cromosomi si traducesse nella formazione di cromosomi ad anello e dicentrici grazie
all'adesione e alla fusione alle estremità dei frammenti. Ella poté dimostrare che,
indipendentemente dal danno subito, le estremità potevano essere ricostituite dall'acquisizione
di nuovi telomeri. Da queste osservazioni la McClintock, a differenza di quanto fece Müller,
concluse che i telomeri giocano un ruolo cruciale nel mantenimento dell'integrità dei
cromosomi poiché sono strutture aventi la capacità di impedire riarrangiamenti cromosomici
quali le fusione end-to-end e la formazione di cromosomi ad anello e dicentrici (McClintock
1941).
La lunghezza delle sequenze telomeriche nelle cellule somatiche varia a seconda del numero
di divisioni cellulari che una cellula ha subito (Samassekou 2010). Ad ogni ciclo cellulare una
parte della sequenza telomerica viene persa (da 50 a 200 bp ogni ciclo di replicazione) a causa
del problema della replicazione terminale già postulato da James Watson nel 1972 (Watson
1972; Blackburn 2005). Nel modello di replicazione semi-conservativa del DNA, la DNA
polimerasi non riesce a replicare il 3’ del filamento lagging una volta rimosso il primer ad
RNA, determinando un progressivo accorciamento di tale filamento ad ogni fase S del ciclo
cellulare. Negli anni '70 del secolo scorso Alexsei Olovnikov mise in relazione il problema
della replicazione terminale, e quindi del progressivo accorciamento delle sequenze
telomeriche, con gli esperimenti sulla senescenza cellulare e l'inibizione della proliferazione
1
di Leonard Hayflick che hanno portato all'identificazione del cosiddetto ‘limite di Hayflick’,
corrispondente al numero di divisioni cellulari possibili per una determinata cellula (Hayflick
1965). Per Olovnikov, il progressivo accorciamento dei telomeri agisce come un orologio
interno che determina il numero di divisioni che una cellula può effettuare nel corso della sua
vita e quindi controlla il processo dell'invecchiamento cellulare (Olovnikov 1971 e 1973).
Questo pionieristico modello è tutt'ora univocamente accettato dalla comunità scientifica, che
considera l’accorciamento dei telomeri quale orologio molecolare per il ciclo vitale delle
cellule (Wright & Shay, 2001).
Sia Watson che Olovnikov avevano postulato l'esistenza di un meccanismo che permettesse il
mantenimento della lunghezza dei telomeri durante la replicazione del DNA. Il lavoro del
gruppo di Elizabeth Blackburn alla Yale University e di quello di Jack Szostak della Harvard
Medical School a partire dagli anni '80 sono stati fondamentali per gettare luce sulla reale
natura delle sequenze telomeriche e dell'enzima predisposto alla loro sintesi. Applicando la
sequenza esanucleotidica CCCCAA scoperta all'estremità dei cromosomi del micronucleo di
Tetrahymena thermophila dal gruppo della Blackburn (Yao et al., 1981), Szostak riuscì a far
replicare stabilmente dei plasmidi lineari in Saccharomyces cerevisiae. I due ricercatori
conclusero che se il lievito era in grado di riconoscere e utilizzare le estremità provenienti da
un organismo non affine come T. thermophila, il meccanismo di funzionamento dei telomeri e
le stesse sequenze telomeriche erano altamente conservate durante l'evoluzione (Szostak &
Blackburn, 1982; Birmingham 2001). Essi notarono inoltre come dopo diversi cicli di
replicazione in lievito i plasmidi clonati avessero una lunghezza maggiore rispetto all'inizio, e
diedero ragione del fatto che il lievito possedesse un meccanismo di allungamento dei
telomeri (Shampaj et al., 1984). In seguito la Blackburn e la sua studentessa Carol Greider
arrivarono all'identificazione dell'enzima che sintetizza i telomeri, la "telomere terminal
transferase" oggi chiamata telomerasi. Esse furono in grado di dimostrare che estratti cellulari
di T. thermophila avevano la capacità di catalizzare l'inserzione su degli oligonucleotidi di
ripetizione tandem TTGGGG (Greider & Blackburn, 1985). Per questo lavoro, vera pietra
miliare della biologia molecolare, Elizabeth Blackburn e Carol Greider, insieme a Jack
Szostak sono stati insigniti del premio Nobel per la medicina nel 2009.
2
1.1.2. Struttura E Lunghezza Dei Telomeri Umani
1.1.2.1 Il t-loop e le shelterin
Nell’uomo i telomeri sono formati da migliaia di sequenze ripetute TTAGGG (Moyzis et al.,
1988). La struttura telomerica si conforma in modo tale che il filamento 3’, ricco di G e quindi
chiamato G-strand sporge per ca 35-600 nucleotidi per poi ripiegarsi su se stesso e legarsi con
la sequenza complementare al 5’ dell’altro filamento, ricco in C e quindi chiamato C-strand
(Stewart et al., 2003, Makarov et al., 1997; Figura 1). Tale struttura a t-loop viene quindi
decorata con un complesso di sei proteine, denominato shelterin (de Lange 2005 e 2009) che
svolge tre funzioni fondamentali nel meccanismo di regolazione della lunghezza e della
struttura dei telomeri (crf. par. 1.1.2.2). Le shelterin sono TRF1, TRF2, POT1, TPP1, TIN2 e
Rap1 (Figura 1.1 de Lange et al., 2005).
Figura 1.1 Struttura dei telomeri. I telomeri sono composti da sequenze ripetute TTAGGG e da un complesso
proteico, shelterin (in alto a sinistra). La shelterin è formata da proteine specifiche per i telomeri: TRF1 e TRF2
che legano il filamento doppio e POT1 che lega il singolo filamento. A queste sono legate anche TIN2, TPP1 e
Rap1 (in basso a sinistra). Il t-loop dei telomeri con l’invasione del doppio filamento (in alto a destra) (de Lange
et al., 2009).
Le shelterin sono importanti per tre motivi: determinano la struttura dell’estremità del
telomero, sono implicate nella generazione e nella stabilizzazione del t-loop e controllano la
sintesi del DNA telomerico da parte della telomerasi (de Lange 2005). La caratteristica
fondamentale del t-loop è che grazie ad esso la porzione finale risulta nascosta all’interno di
una struttura chiusa non accessibile. Le dimensioni della porzione ad anello non sembrano
essere importanti nella stabilizzazione delle struttura, in quanto in cellule umane sono stati
osservati sia t-loop molto grandi (25 Kb) che molto piccoli (1 Kb). In vitro, TRF2 e TRF1
3
hanno attività di rimodellamento del DNA, importante nella generazione dell’estremità a
singolo filamento del G-strand e quindi nella formazione del t-loop (Griffith et al., 1999;
Stansel et al., 2001). Le shelterin intervengono sulla struttura assunta dal filamento 3’ grazie a
TRF2 e POT1 che ne controllano la lunghezza (van Steensel et al., 1998; Hockemeyer et al.,
2005, Zhu et al., 2003). In particolare POT1 è coinvolta nel controllo dell’attività nucleasica
all’estremità 5’ (Sfeir et al., 2005; Hockemeyer et al., 2005).
Le shelterin giocano un ruolo essenziale nel mantenere la lunghezza dei telomeri entro un
determinato intervallo di valori, regolando l’accesso della telomerasi sui telomeri stessi
attraverso un meccanismo di feedback negativo che agisce in cis. (Smogorzewska & de
Lange, 2004 e riferimenti ivi citati). Se un determinato cromosoma ha telomeri troppo lunghi
questo meccanismo può inibire l’azione della telomerasi. Se invece un cromosoma ha
telomeri troppo corti, il meccanismo di controllo permette l’azione della telomerasi e quindi
l’allungamento del telomero stesso. Le shelterin, ed in particolare la componente POT1
(Loayza & de Lange, 2003; Liu et al., 2004) hanno un ruolo chiave in questo meccanismo
agendo come inibitori sul telomero stesso, con un processo stocastico influenzato dalla
quantità totale di shelterin legate al telomero. Poiché la quantità di shelterin è proporzionale
alla lunghezza delle ripetizioni TTAGGG, i telomeri più lunghi hanno una maggior
concentrazione di inibitori della telomerasi. Mutanti difettivi in POT1 sono infatti
caratterizzati da cromosomi con telomeri lunghi (Loayza & de Lange, 2003).
1.1.2.2 La lunghezza dei telomeri nelle cellule normali
Nell'uomo la lunghezza dei telomeri varia, nella popolazione normale, dalle 5 alle 15 Kb (de
Lange et al., 1990) ed è influenzata dal corredo genetico, dall'età e da fattori ambientali. Vi è
inoltre una differenza d’organo e tessuto specifica. Ad esempio i telomeri degli epatociti fetali
hanno una lunghezza media di 13 Kb, quella delle cellule del sangue da cordone ombelicale di
ca 12 Kb; mentre cellule del sangue midollare di individui adulti varia dalle 10 Kb alle 8.5 Kb
(Vaziri et al., 1994). Analizzando i telomeri di differenti tessuti dello stesso individuo si nota
come la lunghezza media nella corteccia cerebrale e nel miocardio sia maggiore che nel
fegato e nella corteccia renale (Takubo et al., 2002). Un'altra differenziazione si ha
analizzando individui di età diversa. Alla nascita il fegato e la corteccia renale mostrano
telomeri lunghi più di 13,5 Kb mentre il miocardio e la corteccia celebrale hanno telomeri
lunghi meno di 13 Kb (Takubo et al., 2002). Questa differenza tra neonati e adulti può essere
spiegata ipotizzando che cellule dotate di capacità proliferativa diversa possiedono
meccanismi diversi di mantenimento, influenzati anche dal microambiente cellulare (Takubo
4
et al., 2002). È noto che sulla lunghezza dei telomeri agisca anche una componente genetica
che fa si che un individuo che presenta telomeri lunghi per un determinato tipo di tessuto
generalmente ha telomeri lunghi anche in altri tessuti (Takubo et al., 2002). Altri autori
riportano differenze di lunghezza in diversi tipi cellulari all'interno dello stesso tessuto come
nel caso delle sottopopolazioni leucocitarie (Hoffmann et al., 2009; Martens et al., 2002;
Rufer et al., 1998, 1999).
Le cellule staminali adulte hanno telomeri più lunghi delle cellule somatiche cui danno
origine (Flores et al., 2008). Nelle cellule staminali emopoietiche umane i telomeri delle
cellule CD34+CD38− sono più lunghi di quelli delle cellule CD34+CD38+ (Van Ziffle et al.,
2003; Vaziri et al., 1994). Un'altro studio dimostra come le cellule del sangue midollare
abbiano telomeri solo 600 bp più lunghi delle cellule del sangue periferico (Sakoff et al.,
2002).
La lunghezza dei telomeri può variare sia da una cellula all'altra dello stesso tessuto, sia tra un
cromosoma e l'altro all'interno della medesima cellula. Numerosi studi mostrano una rilevante
eterogeneità nello stesso tipo cellulare di uno medesimo individuo (Harley et al., 1990;
Moyzis et al., 1988; Rufer et al., 1998, 1999; Weng et al., 1997). L' eterogeneità a livello
delle braccia di ogni singolo cromosoma è invece stata osservata per la prima volta da
Lansdorp e collaboratori (Lansdorp et al., 1996). I telomeri a livello del 17p, del 19p e del 20q
sono in assoluto i più corti dell'intero genoma, mentre quelli sul 5p, sul 3p, sul 4q e sul 1p
sono i più lunghi (Martens et al., 1998; Mayer et al., 2006; Perner et al., 2003; Samassekou et
al., 2009). Vi è inoltre una differenza tra cromosomi omologhi e tra cromosoma X attivo e
inattivo; in particolare entrambe le braccia del cromosoma attivo hanno telomeri più lunghi di
quelli nel cromosoma X inattivo (Londono-Vallejo et al., 2001; Surralles et al., 1999). La
differenza può arrivare fino alle 6 Kb in cellule senescenti (Baird et al., 2003). Lo studio dei
telomeri sulle singole braccia ha permesso inoltre di stabilire che 12,5 unità di ripetizioni
TTAGGG costituiscono la lunghezza minima di un telomero per impedire la fusione dei
cromosomi in assenza della protezione delle shelterin e di attività telomerasica (Capper et al.,
2007). La lunghezza minima cala a sole sette unità TTAGGG in presenza di attività
telomerasica (Xu & Blackburn, 2007).
L'estrema variabilità nella lunghezza dei telomeri tra individui diversi suggerisce che questa
sia un tratto determinato geneticamente. Lo confermano studi su gemelli monozigotici e
dizigotici e le loro famiglie. In particolare viene dimostrato che la lunghezza dei singoli
telomeri aventi la medesima origine genetica è praticamente identica (Slagboom et al., 1994;
Graakjaer et al., 2003 e 2006). Non è ancora chiaro quale sia il tipo di ereditarietà che
5
controlla la lunghezza dei telomeri. Alcuni dati mostrano una ereditarietà legata all'X (Nawrot
et al., 2004), mentre altri lavori suggeriscono un'ereditarietà di tipo paterno (Njajou et al.,
2007; Nordfjall et al., 2005, 2010). Sono stati identificati numerosi loci che sembrano essere
coinvolti nell'omeostasi della lunghezza dei telomeri tra i quali si annoverano 3p26.1,
10q26.13, 12q12.22, e 14q23.2 (Andrew et al., 2006; Mangino et al., 2008; Vasa-Nicotera et
al., 2005). All'interno della popolazione giapponese è stata identificata una variante T/C
(Timina/Citosina) in posizione −1327 bp del promotore di hTERT legata alla lunghezza dei
telomeri. Gli individui che presentano il genotipo T/T in posizione −1327 hanno telomeri più
lunghi di quelli di individui che hanno genotipo C/C (Matsubara et al., 2006a,b). Questa
correlazione tra genotipo in posizione −1327 bp del promotore di hTERT e lunghezza dei
telomeri non è stata però confermata in altre popolazioni (Nordfjall et al., 2007).
Recentemente è stato associato alla lunghezza dei telomeri un locus che comprende il gene
codificante la componente a RNA della telomerasi (Codd et al., 2010). Oltre la componente
genetica, diversi fattori ambientali come l'obesità, il fumo di sigaretta e lo stress sono stati
negativamente correlati con la lunghezza dei telomeri (Collins et al., 2003; Epel et al., 2004;
Epel 2009; Simon et al., 2006; Valdes et al., 2005).
1.1.2.3 La lunghezza dei telomeri e l’invecchiamento cellulare
Studi sia in vitro che in vivo dimostrano l’esistenza di una correlazione negativa tra l’età di
una cellula e la lunghezza dei suoi telomeri. In coltura, fibroblasti, linfociti e cellule staminali
emopoietiche perdono dalle 37 alle 120 bp ogni divisione cellulare (Harley et al., 1990; Vaziri
et al., 1993, 1994). Di conseguenza, i telomeri vengono considerati alla stregua di un orologio
mitotico per determinare l’età di una cellula o di un tessuto. Studi su individui di età diversa
mettono in evidenza che le estremità telomeriche si accorciano dalle 9 alle 147 bp all’anno, a
seconda dell’organo/tessuto analizzato. Fanno eccezione la corteccia cerebrale e il miocardio
che non mostrano perdite rilevanti (Takubo et al., 2002). Altri studi riportano un tasso di
erosione nei linfociti da sangue periferico di 53 bp/anno, nei granulociti di 39 bp/anno
(Hoffmann et al., 2009), e nel pancreas di 36 bp/anno (Ishii et al., 2006).
Il tasso di erosione dei telomeri è influenzato oltre che dalla capacità di proliferazione, anche
dal sistema di mantenimento dei telomeri stessi e dal microambiente cellulare. Nonostante
l’espressione della telomerasi, le cellule staminali emopoietiche hanno telomeri più corti in
individui di età avanzata e, se coltivate in vitro, perdono in media 1–2 Kb di estremità
telomeriche in sole quattro settimane di coltura (Lee et al., 2003; Vaziri et al., 1994;
Engelhardt et al., 1997). Al contrario nelle cellule della linea germinale (spermatozoi) la
6
lunghezza dei telomeri è positivamente correlata all’età (14,5 Kb negli ultracinquantenni, 12,8
Kb negli individui con meno di vent’anni; Kimura et al., 2008).
Il tasso di perdita di sequenze telomeriche varia con l’età, è più alto nell’infanzia (1 Kb tra gli
0 e i 4 anni di età) e decresce progressivamente dopo i 5 anni di età in cui si stabilizza a meno
di 100 bp all’anno (Frenck et al., 1998). Alla nascita non sembra esserci una differenza tra i
due sessi (Okuda et al., 2002), mentre nell’età adulta i telomeri dei linfociti nei maschi hanno
un tasso di erosione maggiore che nelle femmine, forse a causa dell’effetto degli ormoni
sessuali (Moller et al., 2009).
1.1.3 La Telomerasi
La telomerasi è una DNA polimerasi RNA dipendente che sintetizza l'aggiunta di ripetizioni
telomeriche alle estremità dei cromosomi (Greider & Blackburn, 1985). L’enzima umano è
formato da una subunità catalitica costituita da un polipeptide di 1132 aminoacidi codificato
dal gene hTERT (human Telomerase Reverse Trascriptase; Nakamura et al., 1997; Kilian et
al., 1997; Harrington et al., 1997) e da una componente ad RNA codificata dal gene hTERC
(o hTR) di 450 nucleotidi (Feng et al., 1995), che serve da stampo per la sintesi del DNA
telomerico. Entrambi i geni sono fortemente conservati negli eucarioti e sono stati isolati in
numerosi organismi tra cui i lieviti (Nakamura et al., 1997; Singer & Gottschling, 1994;
Counter et al., 1997), nel topo e in numerosi protozoi (Blasco et al., 1995 e 1997; Greenberg
et al., 1998; Collins & Gandhi, 1998; Lingner et al., 1997; Romero & Blackburn, 1991). Il
fatto che sia possibile ripristinare l'attività telomerasica in cellule telomerasi-negative
coesprimendo hTERT e hTR dimostra che queste due componenti sono i requisiti minimi per
avere attività telomerasica in vitro (Vaziri & Benchimol, 1998; Wen et al., 1998). È
sufficiente però aggiungere un tag al C-terminale della porzione catalitica che l'enzima perde
di funzionalità in vivo (Ouellette et al., 1999; Counter et al., 1998). Sembra chiaro quindi che
l'assemblaggio di una telomerasi funzionante e la sintesi dei telomeri siano processi
multistadio, finemente regolati, che coinvolgono più fattori, tra cui la maturazione, il
processamento e l’accumulo di hTR, il trasporto nel nucleo, modificazioni post-traduzionali di
hTERT, l'assemblaggio tra componente catalitica e quella a RNA, quindi il riconoscimento
del substrato (l'estremità telomerica) e la sintesi di nuovo DNA telomerico (Aisner et al.,
2002). Le proteine associate alla telomerasi sono coinvolte in tutti questi processi e sono
richieste per l’attività e la funzione biologica dell’enzima (Cong 2002). Dati sperimentali
condotti sia in cellule umane che in S. cerevisae mostrano come la telomerasi verosimilmente
7
agisce sotto forma di un complesso contenente 2 o più subunità catalitiche e componenti a
RNA (Beattie et al., 2001; Wenz et al., 2001; Moriarty et al., 2002).
1.1.3.1 Subunità ad RNA (hTR) della telomerasi
È la componente della telomerasi che fornisce lo stampo per l'attività di trascrittasi inversa
della componente catalitica (Feng et al., 1995). È espressa a livelli misurabili in tutti i tessuti
indipendentemente dall'espressione di attività telomerasica e di hTERT, che invece risulta
finemente regolata a più livelli (Avilion et al., 1996; Poole et al., 2001). La sua espressione
aumenta tuttavia di oltre 5 volte nelle cellule cancerose caratterizzate da elevati livelli di
attività telomerasica, fatto che suggerisce anche per hTR un controllo trascrizionale. (Yi et al.,
1999; Kim et al., 1994; Cairney & Keith, 2008).
HTR è trascritto dalla RNA polimerasi II e subisce un processamento all'estremità 3' che porta
alla formazione di un RNA maturo di 451 nucleotidi (Feng et al., 1995). La porzione che
agisce da stampo per la sequenza telomerica è compresa tra i nucleotidi 46 e 53 (Feng et al.,
1995; Mitchell et al., 1999a). Essa cade all'interno della sequenza compresa tra i nucleotidi in
posizione 10 e 159 che costituiscono la minima porzione in grado di interagire con la porzione
catalitica e dare origine ad attività telomerasica in vitro (Beattie et al., 2000). Sebbene si
possano riscontrare divergenze a livello di sequenza, la struttura secondaria dell'RNA
prodotto da hTR è altamente conservata nei vertebrati. Ciò indica l'importanza che tale
struttura tridimensionale svolge nell'interazione con hTERT (Chen et al., 2000).
A livello della struttura secondaria si possono riconoscere quattro domini funzionalmente
conservati: uno pseudonodo (CR2/CR3), un dominio CR4/CR5, un dominio tipo box H/ACA
(CR6/CR8), tipico dei piccoli RNA nucleolari (snoRNA) ed essenziale per la maturazione e
l'accumulo dell'RNA hTR e un dominio CR7 (Chen et al., 2000; Mitchell et al., 1999a;
Mitchell & Collins, 2000; Figura 1.2).
8
Figura 1.2 La struttura secondaria della subunità ad RNA della telomerasi (hTR). In evidenza i domini
conservati (dall’alto): dominio CR4-CR5; dominio dello psudonodo (CR2/CR3); dominio box H/ACA
(CR6/CR8) e dominio CR7 (Chen et al., 2000).
1.1.3.2 Proteine associate ad hTR
I domini conservati individuati nella struttura tridimensionale di hTR sono siti di
riconoscimento di proteine leganti hTR a funzione stabilizzante, di maturazione e di
localizzazione (Chen et al., 2000). Il motivo H/ACA garantisce a hTR l’interazione con
diverse proteine leganti gli snoRNA: la dyskerin (DKC1), hGAR1 (human glycine-and
arginine-rich domain protein 1), NHP2 (H/ACA ribonucleoprotein complex subunit 2),
hNOP10 (Nucleolar protein 10; Dragon 2000; Dez 2001; Mitchell et al., 1999a; Pogacic et
al., 2000). L'interazione con proteine nucleolari suggerisce la possibilità che la telomerasi
possa assemblarsi a livello del nucleolo, come accade per le altre ribonucleoproteine. A
conferma di ciò sono stati identificati su hTERT dei domini di localizzazione nucleolare
(Etheridge et al., 2002).
9
Altre
proteine
leganti
hTR
in
vivo
sono
le
hnRNA
(heterogeneous
nuclear
ribonucleoproteins) C1, C2, A1 e UP1 (Fiset & Chaboy, 2001; Ford et al., 2000; LaBranche
et al., 1998). In particolare C1 e C2 interagiscono specificatamente con un tratto di 6 basi
uridinilato in hTR, promuovendo l'interazione della telomerasi con i telomeri (Ford et al.,
2000). Le proteine A1 e UP1 interagiscono simultaneamente sia con i telomeri che con hTR;
ciò può far supporre che queste abbiano un ruolo fondamentale nell’accesso della telomerasi
ai telomeri (Fiset & Chaboy, 2001; LaBranche et al., 1998).
1.1.3.3 Subunità catalitica (hTERT) della telomerasi
La componente catalitica hTERT è stata purificata inizialmente in Euplotes aediculatus
prendendo il nome di p123 (Lingner et al., 1996 e 1997) che mostrava spiccate analogie con
la proteina Est2p di S. cerevisiae coinvolta nel meccanismo di omeostasi dei telomeri
(Lendvay et al., 1996).
In hTERT sono riconoscibili quattro principali regioni funzionali: un dominio regolativo Nterminale (R), un dominio di legame all'RNA (RB), un dominio tipico delle trascrittasi inverse
(RT) e un dominio di dimerizzazione al C-terminale (C, Figura 1.3; Kelleher et al., 2002;
Dwyer et al., 2007).
Figura 1.3 Struttura del dominio di hTERT. hTERT ha un dominio N-terminale contenente un blocco GQ
(dominio ipomutabile I), un dominio RNA-binding (RB) con all’interno due motivi conservati QFP e T (dominio
ipomutabile III e IV), il dominio della trascrittasi inversa (RT), e un dominio debolmente conservato
all’estensione C-terminale (Dwyer et al., 2007).
L'allineamento delle sequenze primarie delle porzioni catalitiche della telomerasi di numerose
organismi mostra come diversi motivi (GQ, T2, QFP e T) all'interno del dominio regolativo e
di legame all'RNA sia conservato (Figura 1.3). Inoltre i motivi individuati nel dominio RT
sono comuni alle altre retrotrascrittasi umane (Figura 1.3, Dwyer et al., 2007). Da notare la
presenza di un tipico motivo delle telomerasi, il motivo T all’interno del dominio RB.
10
Oltre la complessa regolazione trascrizionale che sarà ampiamente discussa più avanti,
l'attività telomerasica subisce un controllo posttraduzionale attraverso un meccanismo
positivo di fosforilazione ed uno negativo di defosforilazione (Li et al., 1997 e 1998).
1.1.3.4 Proteine associate ad hTERT
In estratti cellulari di Tetrahymena thermophila due proteine, chiamate p80 e p95, vengono
purificate con l'attività telomerasica (Collins et al., 1995). Esse rappresentano le prime
proteine associate alla porzione catalitica della telomerasi e, sebbene non siano essenziali
all'attività, giocano un ruolo importante nell'omeostasi dei telomeri (Mason et al., 2001;
Miller & Collins, 2000). L’omologo di mammifero di p80, TEP1 (telomerase-associated
protein 1) è stato identificato nell'uomo, nel topo e nel ratto. TEP1 contiene un dominio Cterminale che interagisce con la porzione catalitica e un dominio N-terminale che interagisce
con l'RNA (Harrington et al., 1997; Nakayama et al., 1997). Nonostante l’interazione con
entrambe le subunità della telomerasi, TEP1 non sembra essere essenziale alla sua attività
(Majumdar et al., 2001). Il folding della porzione catalitica è guidato dal complesso di
chaperonine hsp90 e p23. Al contrario di ciò che accade nelle altre trascrittasi inverse, hsp90 e
p23 rimangono stabilmente associate alla proteina anche a folding avvenuto (Holt et al.,
1999). Si pensa che il legame stabile tra porzione catalitica e RNA tipica della telomerasi, ma
non delle altre trascrittasi inverse, sia la causa della necessità di trattenere le chaperonine per
mantenere la corretta struttura tridimensionale durante la sintesi dei telomeri. (Forsythe et al.,
2001).
La regione al C-terminale di hTERT interagisce, sia in vitro che in vivo, con proteine della
famiglia 14-3-3 responsabili della localizzazione subcellulare delle proteine con cui
interagiscono (Seimiya et al., 2000; Muslin & Xing, 2000). Mutazioni di hTERT nella
regione che interagisce con 14-3-3 portano all’abolizione dell’interazione e alla conseguente
localizzazione citoplasmatica di hTERT (Seimiya et al., 2000).
1.1.4 Regolazione Dell’attività Della Telomerasi Umana
Di norma le cellule somatiche sono prive di attività telomerasica misurabile con le comuni
metodiche di rilevazione. Nell’individuo adulto quelle cellule che sono soggette a continui
cicli di replicazione senza andare incontro a senescenza, quali i linfociti attivati, le cellule
staminali emopoietiche midollari, le cellule germinali, le cellule dei follicoli piliferi, le cellule
dell’endometrio, sono invece caratterizzate dall’espressione di attività telomerasica necessaria
11
al mantenimento dell’omeostasi dei telomeri e alla stabilità genomica (Kim et al., 1994).
Durante lo sviluppo embrionale la telomerasi è attiva già dallo stadio di blastocisti e permane
nella maggior parte dei tessuti embrionali fino alla ventesima settimana di gestazione, dopo
della quale i livelli tendono ad abbassarsi (Wrigth et al., 1996; Bachor et al., 1999). I tessuti
fetali in cui la telomerasi rimane attiva più a lungo sono: il fegato, il polmone, la milza e i
testicoli, mentre nel cuore, nel cervello e nei reni i livelli si abbassono più precocemente
(Ulaner & Giudice, 1997). Nel cuore la perdita di attività telomerasica è concomitante con la
perdita dell’espressione dell’mRNA di hTERT mentre nei reni è contemporanea ad un
cambiamento nel pattern di splicing dell’pre-mRNA di hTERT (Ulaner et al., 1998). Quanto
detto suggerisce l’esistenza di una regolazione generale dell’attività telomerasica che viene
“spenta” nelle cellule somatiche e rimane “accesa” in particolari tessuti. La deregolazione
dell’espressione della telomerasi è stata strettamente associata a numerose patologie umane
(Marciniak & Guarente, 2001). Ne è un esempio la Discheratosi Congenita in cui mutazioni a
livello di hTR o del gene codificante la discheratina determinano una mancata attivazione
della telomerasi con un conseguente rinnovo difettoso degli epiteli e una emopoiesi
inefficiente (Mitchell et al., 1999b; Vulliamy et al., 2001). L’attività telomerasica è sovraregolata in circa il 90% dei tumori solidi ed emopoietici, a conferma del fatto che il controllo
della lunghezza dei telomeri è intimamente connesso con la capacità proliferativa delle cellule
(Kim et al., 1994; Shay & Bacchetti, 1997).
L’attività telomerasica è finemente regolata attraverso diversi meccanismi che agiscono a più
livelli. In primis vi è la regolazione trascrizionale, attiva sia sul promotore di hTERT che su
quello di hTR. Per molti anni gli studi sulla regolazione si sono incentrati quasi
esclusivamente sul promotore di hTERT in quanto la visione classica della regolazione della
telomerasi si basa sulla considerazione che la disponibilità di hTERT fosse il fattore limitante
e che hTR fosse ubiquitariamente espresso indipendentemente dall’espressione dell’attività
telomerasica (Ducrest et al., 2002; Liu et al., 2000; Cairney & Keith, 2008). Vi è quindi il
controllo del processamento degli RNA prodotti a partire da hTERT e hTR, il controllo della
traduzione della porzione catalitica e del suo inport nucleare, l’assemblaggio della
ribonucleoproteina completa e funzionante e l’accesso alle estremità telomeriche.
1.1.4.1 Caratteristiche del gene hTR e della sua regolazione trascrizionale
HTR è stato il primo componente della telomerasi ad essere stato clonato nel 1995. Il suo
ruolo nel meccanismo di tumorogenesi è stato ipotizzato fin dalla sua scoperta in quanto hTR
è di norma iper-espresso nelle cellule trasformate e la sua inibizione specifica in vitro causa
12
un accorciamento della lunghezza dei telomeri ed una riduzione dell’attività telomerisica in
linee cellulari immortalizzate (Feng et al., 1995). Il gene hTR si trova in singola copia in
posizione 3q26.3, regione cromosomica che risulta comunemente amplificata nelle cellule
cancerose dei tumori solidi (Soder et al., 1997).
Il meccanismo fondamentale che controlla l’espressione genica di hTR è la regolazione
trascrizionale. Il promotore contiene una CCAAT box vicino al sito di inizio della trascrizione
oltre ad una TATA box sul filamento complementare come tipico dei geni trascritti dalla
RNA polimerasi II (Zhao et al., 1998). La regione minima richiesta per l’attività del
promotore parte da 272 bp a monte del sito di inizio della trascrizione contenente 4 CG-box,
siti di legame per i fattori trascrizionali della famiglia Sp1 (Sp1 ad azione attivante, Sp3 ad
azione reprimente), di cui tre posizionati a valle della CCAAT box con azione reprimente la
trascrizione, e uno a monte della CCAAT box, con azione positiva sulla trascrizione (Zhao et
al., 2000 e 2003). Il sito immediatamente a valle della CCAAT box svolge l’azione repressiva
più forte a causa della sua prossimità con il sito di legame per il Nuclear factor-Y (NF-Y).
L’oncosoppressore pRb ha azione positiva, ma agisce in maniera indiretta modulando sia Sp1
che NF-Y (Zhao et al., 2003).
Figura 1.4 Regolazione trascrizionale di hTR. Sono evidenziati la sequenza CCAAT legante il complesso NF-Y,
la TATA box e i siti di legame per Sp1. (da http://www.biocarta.com/pathfiles/m_tercPathway.asp, non
modificato).
13
La modulazione di Sp1, attraverso cicli di fosforilazione e defosforilazione, è mediata dalla
cascata di trasmissione del segnale delle mitogen-activated protein kinase (MAPK). È perciò
stato ipotizzato un coinvolgimento delle MAPK sulla regolazione positiva dell’attività del
promotore hTR (Cairney & Keith, 2008). Un’altra chinasi coinvolta, che però regola
negativamente l’attività di hTR, è la mitogen-activated protein kinase kinase kinase 1
(MEKK1)/c-jun-NH2-kinase (JNK) che dirige l’attività e l’espressione del promotore di hTR
attraverso il legame con Sp3 (Bilsland et al., 2006).
Le analisi di sequenza hanno dimostrato la presenza di isole CpG nelle zone regolative del
gene hTR facendo ipotizzare che la metilazione potesse giocare un ruolo per la sua
regolazione genica. È stato invece dimostrato che i livelli di metilazione del promotore non
sono correlati con il grado di espressione di hTR, sia nelle cellule normali che in quelle
tumorali, indipendentemente dall’attività telomerasica (Guilleret et al., 2002a). Esiste invece
una connessione con l’ipermetilazione del promotore hTR e la repressione dell’espressione di
hTR in linee cellulari ALT (Alternative Lengthening of Telemeres, cfr. par. 1.1.4.5) che
suggerisce l’esistenza di meccanismi di regolazione contesto specifici (Hoare et al., 2001).
1.1.4.2 Caratteristiche del gene hTERT e della sua regolazione trascrizionale
Il gene hTERT, presente in singola copia in posizione 5p15.23, è lungo ca 41 Kb di DNA e
codifica un mRNA formato da 16 esoni e 15 introni (Figura 1.5; Cong et al., 1999; Bryce et
al., 2000). Come nel caso di hTR, la regione che lo contiene è frequentemente amplificata in
numerose neoplasie, determinando così un aumento del dosaggio genico di hTERT (Saretzki
et al., 2002). Il gene hTERT, in particolare durante lo sviluppo embrionale, è sottoposto a
splicing alternativo tessuto-specifico che è in grado di modulare la funzionalità della
telomerasi (Ulaner et al., 1998; Ulaner et al., 2000). Tra i vari prodotti genici ci sono: il
trascritto full-length che è l’unico ad essere efficacemente tradotto nella proteina attiva, un
trascritto denominato hTERT a cui mancano 36 nt al 5’ dell’esone 6 (hTERTα sembra avere
un’azione inibitrice dell’attività telomerasica), un trascritto denominato hTERT a cui
mancano gli esoni 7 e 8 e altri vari prodotti dati da inserzioni più o meno estese, che sono
prodotti durante lo sviluppo ma non producono la proteina funzionante ed hanno una qualche
funzione regolatrice (Cong et al., 2002; Colgin et al., 2000; Yi et al., 2000).
14
Figura 1.5 Struttura del gene hTERT. Il gene hTERT (5p15.33) è formato da in 16 esoni e 15 introni a ca 2 Mb
dai telomeri. Sono presenti: il dominio specifico della telomerasi (dominio T), il dominio della trascrittasi
inversa (dominio RT) e la regione al C-terminale della proteina hTERT (Cong et al., 2002).
Figura 1.6 Regolazione trascrizionale del promotore di hTERT in cui sono evidenziati gli attivatori (frecce
verdi) i repressori (frecce rosse) e i principali siti di legame per i fattori della trascrizione descritti nel testo (da
Cairney & Keith, 2008).
15
La sequenza minima richiesta per l’attività del promotore di hTERT in vitro è contenuta nella
regione tra l’inizio della traduzione e 330 bp a monte. L’ analisi della sequenza rivela che il
promotore di hTERT è carente sia del TATA box che del CCAAT box, ma contiene numerose
isole CpG per il controllo epigenetico, 5 CG-box per i fattori di trascrizione della famiglia
Sp1 (Kyo et al., 2000), 2 E-box (5’-CACGTG, Wick et al., 1999; Horikawa et al., 1999)
riconosciuti dalla famiglia c-myc/max/mad e di numerosi altri fattori della trascrizione a
effetto positivo e negativo riportati qui di seguito.
C-myc. C-myc è un oncogene membro della famiglia c-myc/max/mad, fondamentale nel
controllo della proliferazione cellulare, della differenziazione e dell’apoptosi (Grandori et al.,
2000). Lesioni a suo carico o nella sua regolazione sono correlate all’insorgenza di numerose
patologie oncologiche (DePinho et al., 1991). La famiglia c-myc/max/mad codifica dei fattori
trascrizionali caratterizzati da un dominio attivatore al N-terminale e un dominio zip elicaloop-elica (basic-helix-loop-helix-zipper, bHLHZ) al C-terminale. Sia c-myc che mad
possono dimerizzare con max ma il loro legame porta ad effetti opposti: infatti l’eterodimero
c-myc/max attiva l’espressione genica, mentre l’eterodimero mad/max compete con cmyc/max per il legame l’E-box del promotore, reprimendo l’espressione genica (Grandori et
al., 2000). Il livello di espressione di c-myc, in molti casi, sembra essere confrontabile con
quello di hTERT: alto nelle cellule immortalizzate e basso in quelle in senescenza (Wang et
al., 1998).
Sp1. L’azione di Sp1 sui 5 CG-box localizzati tra i 2 E-box presenti è essenziale per l’inizio
della trascrizione di hTERT (Kyo et al., 2000). Sp1 interagisce con i componenti del
meccanismo generale di trascrizione come le TATA-box binding protein (TBP) e i fattori
associati a TBP per aiutare l’inizio della trascrizione nei promotori, come hTERT, mancanti di
sequenza TATA (Emili et al., 1994; Cong & Bacchetti, 2000).
Human papillomavirus 16 E16. I papilloma virus umani (HPVs) sono associati a lesioni
ano-genitali che possono portare alla formazione di cellule cancerose (zur Hausen 2000). Il
gene virale E6 contribuisce all’immortalizzazione delle cellule infettate attraverso la
promozione dell’espressione di hTERT e alla conseguente attivazione della telomerasi con un
meccanismo dipendente da c-myc e da p53 (Wang et al., 1998; Veldman et al., 2001).
Ormoni steroidei. L’attività della telomerasi umana è rilevabile nell’endometrio sano umano
durante il ciclo mestruale ed è strettamente correlata con l’attività proliferativa delle cellule
dell’endometrio, suggerendo che gli ormoni steroidei sessuali regolino l’attività telomerasica
(Kyo et al., 1997). Le analisi di sequenza hanno evidenziato nel promotore hTERT due
elementi sensibili agli estrogeni in posizione -950 bp e in posizione -2754 bp a monte del sito
16
di inizio della traduzione (Kyo et al., 1999). Molti studi mostrano come la regolazione
trascrizionale di hTERT sia direttamente correlata agli estrogeni nei tessuti ormone-sensibili
(Misiti et al., 2000). L’attivazione del promotore hTERT da parte degli estrogeni è stata
osservata anche nel cancro al seno dove l’elemento estrogeno-sensibile in posizione -2754 bp
ha un ruolo fondamentale sia nell’attivazione diretta di hTERT che nell’attivazione indiretta
attraverso l’induzione di c-myc estrogeno-dipendente (Kyo et al., 1999). Il promotore hTERT
è inoltre target dell’azione del progesterone, antagonista degli estrogeni, di cui promuove
l’inibizione dell’attivazione estrogeno-indotta (Wang et al., 2000).
Mad-1. Mad-1 è un membro della famiglia c-myc/max/mad, ed è attivo in forma
eterodimerica mad/max in competizione con l’eterodimero c-myc/max per il legame con l’Ebox (Grandori et al., 2000). Nelle cellule proliferanti in cui vengono espressi sia hTERT che
la telomerasi, gli E-box del promotore hTERT sono occupati dall’eterodimero c-myc/max,
mentre nelle cellule senescenti questo eterodimero viene scambiato con mad/max portando
alla repressione dell’espressione genica e dell’attività telomerasica (Xu et al., 2001). In più cmyc è iperespresso nelle cellule positive alla telomerasi, come le cellulare immortali e le
cellule tumorali, mentre l’espressione di mad-1 è di solito bassa. La situazione si inverte nelle
cellule umane somatiche e nelle cellule differenziate, in cui hTERT viene represso, dove la
concentrazione di mad-1 è di gran lunga maggiore rispetto a quella di c-myc (Cong et al.,
2002).
Wilm’s tumor 1 tumor suppressor. Il gene del tumore di Wilm (WT1) codifica un fattore
della trascrizione attivo in fase embrionale e in numerosi tumori solidi ed ematologici (Oh et
al., 1999, Sugiyama 2001). A seconda del contesto, può fungere sia da attivatore che da
repressore della trascrizione. Sul promotore di hTERT è presente un sito di legame specifico a
-352 bp a monte dell’inizio della traduzione che implica quindi un’azione diretta di WT1 nella
repressione di hTERT durante la differenziazione cellulare (Englert et al., 1998, Oh et al.,
1999).
p53. La tumor suppression protein 53 (TP53 o p53) è un fattore trascrizionale che inducendo
l’arresto del ciclo cellulare e favorendo l’apoptosi in risposta a vari tipi di danno cellulare,
determina l’arresto del processo tumorogenico (Levine 1997; Asker et al., 1999). Vari studi
hanno dimostrato che p53 inibisce l’attività della telomerasi attraverso la repressione
trascrizionale di hTERT indipendentemente dall’arresto del ciclo cellulare o dall’apoptosi ma
con la mediazione di Sp1 (Xu et al., 2000).
MZF-2 e E2F-1. Sul promotore di hTERT sono stati riscontrati anche siti di legame per E2F1 e MZF-2 (Myeloid zinc finger protein 2), due fattori di trascrizione che agiscono
17
reprimendone la trascrizione (Crowe & Nguyen, 2001; Fujimoto et al., 2000). MZF-2 è il
fattore trascrizionale con il sito di legame più lontano dal core del promotore, si lega in una
regione tra -594 bp e -764 bp a monte dall’ATG (Fujimoto et al., 2000), mentre per E2F-1
esistono due siti di legame localizzati in prossimità del sito di inizio della traduzione (Won et
al., 2002). Per entrambi i fattori trascrizionali una loro iperespressione porta ad una
repressione dell’espressione di hTERT e ad una diminuzione dell’attività della telomerasi
(Crowe & Nguyen, 2001; Cong et al., 2002).
1.1.4.3 Regolazione epigenetica della trascrizione di hTERT
La metilazione della citosina presente nelle isole CpG localizzate soprattutto nei promotori
dei geni eucariotici è uno dei meccanismi principali di repressione genica (Horikawa &
Barrett, 2003). Durante il processo di trasformazione cancerosa determinati geni vengono
silenziati a seguito della metilazione del loro promotore, determinando i classici fenotipi
cancerosi come la perdita del controllo del ciclo cellulare, l’instabilità genomica o la capacità
di produrre metastasi (Esteller 2002).
La presenza di isole CpG nel promotore di hTERT porta ad ipotizzare una correlazione
generale tra la metilazione del promotore e la sua espressione. Le analisi effettuate da gruppi
diversi portano però a risultati contrastanti: mentre alcuni hanno riscontrato la correlazione tra
metilazione e repressione di hTERT (Shin et al., 2003; Lopatina et al., 2003; Liu et al., 2004)
altri gruppi non riportano una significativa correlazione tra espressione e lo stato
metilazionale (Devereux et al., 1999; Dessain et al., 2000), altri ancora invece hanno messo in
evidenza come l’ipermetilazione delle isole CpG si osservasse anche in cellule cancerose
hTERT-positive e come l’ipometilazione fosse tipica delle normali cellule hTERT-negative
(Guilleret et al., 2002b). Solo in tempi più recenti si è visto che nelle cellule cancerose
telomerasi-positive almeno uno dei due alleli di hTERT presenta una regione ipometilata in
prossimità del punto di inizio della trascrizione, nonostante l’elevato livello di metilazione in
regioni più a monte (Zinn et al., 2007). Questi autori hanno inoltre ipotizzato che, in questo
contesto particolare, rimodellamenti cromatinici a carattere positivo a livello della regione
ipometilata giocano un ruolo nella regolazione di hTERT. I rimodellamenti cromatinici indotti
da modificazioni (acetilazione/metilazione) delle proteine istoniche sono dei potenti regolatori
dell’espressione genica (Stein et al., 2000). Trattando le cellule con tricostatina A (TSA), un
potente inibitore dell’istone deacetilasi (HDAC) si ha un forte aumento dell’espressione di
hTERT e dell’attività telomerasica nelle cellule normali ma non in quelle cancerose. Dati
18
sperimentali portano a ipotizzare un meccanismo che coinvolge Sp1 nel suo sito di legame
presente nella regione interessata (Figura1.7; Cong & Bacchetti, 2000; Takakura et al., 1999).
A
B
Figura 1.7 Regolazione trascizionale (A) e rimodellamento cromatinico (B) del promotore del gene hTERT. A)
Sono evidenziati i fattori della trascrizione, +1 indica il sito di inizio della trascrizione. B) Me, metilazione degli
istoni; Ac, acetilazione degli istoni (da Kyo et al., 2008 modificato).
Sebbene Sp1 rientri nella categoria degli attivatori trascrizionali di hTERT, la sua azione
sembra essere duplice a seconda del microambiente cellulare. È noto infatti che Sp1 può
interagire con HDAC, convogliarlo sul promotore di hTERT, promuovere la deacetilazione
degli istoni e quindi la repressione della trascrizione (Suzuki et al., 2000). Sp1 interagisce
però anche con p300, un coattivatore trascrizionale che possiede attività istoneacetiltransferasica (HAT) che porta quindi all’attivazione del promotore (Suzuki et al., 2000).
Rimodellamenti cromatinici mediati dall’acetilazione/deacetilazione degli istoni rientrano
anche nel meccanismo d’azione della famiglia c-myc/mad/max. Nelle cellule leucemiche il
complesso c-myc/max è associato ad istoni acetilati e quindi a hTERT attivamente espresso. Il
19
complesso antagonista mad/max è associato a istoni deacetilati e a un abbassamento
dell’espressione di hTERT (Xu et al., 2001).
Sulla regolazione di hTERT interviene anche la metilazione degli istoni. In cellule tumorali
telomerasi positive la forte metilazione dell’istone H3-H4 è strettamente associata ad un’alta
espressione di hTERT (Atkinson et al., 2005). Il promotore di hTERT è un target di SMYD3,
un’istone metiltransferasi specifica per H3-H4 che si lega a tre sequenze bersaglio CCCTCCC
localizzate tra -60 bp e -30 bp dal sito di inizio della traduzione (Liu et al., 2007). Questi
autori hanno ipotizzato un modello, riassunto in Figura 1.7, secondo cui il legame di SMYD3
sul promotore hTERT determina la metilazione di H3 che funge da evento scatenante per il
richiamo di HAT e l’accesso di Sp1 e c-myc sui loro siti di legame su hTERT.
1.1.4.4 Ruolo del signalling sulla regolazione di hTERT
Analizzando l’espressione di hTERT e l’attività telomerasica di numerosi tessuti, sia sani che
tumorali, si sono osservate delle discordanze in quanto elevati livelli di mRNA non sempre
erano associati ad elevati livelli di attività. Ciò porta a ipotizzare che l’espressione di hTERT
non è sempre sufficiente a produrre una telomerasi attiva e che quindi le modificazioni
posttraduzionali, come la fosforilazione/defosforilazione, giocano un ruolo nel cambiamento
tra stato attivo e inattivo della telomerasi (Ulaner et al., 2000; Rohde et al., 2000; Cong et al.,
2002). È noto infatti che il trattamento con imatinib mesilato, un potente inibitore della tirosin
chinasi, è in grado di abbassare i livelli di attività telomerasica in cellule leucemiche telomersi
positive (Uziel et al., 2005).
La protein chinasi C (PKC) fa parte di una larga famiglia di chinasi fosfolipide dipendenti,
coinvolta nella crescita cellulare, nella differenziazione e nella carcinogenesi. La famiglia
consiste di circa 10 isoforme con più di 100 substrati differenti (Liu 1996). Varie isoforme di
PKC sono coinvolte nella regolazione dell’attività telomerasica in differenti tipi cellulari e in
diverse condizioni fisiologiche. Ad esempio PKC è coinvolta nella fosforilazione di hTERT
e nella regolazione dell’attività telomerasica nelle cellule di cancro al seno (Li et al., 1998).
La protein chinasi B (o Atk chinasi) è coinvolta nell’attivazione della telomerasi umana
attraverso la fosforilazione in due siti specifici (Breitschopf et al., 2001; Kang et al., 1999).
Al contrario di PKC e Atk, la tirosin chinasi c-Abl, fosforilando hTERT inibisce l’attività
telomerasica (Kharbanda et al., 2000).
La fosforilazione di hTERT è importante anche durante l’attivazione dei linfociti CD4. In
questo contesto l’induzione dell’attività telomerasica è indipendente dall’aumento della
quantità di proteina stessa. Il meccanismo di attivazione prevede la fosforilazione di hTERT e
20
la sua traslocazione dal citoplasma, dove è inattiva, al nucleo dove assume la forma attiva
(Liu et al., 2001). Questo meccanismo si riscontra anche durante la proliferazione delle
cellule della muscolatura liscia vascolare di ratto, dove la fosforilazione di hTERT ne
determina la traslocazione citoplasma-nucleo e la conseguente attivazione (Minamino et al.,
2001).
1.1.4.5 Meccanismo alternativo di allungamento dei telomeri (ALT)
Tutte le linee cellulari umane immortalizzate hanno un meccanismo di mantenimento della
lunghezza dei telomeri (telomere length maintenance mechanism, TMM) per compensare
l’accorciamento dei telomeri che accompagna la proliferazione cellulare (Colgin & Reddel,
1999; Henson & Reddel, 2010). Oltre al già descritto meccanismo che coinvolge la
telomerasi, è stata evidenziata la presenza di un meccanismo alternativo indipendente dalla
telomerasi stessa detto ‘Alternative Lengthening of Telomeres’ (ALT) (Bryan et al., 1995). Fu
scoperto per primo nei lieviti, si notò anche nelle cellule di mammifero, dove si ipotizzò la
presenza di questo meccanismo alternativo grazie all’analisi della lunghezza dei telomeri nelle
cellule immortalizzate telomerasi-negative. In queste cellule la lunghezza viene infatti
mantenuta costante anche dopo centinaia di duplicazioni senza l’intervento della telomerasi
(Bryan et al., 1995; Rogan et al., 1995).
Circa il 90-95 % dei tumori umani e circa il 60-70 % delle linee cellulari immortalizzate sono
telomerasi-positivi (Shay & Bacchetti, 1997). Il restante 30-40 % delle cellule immortalizzate
ed il 5-10 % di quelle cancerose sono telomerasi-negative e quindi usano il meccanismo ALT
(Bryan et al., 1995; Henson et al., 2002). Anche se la definizione di ALT comprende tutti i
meccanismi di mantenimento della lunghezza dei telomeri (TMM) non esistono evidenze che
portano a pensare all’esistenza di più di un meccanismo ALT (Bryan & Reddel, 1997).
I telomeri delle cellule ALT conservano diverse caratteristiche canoniche, come la presenza
delle ripetizioni TTAGGG nel doppio filamento con una coda terminale a singolo filamento
ricca di G (G-tail), la presenza del complesso della shelterin e di altre proteine associate ai
telomeri, e l’abilità di formare il t-loop (Cesare & Reddel, 2010). In aggiunta a queste, le
cellule ALT mostrano altre caratteristiche del tutto inusuali, come l’abbondanza di DNA con
sequenza telomerica, non appartenente ai cromosomi. Questo DNA extracromosomale prende
varie forme, nella maggior parte dei casi si trova sotto forma di DNA circolare a doppio
filamento chiamato t-circle (Cesare & Griffith, 2004), DNA circolare parzialmente a singolo
filamento chiamato C-circle o G-circle a seconda di quale base sia più presente (Henson et
21
al., 2009), DNA lineare a doppio filamento (Tokutake et al., 1998), ed un complesso di DNA
ad alto peso molecolare detto ‘t-complex’ (Nabetani & Ishikawa, 2009).
Nelle cellule ALT il DNA dei telomeri (sia cromosomale che extracromosomale) e le proteine
associate ad esso possono presentarsi come ‘promyelocytic leukaemia nuclear bodies’ (PML
nuclear bodies) che nel caso specifico prendono il nome di ‘ALT-associated PML bodies’
(APB; Jensen et al., 2001). Il DNA telomerico presente negli APB può dinamicamente
passare dalla forma cromosomale a quella extracromosomale (Molenaar et al., 2003).
Sebbene gli APB contengano proteine specifiche per la ricombinazione attiva nel meccanismo
ALT, non è ancora chiaro se l’attività ALT stessa abbia sede sugli ABP (Jensen et al., 2001).
La presenza di DNA telomerico all’interno delle APB ha permesso di spiegare la grande
abbondanza di DNA con sequenze telomeriche non appartenente ai cromosomi (Tokutake et
al., 1998) Fondamentale è la stretta correlazione tra la presenza delle APB e quella di ALT,
che porta le APB ad essere ottimi marker per l’individuazione delle cellule ALT+ (Yeager et
al., 1999).
Un’altra caratteristica evidente delle cellule ALT riguarda la loro grande eterogeneità a livello
della lunghezza dei telomeri (Bryan et al., 1995), la loro rapidità nel cambiarla (Perrem et al.,
2001) e l’elevato livello di ricombinazione della regione telomerica (Londono-Vallejo et al.,
2004). Nelle cellule tumorali telomerasi-positive o nelle cellule immortali la lunghezza dei
telomeri è relativamente omogenea, ed è di circa 10 Kb, mentre nelle cellule ALT+ la
lunghezza di media è di circa 20 Kb, con un range che va da meno di 3 Kb a più di 50 Kb
(Opitz et al., 2001). È inoltre stata ipotizzata una correlazione temporale tra l’evento di
immortalizzazione in vitro e la comparsa delle caratteristiche del fenotipo ALT (Yeager et al.,
1999).
22
Figura 1.8 Visualizzazione dei telomeri nelle cellule (a) ALT e in quelle (b) telomerasi-positive grazie alla
l’Ibridazione Fluorescente in situ (Fluorescence in situ hybridization, FISH), si può notare l’eterogeneità nella
lunghezza dei telomeri nelle cellule ALT. È stata usata una sonda fluorescente DNA telomerico-specifica (rosa)
(da Henson et al., 2002).
Anche se ormai è appurato il fatto che il meccanismo delle ALT si basa sulla ricombinazione,
il processo dell’allungamento dei telomeri è ancora in parte sconosciuto (de Boeck et al.,
2009). Gli studi fatti portano a pensare che il modello migliore che spieghi l’attività delle
ALT sia quello in cui una coda di un telomero a singolo filamento invade un telomero a
doppio filamento, o si lega ad un DNA telomerico a singolo filamento, usandolo come stampo
per la sintesi di nuove sequenze telomeriche, o per allungare se stesso. Lo stampo può far
parte dello stesso telomero formando un t-loop, del telomero del cromatide fratello, di un altro
cromosoma o del DNA extracromosomale presente nelle cellule ALT (Cesare & Reddel,
2010).
23
Figura 1.9 Meccanismi di sintesi altenativa del DNA mediati dalla ricombinazione dei telomeri nelle ALT.
L’allungamento può avvenire tramite ricombinazione dello stesso telomero grazie alla formazione di un t-loop al
suo interno (a), al telomero del cromatide fratello (b), di un DNA telomerico lineare extracromosomale (c),o
DNA telomerico circolare extracromosomale (d). I segmenti obliqui di colore grigio indicano il sito di taglio del
filamento ricco di C (da Cesare & Reddel, 2010).
24
1.2 LE SINDROMI MIELODISPLASTICHE
Le Sindromi Mielodisplastiche (SMD) comprendono un ampio spettro di disordini mieloidi
clonali (neoplastici) caratterizzati da emopoiesi inefficace, citopenie, anomalie qualitative
delle cellule del sangue e dei loro precursori, anomalie cromosomiche clonali ed una variabile
probabilità di evolvere in Leucemia Acuta Mieloide (LAM, Lichtman 2000).
Le SMD comprendono entità nosologiche che vanno dall'anemia a decorso indolente, con una
scarsa probabilità di progressione in LAM, alle citopenie multilineari, clinicamente più
difficili da gestire, fino alle LAM oligoblastiche, definite sindromi preleucemiche (HamiltonPaterson 1949).
La proliferazione clonale di cellule emopoietiche multipotenti in questo gruppo di malattie è
accompagnata da effetti molto variabili su tutte e tre le linee cellulari e di solito si associa ad
un'aumentata apoptosi dei precursori midollari. Anomalie qualitative come la forma e la
dimensione delle cellule e degli organelli subcellulari possono essere presenti in ogni linea
cellulare.
L’ incidenza delle SMD è di circa 3 e 12 casi per 100.000 abitanti per anno, con variazioni
legate in parte a vere differenze geografiche e/o etniche e parte alla diversa capacità di
diagnosi e selezione dei singoli centri. Tutti gli studi fatti sono concordi nell'evidenziare un
aumento dell'incidenza correlato all'età (Tabella 1.1), rendendo le SMD un problema di
interesse geriatrico; questo dato è confermato da uno studio di popolazione condotto dal
Surveillance Epidemiology and End Results (SEER) americano (Aul et al., 1992; Williamson
et al., 1994; Rådlund et al., 1995; Maynadié et al., 1996; Bauduer et al., 1998; Iglesias
Gallego et al., 2003; Ma et al., 2007).
L'insorgenza di una SMD prima dei 50 anni è, infatti, abbastanza rara se si fa eccezione per i
pazienti trattati con radio- o chemioterapia eseguite per altre neoplasie (Aul et al., 1992;
Groupe Francais de Morfologie Hematologique 1987; McNally et al., 1997; Luna-Fineman et
al., 1999). L'incidenza delle SMD nell'infanzia (tra 5 mesi e 15 anni) è di circa un caso per
milione per anno. La maggior parte dei casi di SMD nell'infanzia esordisce come ereditarie
predisponenti, come la sindrome di Down e l'anemia di Fanconi (Novitzky 2000; Hasle et al.,
2003; Kardos et al., 2003).
L'incidenza annuale delle SMD dopo i 20 anni aumenta, secondo una funzione logaritmica, da
meno di uno per milione di abitanti, a più di 20 per 100.000 nei settantenni (Eisenstaedt et al.,
2006). L'incidenza nei maschi è maggiore rispetto alle femmine.
25
Incidenza (%) per fasce d’età
< 50
Aul et al., 1992
0,2
Williamson et al., 1994
0,5
Rådlund et al., 1995
0,7
Maynadié et al., 1996
<1
50-59
5,3
Ma et al., 2007
22,8
15,0
49,0
1,6
2,0
 80
70-79
4,9
Bauduer et al., 1998
Iglesias Gallego et al., 2003
60-69
Incidenza
4,1
89,0
15,0
11,0
25,0
(%) globale
12,6
3,5
30,0
7,2
3,2
7,2
0
4,5
6,8
25,5
56,7
8,0
<1
2,2
8,1
21,1
36,3
3,4
Tabella 1.1 Incidenza delle SMD secondo vari studi; da Sindromi mielodisplastiche. Dalla teoria alla pratica
clinica. (da Aloe Spiriti et al., 2007; modificata).
1.2.1 Presentazione Clinica
Il sospetto clinico di SMD è strettamente correlato all’età del paziente. Le indagini
epidemiologiche suggeriscono un aumento esponenziale di incidenza correlato all’aumento
dell’età. Una SMD è un evento eccezionale sotto i 30 anni ed è relativamente frequente in età
avanzata. Il sospetto che deve innescare le procedure diagnostiche iniziali, oltre ai segni ed ai
sintomi, deve tenere in considerazione in primis l’età del paziente.
Anemia. L’anemia ed i sintomi ad essa correlati costituiscono il motivo che induce più
frequentemente a sospettare una SMD. L’85% dei casi si presenta con anemia alla diagnosi
(emoglobina inferiore a 12 g/dl) ed il 25% ha un valore inferiore a 8 g/dl. L’anemia, pur
essendo l’alterazione più frequente, si associa ad altre citopenie in circa la metà dei casi;
un’anemia isolata costituisce l’unica alterazione dell’emocromo in circa il 35% dei casi.
Neutropenia. Talvolta il quadro di esordio di una SMD è una neutropenia isolata che perdura
e peggiora nel tempo. Molti casi sono diagnosticati in modo del tutto occasionale. All’esordio
circa due terzi dei pazienti sono neutropenici, anche se nella maggior parte dei casi si
presentano anche anemici. Normalmente il limite inferiore dei neutrofili (PMN) è considerato
1.500/mmc; in relazione alla conta granulocitaria la neutropenia può essere classificata come
lieve (1.000/mmc < PMN < 1.500/mmc), moderata (500/mmc < PMN < 1.000/mmc) o grave
(PMN < 500/mmc). Un valore di PMN inferiore a 1.000/mmc pone il paziente ad un grave
rischio infettivo.
26
Le infezioni presentano l’esordio clinico di un’elevata percentuale di SMD. Infezioni
polmonari ricorrenti, delle vie urinarie, sepsi ed ascessi cutanei sono le forme più frequenti, di
origine prevalentemente batterica. Le infezioni sono anche la causa più frequente di decesso
nei pazienti affetti da SMD, in particolare nelle forme più ad alto rischio. Ad aumentare il
rischio infettivo contribuiscono anche le alterazioni funzionali dei granulociti che presentano
deficit di chemiotassi, di fagocitosi e di attività battericida (Boogaerts et al., 1983).
Morfologicamente i granulociti si presentano ipogranulati con cromatina addensata. Sul piano
fisiopatologico la neutropenia può essere il risultato di una diminuita produzione midollare, di
un’aumentata distruzione periferica o di un sequestro splenico.
Piastrinopenia. Nell’ambito delle SMD si definisce piastrinopenia una riduzione delle
piastrine (PLT) al di sotto di 100.000/mmc (Greenberg et al., 1998; Kantarjian et al., 2007).
Una conta piastrinica inferiore a 20.000/mmc è considerata ad elevato rischio emorragico
(Kantarjian et al., 2007). La piastrinopenia svolge un ruolo preponderante nel determinare le
complicanze emorragiche nei pazienti affetti da SMD. Nella casistica di 816 pazienti,
arruolati nel 1997 per la messa a punto dell’International Prognostic Scoring System (IPSS), i
piastrinopenici erano solo il 37% del totale (Greenberg et al., 1998). Un’analisi effettuata su
18 studi clinici ha evidenziato un’incidenza media del 65% con un’ampia variabilità oscillante
tra il 23% ed il 93%. La revisione della casistica di 2.410 pazienti mielodisplastici seguiti
all’MD Anderson Cancer Center di Houston identifica un’incidenza del 67% all’esordio
(Kantarjian et al., 2007); si tratta, tuttavia, di una casistica che seleziona un’alta percentuale di
forme secondarie (25%) e di casi con score IPSS intermedio-2 o alto (38%). Una
piastrinopenia isolata è tuttavia una forma di presentazione clinica infrequente che si riscontra
solo nel 7% dei casi.
Pancitopenia. Una citopenia bi- o trilineare costituisce il sintomo d’esordio in circa il 60%
delle SMD e quasi sempre l’anemia è presente. In un soggetto anziano il sospetto di una SMD
si pone in particolare per i casi che si presentano con pancitopenia moderata dove la diagnosi
più frequente è tra un’epatopatia cronica ed una patologia midollare primitiva.
27
1.2.2 La Diagnosi
1.2.2.1 Sangue periferico e midollo osseo
Il percorso che porta alla diagnosi di una SMD si avvale di numerosi strumenti quali
l’emocromo, l’aspirato midollare, la biopsia osteomidollare e l’analisi citogenetica a cui, più
recentemente, si sono aggiunte valutazioni di tipo citofluorimetrico e di biologia molecolare
che, integrandosi, concorrono ad una sempre più precisa definizione diagnostica e prognostica
di questi disordini (Fig. 1.10).
L’emocromo è il primo e più semplice esame di laboratorio che permette di far sospettare una
SMD: il tipico paziente che giunge all’osservazione del Medico è un soggetto anziano con
un’età media di 65-70 anni che presenta una o più citopenie; alcuni pazienti possono
presentare sintomi diversi quali sanguinamenti o sintomi legati ad una infezione o ad una
patologia autoimmune (Heaney & Golde, 1999).
L’esame microscopico ottico dello striscio di sangue periferico, con determinazione della
formula leucocitaria su almeno cento elementi cellulari leucocitari, può dare informazioni
molto utili per una diagnosi differenziale. Al fine di poter rilevare e valutare questi aspetti è
tuttavia necessario che il preparato citologico sia adeguatamente allestito e colorato con
colorazioni tipo May Grumwald Geimsa o similari. L’esame di un preparato citologico di
aspirato midollare, adeguatamente allestito e colorato, rappresenta la più importante indagine
diagnostica in un paziente con sospetta SMD (Valent et al., 2007). Accanto alla colorazione di
May Grumwald Geimsa deve sempre essere allestita anche una colorazione per la
determinazione del ferro (reazione di Perls) per enumerare i sideroblasti ad anello.
Il midollo è generalmente iper- o normocellulato, anche se in alcuni casi può essere
ipocellulato. Per una diagnosi di SMD almeno il 10% delle cellule di una data filiera deve
mostrare una chiara displasia. Poiché il sistema di classificazione si basa, oltre che sulla
valutazione delle alterazioni displastiche, anche sulla determinazione della percentuale delle
cellule blastiche, il loro riconoscimento è di primaria importanza per l’attribuzione dei singoli
casi alle diverse sub-entità.
I mieloblasti sono riconosciuti sulla base di diverse caratteristiche nucleari, tra cui l’elevato
rapporto nucleo/citoplasma, la presenza di nucleoli e la fine cromatina nucleare.
L’International Working Group on Morphology of Myelodysplastic Syndrom, nel 2008,
(IWGM-MDS) ha revisionato una serie di midolli di pazienti affetti da SMD ed ha formulato
alcune raccomandazioni riguardanti l’identificazione ed il conteggio dei blasti anche alla luce
del fatto che la WHO (World Health Organization) non ha mai dato raccomandazioni
28
Figura 1.10 Aspirato midollare: zona di prelievo, cresta iliaca.
specifiche su questo aspetto e che la valutazione dei blasti midollari non è uniforme nella
comune pratica clinica (Mufti et al., 2008).
L’IWGM-MDS ha raccomandato che i mieloblasti siano inoltre classificati come granulati e
non granulati. I blasti agranulati corrispondono ai blasti di tipo I della classificazione FAB
(French-American-British). I blasti granulati sono cellule che hanno le caratteristiche nucleari
dei blasti ma hanno anche granulazioni citoplasmatiche: essi includono i blasti di tipo II della
classificazione FAB ed i blasti di tipo III (Goasguen et al., 1991).
Nelle SMD è pertanto utile individuare le seguenti categorie :
 promielociti normali;
 blasti granulati;
 blasti non granulati;
 promielociti displastici.
Vista l’importanza del riconoscimento delle anemie refrattarie con sideroblasti ad anello,
l’IWGM-MDS ha ridefinito i precisi criteri per il riconoscimento dei sideroblasti ad anello
(Mufti et al., 2008). I sideroblasti ad anello devono rispondere ai seguenti criteri:
 avere almeno cinque granuli a distribuzione perinucleare;
 i granuli possono sia circondare l’intero nucleo, sia essere localizzati in porzioni
dell’area perinucleare o coprire almeno un terzo del nucleo.
L’IWGM-MDS ha inoltre definito tre tipi di sideroblasti ad anello:
29
 tipo I (meno di cinque granuli di ferro nel citoplasma);
 tipo II (cinque o più granuli di ferro ma non in una disposizione perinucleare);
 tipo III o sideroblasti ad anello (cinque o più granuli in posizione perinucleare che
circondano il nucleo o interessano almeno un terzo della circonferenza nucleare).
1.2.2.2 Analisi citogenetica
L’analisi citogenetica midollare è un’indagine essenziale indicata non solo a scopo
diagnostico, per individuare le caratteristiche anomalie cromosomiche, ma anche per
l’importante ruolo prognostico.
Per consenso si ritiene che debbano essere analizzate almeno 20-25 metafasi midollari. Il
cariotipo deve essere riportato secondo le linee guida International System for human
Cytogenetic Nomenclature (ISCN; No authors listed 1981). Sulla base di queste linee guida si
definisce “clone” la presenza di due cellule midollari che mostrano un’anomalia strutturale o
un’acquisizione di materiale cromosomico o di almeno tre cellule midollari che presentino la
stessa perdita di materiale cromosomico. Un cariotipo complesso è invece definito dalla
presenza di almeno tre lesioni citogenetiche clonali indipendenti in almeno due cellule.
Durante il follow-up il cariotipo dovrebbe essere ripetuto, in caso di progressione, ad almeno
6-12 mesi di distanza. Nei casi dubbi (per esempio in caso di ridotto numero di metafasi)
viene raccomandata l’indagine di Fluorescent In Situ Hybridization (FISH) in interfase
(Valent et al., 2007) che includa almeno le sonde per studiare le seguenti regioni
cromosomiche: 5q31, CEP7, 7q31, CEP8, 20q, CEPY e p53.
Alterazioni cromosomiche sono dimostrabili nel 40-70% dei pazienti affetti da SMD; nelle
forme secondarie l’incidenza si aggira attorno al 90% (Mufti 1992; Rigolin et al., 1998; Olney
& Le Beau, 2001; Haase et al., 2007). Le delezioni cromosomiche sono le alterazioni più
frequentemente osservate (Tabella 1.2). Nelle SMD secondarie a trattamenti chemioterapici
includenti alchilanti, il cariotipo risulta nella maggior parte dei casi complesso, con anomalie
che interessano nel 90% dei casi i cromosomi 5 e 7 (monosomia del 7, 7q-, monosomia del 5,
5q-). Nel caso di un trattamento con inibitori delle topoisomerasi, si osservano spesso
alterazioni a carico del cromosoma 11q23 (Olney & Le Beau, 2001).
Il riscontro di una lesione citogenetica può rivestire anche un ruolo diagnostico. Non esistono
lesioni citogenetiche patognomoniche delle SMD essendo molte di esse riscontrabili anche
nelle LAM, specialmente nell’anziano (Mufti 1992). Alcune anomalie ricorrenti sono state
recentemente riconosciute come evidenza presuntiva per una diagnosi di SMD in presenza di
30
una citopenia persistente in assenza di una diagnosi morfologica definitiva (Vardiman et al.,
2009).
Altre anomalie genetiche, quali del (20q) e +8, non sono invece considerate specifiche,
essendo
state
riscontrate
in
altre
emopatie
che
rispondono
bene
alla
terapia
immunosoppressiva e che non mostrano segni morfologici di displasia in un lungo follow-up
(Maciejewski et al., 2002; Steensma et al., 2003; Gupta et al., 2006). La perdita del
cromosoma Y nelle cellule emopoietiche sarebbe invece un fenomeno associato
all’invecchiamento (Pierre & Hoagland, 1972). Pertanto non è ancora chiaro se queste
anomalie siano necessariamente indicative di SMD quando le caratteristiche morfologiche
non sono indicative.
La valutazione del cariotipo alla diagnosi è stata inserita in molti sistemi prognostici e riveste
anche importanza per la risposta al trattamento con nuovi farmaci quali ad esempio la
lenalidomide nella Sindrome 5q- (List et al., 2006) o di pazienti che ricevono trattamenti
intensivi (Alessandrino et al., 2008). In particolare nell’IPSS, sulla base del tipo e del numero
di anomalie, sono stati identificati tre gruppi citogenetici a diversa prognosi e rischio di
progressione in LAM.
Aberrazioni non bilanciate (acquisizione o
perdita di materiale cromosomico)
Anomalie strutturali (traslocazioni
reciproche bilanciate, inversioni,
inserzioni)
*del(5q)-monosomia 5 (20-32%)
*del(7q)- monosomia 7 (10-17%)
*monosomia 17/17p- (1-7%)
*der/del(11q) (3%)
*del(12p) (2-6%)
*del (13q)/-13 (2%)
*iso17q (1-3%)
*del(9q) (0,5-1%)
*idic(X)(q13) (0,5-1%)
trisomia 8 (8-21%)
del(20q) (1-14%)
monosomia Y (3-10%)
trisomia 11 (1-2%)
trisomia 21 (2%)
traslocazioni bilanciate (6%)
*t(3;21)(q26;q21)
*inv(3)(q21;q26)
*t(11;16)(q23;p13.3)
*t(1;3)(p36.3;q21.1)
*t(2;11)(p21;q23)
*t(6;9)(p23;q34)
*t(12p)
*anomalie complesse (più di tre cromosomi)
(10-20%)
Tabella 1.2 Anomalie citogenetiche; da Chromosomal deletions in the myelodysplastic syndrome. (Mufti 1992;
modificata). *Anomalie cromosomiche ricorrenti considerate, come evidenza, presuntive per una diagnosi di
SMD in presenza di una persistente citopenia in assenza di una definitiva diagnosi morfologica di SMD.
31
1.2.2.3 Analisi molecolare e mutazioni puntiformi
Le indagini di tipo molecolare rivestono un ruolo ancora in via di definizione
nell’inquadramento diagnostico delle SMD. Tra le metodiche molecolari che oggi vengono
utilizzate vi è lo studio dei profili di espressione genica (GEP) con i microarray. Caratteristici
profili di espressione genica sono stati osservati nei pazienti con anemia refrattaria con
sideroblasti ad anello (upregolazione di geni correlati ai mitocondri, tra cui quelli coinvolti
nella sintesi dell’eme quali ALAS2) e con sindrome 5q-, nei quali si è osservata una up
regolazione di geni istonici del cluster HIST1 e di geni correlati al citoscheletro actinico e una
down regolazione di geni assegnati alla Commonly Deleted Region (CDR) sulla regione 5q,
quali SPARC e RPS14 (Boultwood et al., 2007).
La valutazione dei GEP, pur molto promettente, necessita di ulteriori studi per meglio
definirne l’impatto diagnostico e prognostico.
Recentemente è stato poi dimostrato, con una tecnica di RNA silencing, che la perdita
parziale della funzione di RPS14 potrebbe avere un ruolo nella patogenesi della sindrome 5qe di forme congenite di insufficienza midollare (Ebert et al., 2008).
In certe condizioni cliniche l’analisi mutazionale può invece rivestire un ruolo diagnostico.
Un esempio è rappresentato dallo studio della mutazione V617F del gene JAK2 nelle SMD
con caratteristiche mieloproliferative ed in alcuni pazienti con del(5q) (Ingram et al., 2006;
Boissinot et al., 2006; Renneville et al., 2006; Szpurka et al., 2006).
Recentemente, in analogia a ciò che è stato osservato per le sindromi mieloproliferative
croniche Ph-negative, si è valutata l’incidenza delle mutazioni del gene TET2 nelle SMD
(Delhommeau et al., 2009). L’interesse nell’analisi di TET2 mutato sorge dall’osservazione,
secondo cui i pazienti che presentano la mutazione hanno una prognosi migliore (Kosmider et
al., 2009). Benché questo dato non sia stato confermato da studi successivi (Jankowska et al.,
2009) permane tuttavia molto interesse per questa molecola, dato che potrebbe rivestire un
ruolo importante come regolatore dell’idrossilazione della metilcitosina (come l’analogo
TET1), e dunque in qualche modo influenzare la regolazione dell’assetto cromatinico e,
ipoteticamente, la risposta a farmaci che coinvolgano meccanismi epigenetici. Il ruolo
patogenetico nelle SMD di mutazioni di TET2 e di mutazioni di JAK2, riscontrabili in meno
del 10% dei casi, non è stato comunque chiarito, potrebbe trattarsi di alterazioni molecolari
esprimenti l’instabilità genomica del clone e non la causa della patologia.
L’iperespressione del gene Wilms Tumor-1 (WT-1) sembra essere un marker universale di
malignità e di progressione nelle patologie mieloproliferative. Anche nelle SMD, alti livelli di
32
trascritto per WT-1 correlano con la progressione della patologia e con il grado di rischio
IPSS (Greiner et al., 2008).
1.2.2.4 Modificazioni epigenetiche
Le modificazioni epigenetiche sono eventi potenzialmente reversibili che determinano
riarrangiamenti cromatinici trasmissibili da una cellula alla sua progenie. Tali modificazioni
modulano ed alterano l’espressione genica senza cambiare la sequenza del DNA e senza
nessuna nuova informazione genetica. Modificazioni epigenetiche sono date da metilazione
del DNA, acetilazione, fosforilazione, ubiquitinazione degli istoni e generazione di siRNA.
La modulazione dell’espressione genica è dunque regolata principalmente da quello che è
stato definito “codice istonico” e dall’ipermetilazione delle isole CpG (Turner 2005). Le isole
CpG sono dei tratti ripetitivi di citosina e guanina che si localizzano nel DNA, generalmente
in corrispondenza dei promotori di alcuni geni. L’aggiunta di CH3 alle isole CpG è un
fenomeno che impedisce la trascrizione del gene a valle. La metilazione delle citosine è
compiuta da enzimi specifici chiamati DNA metiltransferasi (DNMT), DNMT1 di
mantenimento e DNMT3a e DNMT3b per la metilazione de novo. La metilazione del DNA è
reversibile e la sua modulazione regola l’embriogenesi, l’inprinting, l’inattivazione del
cromosoma X ed il differenziamento. Le isole CpG metilate sono molto rare nell’intero DNA.
In molte neoplasie, solide ed ematologiche, determinate isole CpG sono ipermetilate in
maniera non fisiologica e dunque i geni a valle sono stabilmente silenziati (Santini et al.,
2001).
In un recente studio, sono state valutate la metilazione globale e l’acetilazione istonica in 54
pazienti affetti da carcinoma renale a cellule chiare e sottoposti a nefrectomia parziale. Sono
state osservate una ipermetilazione globale ed una ipoacetilazione istonica, inoltre il grado di
metilazione e quello di acetilazione rispettivamente aumentava e diminuiva con l’aumentare
del grado di Fuhrman (identificato come fattore prognostico più importante all’analisi uni
variata; Minardi et al.,2009). Le modificazioni epigenetiche sono ormai considerate un evento
cruciale nella carcinogenesi e nella crescita tumorale e l’interplay tra metilazione globale del
DNA ed acetilazione istonica è coinvolto nei processi di trascrizione genica e di anomalo
silenziamento di alcuni geni (Herranz & Esteller, 2007; Vaissière et al., 2008).
La metilazione del DNA è studiata in molti tipi di tumore: un’ipermetilazione globale nel
carcinoma della mammella sembra associata ad un’aumentata resistenza al Docetaxel,
l’ipometilazione dei Long Interspersed Nucleotipe Elements (LINE-1) nel carcinoma
polmonare non a piccole cellule sembra essere un marker prognostico negativo. La
33
metilazione del DNA sembra essere rilevante anche nel carcinoma squamocellulare della cute,
nel carcinoma prostatico ed addirittura come marker di rischio cardiovascolare (Kastl et al.,
2010; Saito et al., 2010; Laing et al., 2010; Ribarska et al., 2010; Kim et al., 2010).
La metilazione globale nelle SMD è stata poco studiata, piuttosto è stata esaminata la
metilazione di alcuni geni in particolare.
In un recente studio pubblicato dal gruppo di Voso è emerso che l’anomala ipermetilazione
dei promotori dei geni CDH1, TBSP-1, COX-2, DAPK1 e GSTP1 è maggiore nelle SMD e
nelle LAM therapy related rispetto alle stesse patologie diagnosticate de novo (Voso et al.,
2010). Nelle SMD sembra essere presente anche un’ipermetilazione di LINE-1 che, secondo
gli autori, può essere utilizzata come marker di ipermetilazione globale nelle SMD
(Römermann
et
al.,
2007).
Recentemente
Issa
e
collaboratori
hanno
descritto
l’ipermetilazione di alcuni geni che controllano la proliferazione e l’adesione cellulare nelle
SMD, inoltre, hanno dimostrato una correlazione con l’aggressività della malattia e la
maggiore probabilità di progressione leucemica (Issa 2010). Il gruppo cinese di Lin ha
studiato la metilazione del promotore del gene DNA-damage-inducible-transcript 3 (DDIT 3)
ed ha trovato che l’espressione di questo gene è down regolata nelle neoplasie mieloidi,
comprese le SMD. La metilazione delle isole CpG del promotore di questo gene è risultata
anomala nel 31,8% dei casi; non vi è, però, nessuna correlazione tra l’ipermetilazione di
DDIT 3 e la presentazione clinica o il sottotipo di SMD. Anche se la sopravvivenza del
gruppo di pazienti “ipermetilati” è risultata minore rispetto agli altri (12 versus 23 mesi), la
differenza non è risultata statisticamente significativa (p = 0,137). Questi dati suggeriscono
che l’ipermetilazione di DDIT 3 potrebbe rappresentare uno degli eventi iniziali nella
patogenesi delle SMD (Lin et al., 2010). Una metilazione aberrante ed alcune delezioni
cromosomiche potrebbero essere responsabili della progressione da SMD a LAM: il gruppo
americano di Cleveland ha studiato con la tecnica dei microarray la metilazione del DNA e
con gli high density Single Nucleotide Polymorfism-A (SNP-A) il genotipo di 184 pazienti
affetti da SMD o LAM per studiare il silenziamento di alcuni geni oncosoppressori. Tutti i
campioni analizzati hanno mostrato un pattern aberrante di metilazione, mentre le delezioni
cromosomiche sono state osservate nel 79% dei pazienti affetti da SMD e nel 90% dei
pazienti affetti da LAM, ma non erano uniformemente distribuite nel genoma. Il gene
oncosoppressore identificato come maggiormente coinvolto nella progressione a LAM è
FZD9, sul cromosoma 7: i pazienti che presentavano il silenziamento di FZD9 avevano un
outcome peggiore. Questi risultati indicano che l’abnorme metilazione e le delezioni
cromosomiche contribuiscono al silenziamento dei geni oncosoppressori, anche se la
34
metilazione sembra avere un’influenza maggiore (Jiang et al., 2009). Nelle SMD è stato
dimostrato che alcuni geni, quali p15ink4b, death associated protein kinase (DAP kinasi),
SOCS-1, E-caderina, recettore estrogenico e RAR sono frequentemente ipermetilati (Voso et
al., 2004; Teofili et al., 2003). L’ipermetilazione incrementa con la progressione della
malattia, dunque sembrerebbe direttamente correlata alla sua patogenesi. In particolare, nelle
SMD, l’ipermetilazione di p15 è associata a perdita di espressione della proteina e correla con
una sopravvivenza minore rispetto a quella di pazienti in cui il promotore di p15 non è
ipermetilato. In aggiunta, p15INK4b non è ipermetilato nelle SMD a basso rischio, mentre
diviene frequente nelle SMD ad alto rischio, che presentano un’incidenza di ipermetilazione
del 23% alla diagnosi, del 30% negli stadi più avanzati e del 60-70% nelle LAM secondarie a
SMD (Aggerholm et al., 2006).
Il gruppo tedesco di Hopfer ha analizzato la cinetica dei sottotipi delle DNMTs e la
metilazione aberrante dei promotori dei geni chiave dell’emopoiesi; in vitro è stato creato un
modello di emopoiesi displastica ponendo in coltura cellule CD34+, provenienti da donatori
sani e da pazienti affetti da SMD, con eritropoietina, trombopoietina e G-CSF. L’espressione
di tutte le isoforme di DNMTs era aumentata durante la trombopoiesi, mentre l’espressione
della DNMT1 era aumentata durante l’eritropoiesi. Nelle SMD ad alto rischio è stata trovata
un’associazione tra un’aberrante metilazione dei promotori e l’espressione di tutte le isoforme
di DNMTs. I dati di questo studio suggeriscono che tutte le isoforme di DNMTs sono
coinvolte nell’aberrante metilazione delle cellule displastiche (Hopfer et al., 2009). Oltre alla
metilazione ed alle DNMT, ci sono altri “attori” nella regolazione dell’espressione genica: gli
istoni. L’ottamero istonico forma il “rocchetto” attorno al quale si avvolge il filamento di
DNA (Richmond & Davey, 2003). Quando tali istoni presentano il loro terminale NH2acetilato, le due cariche negative si respingono ed il DNA non si avvolge strettamente agli
istoni, rimanendo aggredibile da parte delle RNA polimerasi e dei fattori di trascrizione;
viceversa, quando il DNA regionale è metilato, si reclutano in loco complessi corepressivi
formati da diverse proteine, tra cui ovviamente le DNMT e le Istone Deacetilasi (HDAC)
(Spotswood & Turner, 2002). La conseguente deacetilazione degli istoni, accompagnata da
altre specifiche modifiche, porta ad un assetto del DNA che lo rende inaccessibile alla
trascrizione. Nelle cellule normali esiste un equilibrio tra regioni di cromatina accessibili ai
fattori di trascrizione (Transcription Factors, TFs) e regioni rese “mute” da fenomeni
epigenetici quali la metilazione delle isole CpG e la perdita dell’acetilazione istonica. Quattro
coppie di proteine istoniche (due coppie di H3, due di H4, due di H2b e due di H2a)
costituiscono il nucleosoma attorno al quale è avvolto il DNA. La metilazione del DNA
35
avviene sulle citosine grazie agli enzimi DNMT e porta al reclutamento di Metal Binding
Proteins (MBP), corepressori e HDAC che localmente deacetilano le code lisiniche degli
istoni, mentre gli enzimi istone metiltransferasi (HMT) metilano le lisine non più acetilate.
Nelle zone di DNA accessibili ai fattori di trascrizione, i residui lisinici degli istoni sono
acetilati e metilati in residui diversi (Figura 1.11, Figura 1.12).
Figura 1.11 Rimodellamento cromatinico in una cellula normale; da Sindromi mielodisplastiche. Dalla teoria
alla pratica clinica (Aloe Spiriti et al., 2007; modificata).
Figura 1.12 Legenda della Figura 1.10.
Nelle cellule mielodisplastiche questo equilibrio è profondamente alterato; molto
frequentemente si ha una ipermetilazione delle isole CpG situate in zone di DNA
36
normalmente trascritte e questa alterata metilazione recluta in maniera stabile proteine leganti
metili in vaste zone del DNA, rendendole non trascrivibili. Il risultato è la mancata
produzione di mRNA per proteine oncosoppressive o correlate alla maturazione emopoietica.
La terapia epigenetica porta alla reinduzione dell’espressione genica grazie all’azione
demetilante di Decitabina ed Azacitidina (Figura 1.13).
DNMT
HDAC
CR
Trascrizion
e genica
MBP
HP-1a
HMT
CA
HAT
TFs
MBP
HMT
HMT
Figura 1.13 Rimodellamento cromatinico in una cellula displastica; da Sindromi mielodisplastiche. Dalla teoria
alla pratica clinica. (Aloe Spiriti et al., 2007; modificata).
1.2.2.5 Citometria a flusso
Nella fase diagnostica la valutazione citofluorimetrica di una sospetta SMD è di aiuto nella
valutazione dei blasti CD34+, dei monociti, della componente mieloide maturante e della
componente eritroide (Ogata et al., 2006; Wells et al., 2003; Malcovati et al., 2005a; Della
Porta et al., 2006). Lo studio citofluorimetrico può fornire indicazioni di tipo quantitativo e
qualitativo. Dal punto di vista quantitativo è possibile definire la percentuale di blasti, che
nella maggior parte dei casi esprimono il CD34, e quindi concorrere ad un più preciso
inquadramento diagnostico soprattutto nei pazienti con campioni midollari morfologici
subottimali.
Dal punto di vista qualitativo è possibile invece riconoscere anomalie fenotipiche maturative
che, pur non essendo specifiche per le SMD, si sono dimostrate in relazione al grado di
37
displasia valutato all’esame morfologico e pertanto possono essere d’aiuto a differenziare le
SMD da quadri di tipo reattivo o da altre neoplasie mieloidi clonali (Loken et al., 2008).
La citofluorimetria potrebbe rivestire un ruolo nella definizione della prognosi delle SMD, in
quanto i risultati citofluorimetrici correlano con i sistemi prognostici attualmente utilizzati
(Ogata et al., 2006; Malcovati et al., 2005a; Della Porta et al., 2006; Maynadié et al., 2002;
van de Loosdrecht et al., 2008). È stata poi anche dimostrata una correlazione tra uno score
immunofenotipico e la prognosi in pazienti sottoposti a trapianto allogenico di midollo osseo
(Scott et al., 2008).
1.2.2.6 Esame istologico del midollo
L’esame istologico del midollo è oggi raccomandato in tutti i casi di sospetta SMD perché
fornisce indicazioni importanti relativamente a diversi aspetti quali la cellularità globale, la
percentuale di blasti CD34+ e l’aumentata angiogenesi.
Nei casi di sospetta SMD è sempre raccomandabile una valutazione di tipo
immunoistochimico che utilizzi come pannello minimo di marcatori il CD34, un marcatore
megacariocitario e la triptasi (un antigene correlato alle mastcellule). In casi specifici possono
essere poi utilizzati altri marcatori quali il CD3, il CD20, il CD25 ed il CD117 (Valent et al.,
2007). Per la valutazione della percentuale dei blasti, l’approccio migliore è contare i
progenitori CD34+ (Oriani et al., 1996).
1.2.3 Classificazioni Delle Sindromi Mielodisplastiche
1.2.3.1 Classificazione FAB
Da venticinque anni la classificazione FAB rappresenta lo standard per la classificazione delle
SMD. Distingue i pazienti affetti da SMD a seconda della morfologia, della presenza di
sideroblasti ad anello, della percentuale di blasti midollari e periferici e di monocitosi (Tabella
1.3, Bennett et al., 1982).
38
Diagnosi
Refractory Anaemia (RA)
Refractory Anaemia with Ring
Sideroblasts (RARS)
Refractory Anaemia with Excess of
Blasts (RAEB)
Refractory Anaemia with Excess of
Blasts in Transformation (RAEB-T)
Chronic Myelomonocytic Leukaemia
(CMML)
Blasti midollari
(%)
Blasti periferici
(%)
<5
<1
<5
<1
5-20
<5
20-30
>5
5-20
<5
Sideroblasti ad
anello > 15%
-/+ corpi di Auer
Monociti >
1.000/l
Tabella 1.3 Classificazione FAB delle SMD; da Proposals for the classification of the myelodysplastic
syndromes. (Bennett et al., 1982; modificata).
1.2.3.2 Classificazione World Health Organization 2001
Nel 2001 la World Health Organization (WHO) ha proposto alcune revisioni dell’approccio
morfologico della classificazione FAB, tenendo conto dell’impatto prognostico negativo dei
livelli più alti di blasti e della multilinearità della displasia. Infatti, la sopravvivenza dei casi
affetti SMD con blastosi midollare superiore al 20% è sovrapponibile alla quella dei pazienti
affetti da LAM; pertanto la soglia della percentuale di blasti midollari per una diagnosi di
LAM è stata abbassata dal 30% al 20%, eliminando così la categoria FAB di RAEB-T. La
CMML è stata integrata nelle Sindromi Mielodisplastiche/Mieloproliferative Croniche. Di
grande rilievo prognostico è stato il riconoscimento di alcuni sottotipi: l’Anemia Refrattaria
con o senza Sideroblasti ad Anello (con displasia della sola linea eritroide) e l’Anemia
Refrattaria con Displasia Multilineare con o senza Sideroblasti ad Anello (con 10% di
displasia in almeno due linee cellulari) (Tabella 1.4; Jaffe et al., 2001; Vardiman et al., 2002).
La multilinearità della displasia distingue pazienti a prognosi intermedia rispetto a quelli con
la sola displasia eritroide a prognosi buona. È stata inoltre isolata in un sottogruppo distinto la
sindrome caratterizzata da una delezione isolata del braccio lungo del cromosoma 5 [del(5q)]
(Giagounidis et al., 2004).
39
Diagnosi
Sangue Periferico
Midollo osseo
Refractory Anaemia (RA)
Anemia
Non blasti
Displasia eritroide
< 5% di blasti
< 15% di sideroblasti ad anello
Anemia
Non blasti
Displasia eritroide
< 5% di blasti
 15% di sideroblasti ad anello
Refractory Cytopenia
with Multilineage
Displasia (RCMD)
Bi- o pancitopenia
Non blasti
Non corpi di Auer
Monociti < 1.000/l
Displasia in più del 10% delle
cellule o in due o più linee
cellulari
Non corpi di Auer
< 15% di sideroblasti ad anello
Refractory Cytopenia
with Multilineage
Displasia and Ring
Sideroblasts (RCMD-RS)
Bi- o pancitopenia
Non blasti
Non corpi di Auer
Monociti < 1.000/l
Displasia in più del 10% delle
cellule o in due o più linee
cellulari
Non corpi di Auer
 15% di sideroblasti ad anello
Refractory Anaemia with
Excess of Blasts-1
(RAEB-1)
Pancitopenia
< 5% di blasti
Non corpi di Auer
Monociti < 1.000/l
Displasia uni- o multilineare
5-9% di blasti
Non corpi di Auer
Refractory Anaemia with
Excess of Blasts-2
(RAEB-2)
Pancitopenia
5-19% di blasti
 corpi di Auer
Monociti < 1.000/l
Displasia uni- o multilineare
10-19% di blasti
 corpi di Auer
Myelodysplastic
Sindrome, unclassified
(MDS-U)
Pancitopenia
Rari blasti
Non corpi di Auer
Displasia unilineare nei
granulociti o nei megacariociti
< 5% di blasti
Non corpi di Auer
Refractory Anaemia with
Ring Sideroblasts
(RARS)
Myelodysplastic
Sindrome with isolated
del(5q)
Anemia
< 5% di blasti
 piastrinosi
 aumento dei megacariociti con
nuclei ipolobati
< 5% di blasti
Non corpi di Auer
del(5q) isolata
Tabella 1.4 Classificazione WHO 2001 delle SMD; da Classification of tumors: pathology and genetics of
tumors of haematopoietic and lymphoid tissues (Jaffe et al., Ed World Health Organization. IARC Press, Lyon
2001, modificata).
40
1.2.3.3 Classificazione World Health Organization 2008
Di recente, nel 2008, la classificazione della WHO è stata ulteriormente revisionata (Tabella
1.5). I sottotipi morfologici possono essere categorizzati in tre gruppi di rischio sulla base
della sopravvivenza e dell’evoluzione leucemica. Il gruppo a basso rischio comprende la
Citopenia Refrattaria con Displasia Multilineare (RCUD) e l’Anemia Refrattaria con
Sideroblasti ad Anello (RARS). A rischio intermedio sono le Citopenie Refrattarie con
Displasia Multilineare (RCMD) con o senza Sideroblasti ad Anello e le RAEB-1. La RAEB-2
costituisce il gruppo ad alto rischio (Swerdlow et al., 2008)
Diagnosi
Sangue Periferico
Midollo osseo
Refractory Cytopenia with
Unilinear Displasia
(RCUD):
 Refractory Anaemia (RA)
 Refractory Neutropenia
(RN)
 Refractory
Thrombocytopenia (RT)
Non blasti
Displasia unilineare
< 5% di blasti
< 15% di sideroblasti ad anello
Refractory Anaemia with
Ring Sideroblasts (RARS)
Anemia
Non blasti
Displasia eritroide
< 5% di blasti
 15% di sideroblasti ad anello
Refractory Cytopenia with
Multilineage Displasia
(RCMD)
Bi- o pancitopenia
Non blasti
Non corpi di Auer
Monociti < 1.000/l
Displasia in più del 10% delle
cellule o in due o più linee
cellulari
Non corpi di Auer
< 15% di sideroblasti ad anello
Refractory Anaemia with
Excess of Blasts-1 (RAEB1)
Pancitopenia
< 5% di blasti
Non corpi di Auer
Monociti < 1.000/l
Displasia uni- o multilineare
5-9% di blasti
Non corpi di Auer
Refractory Anaemia with
Excess of Blasts-2 (RAEB2)
Pancitopenia
5-19% di blasti
 corpi di Auer
Monociti < 1.000/l
Displasia uni- o multilineare
10-19% di blasti
 corpi di Auer
Myelodysplastic Sindrome,
unclassified (MDS-U)
Pancitopenia
Rari blasti
Non corpi di Auer
Displasia unilineare nei granulociti
o nei megacariociti
< 5% di blasti
Anemia
Neutropenia
Piastrinopenia
41
Non corpi di Auer
Myelodysplastic Sindrome
with isolated del(5q)
Anemia
< 5% di blasti
 piastrinosi
 aumento dei megacariociti con
nuclei ipolobati
< 5% di blasti
Non corpi di Auer
del(5q) isolata
Chronic Myelomonocytic
Leukaemia (CMML)
< 20% di blasti
Monociti > 1.000/l
Displasia uni- o multilineare
< 20% di blasti
Atypical Chronic Myeloid
Leukemia (aCML)
Leucocitosi neutrofila
 10% precursori neutrofili
< 20% di blasti
< 10% monociti
Displasia neutrofila
< 20% di blasti
Juvenile Myelomonocytic
Leukemia (JMMC)
< 20% di blasti
Monociti > 1.000/l
BCR-ABL1 assente
< 20% di blasti
BCR-ABL1 assente
Unclassified
MDS/Myeloproliferative
Neoplasia (MDS/MPN)
BCR-ABL1 assente
< 20% di blasti
Morfologia mista tra MDS e MPN
BCR-ABL1 assente
Refractory Anaemia with
Ring Sideroblasts with
thrombocytosis (RARS-T)
Anemia
Non blasti
Piastrine  450.000/l
BCR-ABL1 assente
Displasia eritroide
< 5% di blasti
 15% di sideroblasti ad anello
Megacariociti atipici
BCR-ABL1 assente
Tabella 1.5 Classificazione WHO 2008 delle SMD; da Classification of tumors of haematopoietic and lymphoid
tissues (Swerdlow et al., 2008).
1.2.4 Fattori Prognostici
Successivamente alla classificazione FAB, che oltre a rappresentare il primo tentativo di
“mettere ordine” nelle SMD ha anche evidenziato di possedere una rilevante valenza
prognostica, sono stati proposti numerosi modelli finalizzati a determinare le possibilità di
sopravvivenza ed il rischio di evoluzione leucemica delle SMD (Mufti et al., 1985; Sanz et
al., 1989; Aul et al., 1992; Morel et al., 1993). Questi hanno prevalentemente incluso variabili
quali la percentuale di blasti, le caratteristiche istologiche midollari, le citopenie periferiche,
l’età ed il cariotipo e sono stati basati sulla combinazione di differenti punteggi (score)
attribuiti ad ognuno di questi parametri, sulla base del peso prognostico di ciascuno di essi.
42
1.2.4.1 International Prognostic Scoring System
L’International Prognostic Scoring System (IPSS), pubblicato nel 1997, è il più noto e diffuso
sistema di classificazione prognostica delle SMD. È stato proposto dall’International MDS
Risk Analysis Workshop, che ha utilizzato una combinazione di dati clinici, morfologici e
citogenetici ottenuti da 816 pazienti riportati in sette studi precedenti, basati sul rischio, da cui
sono state ricavate variabili prognostiche statisticamente significative (Tabella 1.6, Greenberg
et al., 1998).
Variabili prognostiche
Blasti midollari
Cariotipo
Citopenie*
0
0,5
<5
5-10
Normale, Altre
-Y,
anomalie
del(5q),
del(20q)
0-1
Punteggio
1,0
-
1,5
2,0
11-20
21-30
Complesso,
anomalie del
cromosoma 7
2-3
Tabella 1.6 Variabili prognostiche e relativo punteggio dell’IPSS; da International scoring system for evaluating
prognosis in Myelodysplastic Sindrome (Greenberg et al., 1997; modificata). *Neutrofili < 1.500/l, emoglobina
< 10,0 g/l, piastrine < 100.000 / l.
L’analisi univariata ha individuato le anomalie citogenetiche, la percentuale di blasti midollari
ed il numero di citopenie periferiche quali parametri con maggiore impatto sull’evoluzione in
LAM; le stesse variabili sono anche predittrici della sopravvivenza insieme all’età ed al sesso
(minore sopravvivenza nei pazienti anziani a rischio intermedio e basso e nei maschi). In
particolare viene confermata l’importanza del cariotipo con l’identificazione di tre sottogruppi
citogenetici con prognosi “buona” (cariotipo normale, delezione isolata del cromosoma Y,
delezione isolata del braccio lungo del cromosoma 5, delezione isolata del braccio lungo del
cromosoma 20), “intermedia” (tutte le anomalie citogenetiche non incluse nei gruppi a
prognosi buona e severa) e “severa” (cariotipi complessi con più di tre anomalie o le anomalie
del cromosoma 7). Il tempo alla progressione leucemica per le quattro classi di rischio
identificate (basso, intermedio-1, intermedio-2, alto) è rispettivamente di 9,4, 3,3, 1,1 e 0,2
anni; anche la sopravvivenza mediana risulta omogeneamente distribuita nelle classi di
rischio: 5,7 anni nel gruppo a basso rischio, 3,5 anni nell’intermedio-1, 1,2 anni
nell’intermedio-2, 0,4 anni nell’alto rischio (Tabella 1.7).
43
Punteggio
Rischio
Sopravvivenza mediana (anni)
0
0,5-1,0
1,5-2,0
≥ 2,5
Basso
INT-1
INT-2
Alto
5,7
3,5
1,2
0,4
Tabella 1.7 Classi di rischio secondo l’IPSS; da International scoring system for evaluating prognosis in
myelodysplastic syndromes. (Greenberg P et al., 1997; modificata).
Sebbene l’IPSS fornisca un metodo di larga applicazione per la valutazione prognostica delle
SMD, esso raggruppa in classi omogenee pazienti con patologie diverse per caratteristiche
biologiche e per presentazione clinica; inoltre non viene contemplato un punteggio che
consideri l’età.
1.2.4.2 Cariotipo
Recentemente è stato riconsiderato il valore prognostico del cariotipo, raccogliendo dati su
2.072 pazienti valutabili per la citogenetica, di cui 1.084 (52,3%) con anomalie cromosomiche
alla diagnosi (Haase et al., 2007). Gli 802 pazienti del gruppo a prognosi buona includevano
quelli con cariotipo normale o con anomalie (singole o associate ad una sola ulteriore
alterazione) 9q-, 15q-, t(15q), 12p-, +21, 5q-, -X, -Y, t(1q), t(7q), t(11q) e -21. I pazienti a
prognosi intermedia venivano suddivisi in INT-1 (11q- e +8) o INT-2 (+19, 7q-, tutte le
anomalie del cromosoma 3, -7, cariotipi complessi fino a tre alterazioni). I 127 pazienti con
più di tre anomalie cariotipiche o t(5q) si associavano alla prognosi peggiore. Le principali
novità introdotte rispetto allo schema IPSS riguardano l’anomalia t(7q), considerata a basso
rischio, e la presenza di cariotipi con più di tre anomalie citogenetiche, incluse nella categoria
a rischio intermedio.
1.2.4.3 Età
Anche l’età rappresenta un fattore prognostico determinante per la sopravvivenza nelle SMD.
Una recente casistica di 232 pazienti ha fornito ulteriori informazioni sui fattori prognostici
che influenzano la sopravvivenza e l’evoluzione in LAM nei pazienti con età inferiore a 50
anni (Kuengden et al., 2006). La sopravvivenza mediana si è confermata significativamente
migliore (48 versus 25 mesi) rispetto a quella dei pazienti più anziani. Tale differenza è
risultata particolarmente evidente nei soggetti in terapia di supporto (176 versus 23 mesi) ed è
44
stata osservata prevalentemente nei rischi IPSS basso o INT-1 (mediana di sopravvivenza non
raggiunta versus 45 mesi). Nei pazienti a basso rischio la sopravvivenza globale a 20 anni è
risultata dell’86%. La mediana di sopravvivenza è di soli 8 mesi nelle fasce di rischio INT-2 e
alto e non differisce da quella dei pazienti con età maggiore di 50 anni. All’analisi
multivariata nei pazienti non trattati con chemioterapia intensiva o allotrapianto, la
percentuale di blasti midollari maggiore del 10%, LDH elevato e rischio IPSS alto sono
risultati i principali fattori prognostici negativi.
1.2.5 Nuovi Fattori Prognostici
La più recente classificazione WHO ha confermato di possedere un’importante rilevanza
prognostica in analisi di validazione retrospettive (Malcovati et al., 2005b; Germing et al.,
2006a) e prospettiche (Germing et al., 2006b). Nello studio di Germing e collaboratori del
2006 è stata confermata la migliore prognosi dei pazienti con RA o RARS (sopravvivenza
mediana non raggiunta) e 5q- (40 mesi), rispetto a quella meno favorevole dei pazienti con
displasia multilineare, con o senza sideroblasti ad anello, (RCMD 31 mesi, RCMD-RS 28
mesi) o con eccesso di blasti (RAEB-1 27 mesi, RAEB-2 12 mesi). SMD con una quota
blastica inferiore al 5% e displasia unilineare, trattate con l’associazione eritropoietina fattore di crescita granulocitario, hanno evidenziato una più elevata probabilità di risposta ed
una sopravvivenza significativamente maggiore (56% a 67 mesi) rispetto ai 28,5 mesi dei
pazienti con displasia multilineare che ricevono un analogo trattamento (Howe et al., 2004).
La presenza di citopenie multiple e di displasia multilineare peggiora in maniera significativa
la prognosi delle SMD a basso rischio (Verburgh et al., 2007).
1.2.5.1 LDH
L’enzima LDH è un parametro prognostico indipendente dalle classificazioni FAB e WHO,
all’interno delle quali valori elevati di LDH si associano ad una minore sopravvivenza e ad
una più elevata probabilità di evoluzione leucemica identificando, così, sottogruppi a prognosi
sfavorevole nell’ambito dell’IPSS, in particolare nelle fasce a rischio basso ed intermedio
(Germing et al., 2005). In uno studio di Wimazal e collaboratori del 2008 sono stati valutati i
livelli di LDH di 221 pazienti affetti da SMD de novo e gli autori hanno rilevato che i livelli
sierici di questo enzima correlano con la sopravvivenza e con l’evoluzione in LAM.
L’incremento dei valori di LDH si è verificato nei due o tre mesi precedenti l’evoluzione della
malattia, in alcuni casi questo aumento si può accompagnare ad altri segni di malattia, come
45
piastrinopenia o blastosi periferica (Wimazal et al., 2008). Anche recentemente si è
confermata l’importanza prognostica dei livelli di LDH nei pazienti trattati con 5-azacitidina
(5-AZA): valori superiori alla norma alla diagnosi correlano con una minore sopravvivenza
mediana rispetto ai pazienti con valori normali (13,9 versus 20,6 mesi). Un’analisi
multivariata ha mostrato che alti livelli di LDH ed uno score di rischio WHO based
Prognostic Scoring System (WPSS) molto alto si associano significativamente con una
peggiore sopravvivenza, mentre una risposta alla terapia con 5-AZA rappresenta un fattore
prognostico positivo (Moon et al., 2010).
1.2.5.2 Conta piastrinica
Anche la conta piastrinica predice la sopravvivenza nelle SMD. Uno studio del 2006 ha
evidenziato, in pazienti con una conta piastrinica inferiore a 100.000/l, una sopravvivenza
mediana di 9 mesi e del 13% a cinque anni rispetto a pazienti con una conta piastrinica più
elevata, in cui la sopravvivenza mediana non veniva raggiunta dopo 82 mesi di osservazione
(56% dei pazienti vivente a 5 anni). Gli stessi autori hanno dimostrato che anche il volume
piastrinico medio (VPM) ha un potere predittivo indipendente sulla sopravvivenza. Un VPM
basso (inferiore a 8,5 fl) si associa ad una sopravvivenza mediana di 9 mesi (15% di
sopravvivenza a 5 anni), mentre i pazienti con un volume più elevato hanno evidenziato una
sopravvivenza mediana di 46 mesi (46% di sopravvivenza a 5 anni). In particolare una massa
piastrinica (VPM x conta piastrinica) bassa (inferiore a 0,6 ml/l) rappresenta un fattore di
rischio, con una sopravvivenza mediana di soli 5 mesi e nessun sopravvissuto a 5 anni. Esiste
anche una correlazione inversa tra punteggio IPSS e massa piastrinica, che potrebbe
rappresentare un indice prognostico utile nei casi in cui non siano ottenibili dati sufficienti
riguardo la morfologia e/o la citogenetica (pazienti anziani, varianti ipocitosiche o
mielofibrotiche; Bowles et al., 2006). L’importanza delle piastrinopenia sull’outcome delle
SMD è stata confermata anche da uno studio di Kantarjian e collaboratori del 2007, eseguito
su 2.410 pazienti, che ha mostrato una significativa associazione tra trombocitopenia alla
diagnosi (conta piastrinica inferiore a 100.000/l), rischio IPSS elevato e un’incidenza di
emorragie severe più marcata rispetto a quanto segnalato in precedenza in letteratura
(Kantarjian et al., 2007).
46
1.2.5.3 Fibrosi midollare
La fibrosi midollare è un reperto frequente nelle SMD (17%). Nel lavoro di Della Porta e
collaboratori del 2009 essa è risultata associata ad una ridotta sopravvivenza globale e ad una
minore sopravvivenza libera da leucemia. L’effetto della presenza di fibrosi in termini di
sopravvivenza si mantiene indipendentemente dalla classe WHO. L’impatto prognostico è
risultato particolarmente negativo nei pazienti con displasia multilineare e trasfusione
dipendenza (Mufti et al., 2008).
1.2.5.4 Trasfusione dipendenza
La trasfusione dipendenza è stata recentemente identificata come fattore prognostico negativo
nelle SMD (Malcovati et al., 2005b). Esiste una correlazione inversa tra entità del fabbisogno
trasfusionale e sopravvivenza mediana; analogamente, il sovraccarico marziale (ferritina >
1.000 ng/ml) si associa ad una prognosi sfavorevole. L’impatto prognostico negativo del
fabbisogno trasfusionale si evidenzia pressoché esclusivamente nei citotipi senza eccesso di
blasti, dove una maggiore durata di malattia potrebbe consentire lo sviluppo di
un’emocromatosi secondaria clinicamente significativa. Occorre tuttavia ricordare che
l’anemia grave, di per sé, è stata imputata come fattore di rischio cardiovascolare in questi
pazienti (Oliva et al., 2005). La comparsa di fabbisogno trasfusionale si associa anche ad un
incremento del rischio di trasformazione leucemica, suggerendo una stretta correlazione tra
questo parametro e le caratteristiche di aggressività del clone mielodisplastico (Malcovati et
al., 2005b). Anche in un recente studio è stato evidenziato un maggior rischio di evoluzione
leucemica nei pazienti con sovraccarico marziale, inoltre, in questi pazienti, è stato
evidenziato un outcome peggiore dopo trapianto allogenico, probabilmente per un maggiore
rischio infettivo (Fenaux & Rose, 2009). L’impatto negativo della necessità trasfusionale è
ulteriormente supportato da alcune recenti segnalazioni che hanno identificato come possibile
fattore prognostico favorevole la risposta a trattamenti in grado di ridurre o abolire la
necessità trasfusionale (Candoni et al., 2005; Park et al., 2008).
1.2.5.5 WHO based Prognostic Scoring System
L’integrazione retrospettiva delle informazioni derivanti dalla classificazione WHO con la
valutazione del cariotipo secondo IPSS e del fabbisogno trasfusionale ha fornito un nuovo
modello prognostico (WHO based Prognostic Scoring System, WPSS), basato su 426 pazienti
italiani con SMD e successivamente validato in una coorte tedesca indipendente di 739
pazienti (Tabella 1.8; Malcovati et al., 2007).
47
Punteggio
Classe WHO
Richiesta trasfusionale
Rischio citogenetico
IPSS
0
1
2
3
RA, RARS, 5q-
RCMD (± RS)
RAEB-1
RAEB-2
Nessuna
Regolare
-
-
Buono
Buono
Intermedio
Intermedio
Elevato
Elevato
-
Tabella 1.8 Variabili prognostiche e relativo punteggio del WPSS; da Time-dependent prognostic scoring
system for predicting survival and leukemic evolution in myelodysplastic syndromes. (Malcovati et al., 2007;
modificata).
Nella coorte di riferimento italiana il WPSS ha identificato 5 gruppi di pazienti (rischio molto
basso, basso, intermedio, alto, molto alto) con mediane di sopravvivenza rispettivamente di
103, 72, 40, 21 e 12 mesi. Secondo il WPSS la probabilità di evoluzione leucemica a 5 anni è
risultata pari al 6%, 24%, 48%, 63% e 100% a seconda della classe di rischio. Un aspetto
importante di questo modello è rappresentato dalla sua applicabilità nel corso delle diverse
fasi della malattia e non soltanto nella valutazione prognostica all’esordio.
1.3 TELOMERI E TELOMERASI NELLE PATOLOGIE ONCOLOGICHE
1.3.1 Malattie Con Disordini Dei Telomeri E Cancro
Fin dalla loro scoperta, i telomeri sono stati associati alla stabilità genomica (Müller 1938;
McClintock 1941). La loro importanza nella medicina è emersa dall’osservazione che molte
patologie oncologiche o ad esse predisponenti, quali il cancro al colon-retto, la colite ulcerosa,
il carcinoma pancratico e l’osteosarcoma (Hastie et al., 1990; O’Sullivan et al., 2002; Counter
et al., 1994) sono caratterizzati da riarrangiamenti cromosomici più o meno estesi.
Durante gli ultimi venti anni sia l’accorciamento dei telomeri che l’espressione della
telomerasi, intesi come meccanismo capace di determinare il potenziale replicativo cellulare,
sono stati oggetto di molti studi, a causa della loro importanza come potenziali marker per la
48
diagnosi e la prognosi di quasi tutte le malattie neoplastiche, incluse le emopatie maligne
(Sieglovà et al., 2004).
In un recente studio è stata dimostrata la correlazione inversa tra la lunghezza dei telomeri,
l’incidenza del cancro e la mortalità. Willeit ed il suo gruppo (Willeit et al 2010) ha
monitorato 787 individui sani selezionati casualmente dal 1990 fino al 2005. Gli autori hanno
osservato che la lunghezza iniziale dei telomeri era sostanzialmente minore in quegli individui
che avevano in seguito sviluppato tumori rispetto a quelli che non avevano sviluppato alcun
tipo di tumore. Ne consegue che la lunghezza dei telomeri può essere considerata come
marker prognostico per l’insorgenza di tumori. Le percentuali dell’incidenza vanno dal 5,1 %
negli individui con telomeri lunghi al 22,5% in quelli con telomeri corti. Inoltre è stata
osservata un correlazione tra la prognosi e la lunghezza die telomeri. I telomeri corti sono
associati a tumori aggressivi o con prognosi sfavorevole, mentre telomeri più lunghi sono
associati a prognosi migliori (Willeit et al., 2010). Le percentuali di mortalità causata da
cancro invece vanno dallo 0,8 % negli individui con telomeri lunghi al 12,9 % con telomeri
corti. Questi risultati sono concordanti con gli studi già pubblicati che mostrano un relazione
tra la presenza dei telomeri corti e il cancro alla vescica (McGrath et al., 2007; Broberg et al.,
2005), il carcinoma renale (Wu et al., 2003; Shao et al., 2007), il carcinoma squamocellulare
(Wu et al., 2003), il cancro al polmone (Jang et al., 2008), ma sono in disaccordo con le
correlazioni presentate con il cancro colonrettale e con quello al seno (Zee et al., 2009; Shen
et al., 2009).
Parallelamente alla lunghezza dei telomeri, l’attività telomerasica si è rivelata essere un
ottimo marker sia prognostico che diagnostico per alcuni tumori. Precedenti studi hanno
rivelato che l’attività telomerasica può essere rilevata in circa l’85% dei più comuni tumori
come in quello al seno, alla prostata, al polmone, al fegato, al pancreas ed al colon (Kim 1997;
Shay & Bacchetti, 1997), suggerendo che nella maggior parte delle cellule cancerose la
telomerasi è riattivata una volta raggiunta l’immortalità. In alcuni casi, la telomerasi potrebbe
essere attivata già allo stadio preneoplastico, mentre in altri casi potrebbe essere attivata
gradualmente con la progressione del cancro (Shay & Bacchetti, 1997). L’attività
telomerasica è un utile indicatore per determinare la malignità soprattutto nei tipi di tumore
morfologicamente poco definiti, come il glioma e il tumori alla tiroide (Haugen et al., 1997;
Saji et al., 1997). Nei tipi di tumore con elevata attività telomerasica durante la progressione
della malattia (tumore al polmone, cancro gastrico e neuroblastoma), la valutazione di questo
parametro ha valore sia per determinare la gravità della patologia sia come fattore prognostico
(Tatsumoto et al., 2000; Hiyama et al., 1995).
49
1.3.2 Telomeri E Telomerasi Nelle Neoplasie Ematologiche
I linfociti sono le uniche cellule del sangue caratterizzate da un’alta attività telomerasica
anche durante le ultime fasi di differenziazione. Sia i linfociti B che T sono caratterizzati da
una bassa espressione di hTERT durante le fasi di riposo, mentre hanno un alto livello di
espressione durante l’attivazione. L’iper-regolazione della telomerasi in queste cellule gioca
un ruolo importante nel garantire una risposta proliferativa adeguata (Weng et al., 1997;
Weng 2008; Kaszubowska 2008).
Ladetto e collaboratori (2004) hanno valutato la lunghezza dei telomeri dei linfociti B in vari
tipi di malattie linfoproliferative. I pazienti con linfoma mantellare (MCL; media 3,5 Kb,
range da 1,9-8,9 Kb) hanno i telomeri più corti, seguiti da quelli con la leucemia linfatica
cronica (LLC; media 4,3 Kb, range 2,1-8,2 Kb). Il mieloma multiplo (MM; media 6,3,range
4,9-8,9 Kb) e il linfoma marginale (MZL: media 5,9 Kb,range 5,1-6,7 Kb) hanno lunghezze di
telomeri intermedie, mentre il linfoma follicolare (FL; media 7,3 Kb, range 4,3-10,0 Kb), il
linfoma a grandi cellule B (DLCL: media 7,8 Kb, range 5,2-10,3 Kb) e, in modo particolare, il
linfoma di Burkitt (BL; media 9,4 Kb, range 7,0-11,2 Kb) hanno i telomeri più lunghi
(Ladetto et al., 2004).
L’analisi della lunghezza dei telomeri in 58 pazienti affetti da LLC ha dimostrato che questa è
inversamente correlata con l’attività telomerasica. I pazienti con i telomeri più corti di 6,0 kb
sono associati con un’alta attività telomerasica ed una sopravvivenza media molto bassa,
mentre i pazienti con telomeri > 6,0 kb generalmente hanno una bassa attività enzimatica
(Bechter et al., 1998).
Nella Leucemia Mieloide Cronica in crisi blastica (CB) si osserva l’accorciamento dei
telomeri di circa 10-20 volte superiore rispetto a quello osservato nei granulociti di pazienti
sani (Ohyashiki et al., 2000). In più del 50% dei pazienti in CB con anomalie citogenetiche, si
nota un aumento dell’attività della telomerasi di circa 50 volte (Ohyashiki et al., 2000;
Broccoli et al., 1995). Studi più recenti hanno valutato la lunghezza dei telomeri in pazienti in
trattamento con inibitore della tirosin-chinasi Imatinib (IM, Gleevec®), che lega
selettivamente il sito di legame dell’ATP di BCR-ABL (Deininger et al., 2005). Il trattamento
con IM causa un aumento della lunghezza media dei telomeri, i livelli di hTERT sono più
elevati nei pazienti in fase cronica (FC) in trattamento con IM rispetto a quelli dei pazienti
non trattati (Keller et al., 2009; Campbell et al., 2006).
50
L’omeostasi dei telomeri è stata studiata per la prima volta nella Discheratosi Congenita (DC)
per cui questa paqtologia è la meglio caratterizzattìa da questo punto di vista. È una forma
particolare di anemia aplastica (AA) congenita ereditaria, caratterizzata da mutazioni dei geni
che codificano il complesso minimo della telomerasi (Walne & Dokal, 2008; Savage & Alter,
2009), della discheratina (DKC1), proteina stabilizzante la porzione a RNA della telomerasi
(Mitchell et al., 1999). Tutto ciò causa vari disordini al midollo osseo, la cirrosi epatica, la
fibrosi polmonare e alcune forme di cancro quali il carcinoma squamocellulare, il tumore alla
lingua e la LAM (Walne & Dokal, 2008; Savage & Alter, 2009; Alter et al., 2009).
Le famiglie con mutazioni a carico dei geni per la telomerasi mostrano un’ ‘anticipazione’
della malattia, cioè ad ogni generazione la malattia si presenta ad una età sempre minore
(Vulliamy et al., 2004; Armanios et al., 2005). La spiegazione più semplice di questo
fenomeno è che i disordini a livello della telomerasi limitano l’attività di questa fin dalla linea
germinale generando dei gameti con telomeri più corti e conseguentemente dei discendenti
con la stessa caratteristica. Telomeri corti nelle cellule staminali alla nascita riducono il
numero delle divisioni di queste prima che i telomeri corti inneschino la risposta al danno del
DNA ed, eventualmente senescenza o morte cellulare (Lansdorp 2009).
Ball e collaboratori (1998) hanno determinato la lunghezza media dei telomeri in 79 pazienti
affetti da AA acquisita. Comparati con i controlli normali, i telomeri dei pazienti sono molto
più corti ed è evidente una correlazione tra l’accorciamento dei telomeri e la progressione
della malattia (Ball et al., 1998). Inizialmente, come causa primaria dell’erosione dei telomeri,
è stata considerata la presunta risposta fiologica allo ‘stress replicativo’ delle cellule staminali
(Brummendorf et al., 2001). In studi più recenti è dimostrato che le cause che portano
all’accorciamento dei telomeri sono delle mutazioni a livello dei componenti della telomerasi
TERC e TERT. Le conseguenze funzionali di questi cambiamenti genetici sono una riduzione
dell’attività telomerasica ed un accorciamento dei telomeri (Calado & Young, 2008).
1.3.3 Telomeri E Telomerasi Nelle SMD E Nelle LAM
I primi studi pubblicati su SMD e telomeri dimostrano che queste patologie sono
caratterizzate da una forte eterogeneità nella lunghezza dei telomeri. In più della metà dei
pazienti si evidenzia una riduzione della lunghezza media dei telomeri rispetto ai controlli
della stessa fascia d’età. Ohyashiki e collaboratori (1994) analizzando 16 pazienti affetti da
SMD a rischio differente, hanno suddiviso i pazienti in tre tipologie: a) SMD con telomeri
corti alla diagnosi che non subiscono ulteriori accorciamenti durante l’evoluzione della
51
malattia; b) SMD con telomeri normali alla diagnosi e con evidente accorciamento durante
l’evoluzione della malattia; c) SMD con lunghezza normale alla diagnosi senza accorciamenti
significativi in associazione all’evoluzione. Concorde con questi risultati, Counter e
collaboratori (1995) hanno evidenziato la presenza di telomeri particolarmente corti nelle
SMD (range 5,6 Kb - 20,1 Kb) e nelle LAM (range 3,6 - 6,5 Kb) sebbene l’attività
telomerasica fosse significativamente incrementata (Counter et al., 1995).
Lo studio di Yamada e collaboratori (1995) ha dimostrato una variabile (range 2,7 - 6,4 Kb),
ma consistente riduzione nella lunghezza dei telomeri nei pazienti affetti da LAM (Yamada et
al., 1995).
Questa eterogeneità nella lunghezza dei telomeri nelle SMD è riportata anche da Boultwood e
collaboratori (1997) in cui approssimativamente il 50% dei pazienti con SMD con cariotipo
complesso aveva un forte accorciamento della lunghezza dei telomeri associato alla
progressione della malattia (Boultwood et al., 1997).
L’attività telomerasica è stata osservata in più dell’85% dei tumori primari, ed è quindi
considerato un marker di malignità (Kim et al., 1994; Shay & Bacchetti, 1997). Il gruppo di
Ohyashiki (1997), analizzando campioni di sangue periferico di 78 pazienti con Leucemia
Acuta, ha dimostrato l’esistenza di una correlazione tra espressione di attività telomerasica,
lunghezza dei telomeri e decorso della malattia. In particolare l’82% delle LAM e il 70%
delle Leucemie Acute Linfoblastiche (LAL) avevano un’elevata attività della telomerasi. Nei
pazienti in remissione il livello di attività diminuisce significativamente, mentre i pazienti
ricaduti mostrano un trend generale di crescita (Ohyashiki et al., 1997). In successivi studi lo
stesso gruppo analizza 93 pazienti affetti da SMD e fa una correlazione tra rischio IPSS e
lunghezza dei telomeri. I pazienti classificati ad alto rischio (INT-2 e Alto) hanno telomeri
sensibilmente più corti rispetto ai pazienti classificati a basso rischio (Basso e INT-1;
Ohyashiki et al., 1999).
In un’altra coorte di 50 pazienti con SMD e LAM secondaria a SMD si evidenzia
un’accelerata erosione dei telomeri e un’elevata espressione di attività telomerasica, associate
alla complessità del cariotipo, al sottotipo FAB e alla progressione in LAM (Sieglovà et al.,
2004).
L’espressione di hTERT è da sempre considerata il fattore limitante l’attività telomerasica,
sebbene recenti studi pongano l’accento anche sull’importanza dell’espressione di hTR
(Kirkpatrick et al., 2003; Cairney & Keith, 2008). Mentre di norma c’è una stretta
correlazione nelle cellule neoplastiche tra l’espressione del messaggero di hTERT e l’attività
telomerasica (Kirkpatrick et al., 2003; Ohyashiki et al., 2005; Briatore et al., 2009), alcuni
52
studi mettono in evidenza una discrepanza tra i due fattori, suggerendo l’importanza dei
meccanismi di regolazione post trascrizionali della telomerasi (Yan et al., 2002; Swiggers et
al., 2006). In particolare lo studio di Swiggers e collaboratori (2006) su pazienti affetti da
LAM ha messo in evidenza come la complessità del cariotipo (più di 3 riarrangiamenti
cromosomici) fosse associata a telomeri particolarmente corti ed a elevata attività
telomerasica, ma non a livelli di espressione di hTERT superiori a quelli riscontrati in LAM a
cariotipo normale. L’analisi dell’espressione delle proteine che compongono lo shelterin
dimostra un’aumentata espressione di TRF1 (regolatore negativo dell’allungamento dei
telomeri telomerasi dipendente; van Steensel & de Lange, 1997) nelle LAM a cariotipo
complesso rispetto a quelle a cariotipo normale, ma non di TRF2 e POT1 (proteine di
capping; van Steensel et al., 1998).
Molti studi mirano ad avvalorare l’idea che l’espressione di hTERT possa essere considerata
fattore prognostico nelle SMD per l’evoluzione in LAM e nelle LAM per il rischio di relapse
(Gürkan et al., 2005; Bock et al., 2004; Huh et al., 2005; Briatore et al., 2009).
In un recente lavoro si mettono in relazione l’attività telomerasica e l’espressione di hTERT
con l’espressione di c-myc, mad1 e p53 (fattori trascrizionali che agiscono su hTERT; Cong et
al., 2002) in pazienti affetti da SMD e LAM secondaria a SMD. Mentre non si rileva
differenza nell’espressione di c-myc e p53 tra pazienti e controlli, l’espressione di mad1
aumenta nelle SMD, soprattutto in quelle caratterizzate da prognosi migliore (Briatore et al.,
2009).
Il gruppo di Göhring, in un recente lavoro, evidenzia l’importanza non tanto della media della
lunghezza dei telomeri, quanto della lunghezza dei telomeri di alcuni specifici cromosomi
coinvolti nelle anomalie citogenetiche più comuni nelle SMD (Lange et al., 2010).
Utilizzando un’innovativa tecnica in FISH, denominata T/C-FISH (telomere/centromerefluorescence in situ hybridisation) che permette l’analisi delle sequenze telomeriche su ogni
singolo cromosoma, gli autori evidenziano la nota riduzione generale dei telomeri tipica delle
SMD senza particolari differenziazioni in base al cariotipo eccetto che per i pazienti con la
monosomia isolata del 7. Questi pazienti hanno elevata attività telomerasica e telomeri
significatamente più lunghi in molti cromosomi, 7 incluso, rispetto ai pazienti a cariotipo
normale (Lange et al., 2010).
53
2. SCOPO DELLA TESI
Negli ultimi anni lo studio dei telomeri ha suscitato un crescente interesse in campo medico e
biologico. Il loro ruolo nell’invecchiamento cellulare e nella carcinogenesi ha fatto sì che le
pubblicazioni scientifiche riguardanti l’erosione dei telomeri e l’attività telomerasica si stiano
moltiplicando di anno in anno, anche se i risultati rimangono contradditori.
Lo scopo di questo lavoro è quello di studiare la lunghezza dei telomeri, l’attività telomerasica
ed i fattori trascrizionali ad essa correlati nelle sindromi mielodisplatiche. Sono stati quindi
selezionati un gruppo di pazienti con diagnosi di SMD rappresentanti tutti i sottotipi WHO e
di LAM de novo o secondaria a SMD, seguiti dalla Clinica di Ematologia di Ancona, dal 2008
al 2012, per i quali i parametri in esame sono stati messi in relazione con le caratteristiche
cliniche e biologiche (sottogruppo FAB e WHO, età, percentuale di blasti, cariotipo e rischio
IPSS) al fine di valutarne la possibilità di utilizzo come marker nella diagnosi e nella prognosi
delle sindromi mielodisplastiche.
54
3. MATERIALI E METODI
3.1 PAZIENTI
Nel periodo che va da Ottobre 2008 a Settembre 2012 nel laboratorio della Clinica di
Ematologia della Facoltà di Medicina e Chirurgia dell’Università Politecnica delle Marche
sono stati raccolti campioni di sangue midollare, durante le procedure diagnostiche e previo
ottenimento del consenso informato, di 109 pazienti con diagnosi di SMD e di 47 pazienti con
diagnosi LAM de novo o secondaria a SMD. I campioni sono stati ottenuti dal Registro
Marchigiano delle Sindromi Mielodisplastiche ed il protocollo è stato approvato dal Comitato
Etico e segue le guidelinea della Dichiarazione di Helsinki.
I pazienti con SMD sono stati valutati per le caratteristiche cliniche quali l’età ed il sesso, e le
caratteristiche della malattia, quali il sottogruppo FAB e WHO, la percentuale di blasti, la
citogenetica e lo score prognostico IPSS (Tabella 3.1). All’analisi dei dati questi pazienti sono
stati suddivisi in due gruppi sulla base dello score IPSS, SMD a basso rischio (SMD-BR) con
score IPSS pari a “basso” e “intermedio 1” (n=83) e SMD ad alto rischio (SMD-AR) con
score IPSS pari a “intermedio 2” e “alto” (n=20). I pazienti affetti da LMMC sono stati
analizzati separatamente (n=8). Come controlli sono stati utilizzati 24 campioni di sangue
midollare prelevati da 12 pazienti affetti da linfoma non-Hodgkin’s (LnH) senza
compromissione midollare, da 10 individui sani che erano stati sottoposti ad espianto di
midollo per donazione a fini trapiantologici e da 2 pazienti che erano stati sottoposti ad
intervento chirurgico dell’anca. I campioni sono stati ottenuti previo ottenimento del consenso
informato.
55
Tabella 3.1 Caratteristiche cliniche dei pazienti e dei controlli.
Caratteristiche cliniche dei controlli
Età
< 65 anni
65-74 anni
> 75 anni
Sesso
M
F
N° (24, controlli)
%
10
6
8
42
25
33
13
11
54
46
Caratteristiche cliniche dei pazienti
Età
< 65 anni
65-74 anni
> 75 anni
Sesso
M
F
Classificazione FAB
RA
RARS
RAEB
RAEB-t
CMML
AML
Classificazione WHO
RA
RCMD
RAEB-1
RAEB-2
RARS
5q- S
CMML
AML
IPSS categorie di rischio*
Basso
INT-1
INT-2
Alto
Non Valutabile
Cariotipo*
Favorevole
Intermedio
Sfavorevole
Non Valutabile
Numero di blasti*
<5
5-10
11-20
>20
N° (156, pazienti)
%
36
46
74
24
29
47
87
69
57
43
64
3
30
4
8
47
41
2
19
3
5
30
28
19
15
15
3
17
8
51
18
12
10
10
2
11
5
32
32
40
13
9
15
29
37
12
8
14
70
22
2
15
64
20
2
14
61
33
11
4
56
30
10
4
56
3.2 PREPARAZIONE DEL CAMPIONE
Il sangue midollare, trattato con EDTA come anticoagulante, è stato diluito 1:3 con Phosphate
Buffered Saline (PBS Dulbecco’s). Le cellule mononucleate (CMN) sono state isolate
mediante stratificazione su Ficoll-Paque (MP Biomedical, Santa Ana, California, USA) e
centrifugazione a 1500 rpm per 30 minuti a temperatura ambiente; sono stati fatti due lavaggi
in PBS mediante centrifugazione a 1800 rpm per dieci minuti a temperatura ambiente e quindi
la determinazione della conta cellulare al Coulter Serie Ac·T (Beckman Coulter). Il campione
è stato suddiviso in aliquote da 107 di CMN in provette per crioconservazione come pellet
anidro per l’estrazione del DNA o come lisato in buffer RLT (Qiagen, GmbH, Germany) per
l’estrazione dell’RNA.
3.3 ANALISI DELLA LUNGHEZZA DEI TELOMERI
Il DNA è stato estratto mediante il QIAamp DNA Blood Mini Kit (Qiagen) secondo la
procedura consigliata. La quantità e la purezza del DNA sono state valutate allo
spettrofotometro e mediante elettroforesi in gel orizzontale di agarosio all’ 1% , in tampone
TAE 1X (Tris Base, acetato, EDTA bisodico in acqua distillata), colorato con Gel Red
(Biotium), in un campo elettrico di 10 mV/cm, paragonando le bande ottenute con quelle di
una scala di pesi molecolari (GeneRuler DNA Ladder Mix Fermentas).
Per la determinazione della lunghezza delle porzioni telomeriche dei cromosomi è stato
utilizzato il TeloTAGGG Telomere Lengh Assay Kit (Roche Applied Science, Manheim,
Germany) che permette di esprimere la lunghezza dei telomeri come lunghezza media dei
frammenti di restrizione telomerici (Telomere Restriction Fragment, TRF).
Tale protocollo prevede tre passaggi:
1.
digestione del DNA genomico estratto
2.5 g di DNA genomico, diluito in un volume di 17 μl, sono digeriti con 20 U di Hinf I e 20
U di RsaI, in Digestion Buffer 1X (Roche) per un volume finale di 20 l; la miscela di
reazione viene incubata a 37°C per 4 ore. Gli enzimi digeriscono il DNA agendo su siti
presenti nelle sequenze non telomeriche ma non su quelle sub-telomeriche o telomeriche.
2.
separazione dei frammenti di restrizione mediante elettroforesi su gel d’agarosio e
trasferimento su membrana (Southern Blotting)
57
I campioni di DNA digerito, insieme ad una scala di pesi molecolari marcata con
digossigenina (DIG) fornita dal kit, sono sottoposti a elettroforesi su gel di agarosio allo 0,8%
in tampone TAE 1X e campo elettrico di 5 mV/cm. La corsa è stata interrota quando la banda
del colorante aveva percorso ca 10 cm.
Il gel è quindi trattato con tre diverse soluzioni, in leggera agitazione, per denaturare il DNA e
facilitarne il passaggio alla membrana e la successiva ibridazione: una soluzione acida con
HCl 0,25 M che determina una parziale depurinazione degli acidi deossiribonucleici, una
soluzione di denaturazione (NaOH 0.5 M, NaCl 1.5 M) che causa l’idrolisi dei legami
fosfodiesterici nei siti di depurinazione e una soluzione di neutralizzazione ( Tris-HCl 0,5M,
NaCl 3M, pH 7,5). Il DNA è quindi trasferito per capillarità con SSC 20X (NaCl 3M, Citrato
di Sodio 0,3M, pH 7,0) su membrana di nylon carica positivamente (Roche). Il DNA trasferito
è fissato covalentemente sulla membrana tramite UV-autocrosslinking a 1200 μJoule X 100
utilizzando lo Stratalinker 2004 (Stratagene).
3.
ibridazione con sonda telomero-specifica marcata con DIG, incubazione con anticorpo
anti-DIG coniugato con Fosfatasi Alcalina (AP) e rilevamento della chemiluminescenza
prodotta dal substrato CDP-Star
La membrana è inserita nel tubo del fornetto da ibridizzazione Hibridiser HB-1D (Techne),
per essere trattata con le soluzioni, fornite dal kit, che determinano il legame con la sonda e la
reazione con l’anticorpo anti-DIG. I passaggi sono i seguenti:
a) pre-ibridazione, per 30-60 minuti a 42 °C, con DIG Easy Hyb (Roche)
b) ibridazione, per 3 ore a 42°C, con DIG Easy Hyb contenente la sonda telomero-specifica
marcata con DIG (Roche);
c) lavaggio a bassa stringenza a 25 °C per 5 minuti ripetuto due volte con SSC 2X, SDS 0,1X;
d) lavaggio ad alta astringenza per 15-20 minuti a 50°C ripetuto due volte con SSC 0,2X e
SDS 0,1X;
e) lavaggio con washing buffer 1X (Roche), per 5 minuti a 25°C;
f) condizionamento con blocking solution 1X (Roche) per 30 minuti a temperatura ambiente;
g) marcatura con Anti-DIG-AP working solution (Roche), contenente l’anticorpo anti-DIG
legato alla Fosfatasi Alcalina, per 30 minuti a temperatura ambiente;
h) due lavaggi con washing buffer 1X (Roche) per 15 minuti a temperatura ambiente;
i) condizionamento con detection buffer 1X (Roche), per 5 minuti a temperatura ambiente.
Terminati questi passaggi, la membrana è estratta dal tubo, asciugata dall’eccesso di liquido e
posta tra i due fogli di una busta da ibridizzazione (Roche). Si aggiungono quindi 3 ml del
substrato CPD-Star (Roche), dopo 5 minuti di incubazione a temperatura ambiente si elimina
58
l’eccesso di liquido e si acquisisce il segnale chemiluminescente con l’acquisitore di
immagini Chemidoc (Bio-Rad California, USA; Figura 3.1).
Figura 3.1 Rilevamento chemiluminescente dei TRF di 8 pazienti con SMD (lane 1-8) e di un controllo (lane 9).
Il segnale è stato analizzato in densitometria con il software Quantity One (Bio-Rad). La
lunghezza dei telomeri, espressa come TRF è calcolata in base alla formula:
TRF = Σ(ODi) / Σ(ODi /Li)
dove ODi è la densità rilevata nella porzione i di segnale e Li è la sua lunghezza in kb
calcolata interpolando la mobilità elettroforetica misurata in cm con una retta di taratura
costruita sulla base della scala di pesi molecolari.
3.4 STUDIO DELL’ATTIVITÀ TELOMERASICA
L’attività telomerasica è stata valutata con il TeloExpress Quantitative Telomerase Detection
Kit (XpressBio Maryland, USA), che associa il protocollo di amplificazione delle sequenze
59
ripetute telomeriche (TRAP) alla quantificazione in real time PCR con rilevazione in Sybr
Green.
Per ogni campione studiato è stato raccolto un pellet di circa 1x105 CMN che sono state, in
seguito, lisate con 100 l di Teloexpress Lysis Buffer (XpressBio) mediante un’incubazione in
ghiaccio per 30 minuti e quindi due centrifugazioni successive a 12000g per 3 e 20 minuti
rispettivamente per eliminare il detrito cellulare e ottenere un estratto proteico limpido che è
stato suddiviso in aliquote da 10 l e repentinamente congelato a -80°C, facendo un bagnetto
con etanolo assoluto e ghiaccio secco. Le proteine totali dell’estratto cellulare sono state,
quindi, quantificate spettrofotometricamente a 595 nm con il Bio-Rad Protein Assay (BioRad) utilizzando una retta di taratura con albumina serica bovina (BSA) a 6 punti (range 1,25
g/ml – 10 g/ml).
Per la quantificazione in PCR-Real Time sono state preparate delle diluizioni scalari (10-1,
10-2, 10-3, 10-4 amol/l) di standard oligonucleotidici di riferimento partendo da una soluzione
madre fornita dal kit alla concentrazione di 1 amol/l. Una linea cellulare fornita dal kit (XT106, XpressBio) caratterizzata da un elevata attività telomerasica è stata utilizzata come
controllo positivo.
La reazione di Real-time PCR è stata fatta in triplicato per ogni campione studiato, compreso
il controllo positivo, e in doppio per gli standard. La mix di reazione era così composta:
TeloExpress Master Mix 1X (pari a 15 l), 50nM di Fluorescein-NIST Traceable Standard
(Invitrogen) e 1 l di campione o controllo positivo (pari a 8,8-1.100 ng/l di proteina) o
standard oligonucleotidico, quindi acqua fino al volume finale di 25l.
La reazione, nel Biorad iCyclerTM Optical Module System, seguiva il seguente profilo: un
primo step a 25°C per 20 minuti in cui l’enzima telomerasi presente negli estratti proteici dei
campioni agisce sugli oligonucleotidi presenti nella master mix determinandone
l’allungamento tramite l’aggiunta di sequenze ripetute TAAGGG; un secondo step a 95°C per
10 minuti e quindi 40 cicli che comprendevano una fase di denaturazione a 95°C per 30
secondi e una fase di annealing e allungamento a 60°C per 90 secondi. Il Fluorescein-NIST
Traceable Standard è un normalizzatore di fluorescenza. I risultati sono stati espressi come la
media dei triplicati in amoli di oligonucleotidi incorporati/g proteina.
60
3.5 ANALISI DELL’ESPRESSIONE GENICA
Per la determinazione dell’espressione di hTERT è stata utilizzata una metodica di Real-time
PCR con sonde a idrolisi (TaqMan). È stato quantificato sia il trascritto che codifica la
proteina funzionale, hTERT-full-length (hTERT-FL), sia il pool di trascritti che in vivo sono
processati prima della traduzione, hTERT-all transcripts (hTERT-AT). I primer e le sonde per
hTERT-AT
e
hTERT-FL
sono
stati
disegnati
con
il
software
Primer3
(http://frodo.wi.mit.edu/primer3/) e riportati nella Tabella 3.2. I dati di espressione sono stati
normalizzati per l’espressione del gene housekeeping GAPDH. Le sequenze dei primer e le
sonde, nonché le coordinate NCBI delle sequenze utilizzate per la loro progettazione sono
riassunte in Tabella 3.2. Per generare le curve standard a 4 punti utilizzate per la
quantificazione dei trascritti sono state fatte diluizioni scalari di ampliconi purificati di
hTERT e GAPDH. Gli ampliconi sono stati costruiti mediante l’estrazione dell’ RNA da
1x107 di cellule HeLa, retrotrascrizione dell’RNA in cDNA ( reazione descritta in seguito) ed
amplificazione di 2l di cDNA utilizzando i primer riassunti nella Tabella 3.3 con Hot Star
Taq Master Mix 1X (Qiagen) e 300 pmoli di primer forward e reverse. Le condizioni di
amplificazione erano: uno step di denaturazione iniziale a 95°C per 15 minuti, seguito da 40
cicli di denaturazione a 95°C per 45 secondi, annealing a 65°C per 30 secondi e allungamento
per 45 secondi a 72°C, e un allungamento finale a 72°C per 7 minuti. L’amplificazione è stata
fatta utilizzando il termiciclatore MyCycler (Bio-Rad). Gli ampliconi sono stati caricati e fatti
correre su un gel di agaroso, in seguito sono stati purificati mediante NucleoSpin Extract kit
(M-Medical, Milan, Italy) e poi quantificati allo spettrofotometro. I risultati di espressione
genica erano la media dei duplicati, espressi come n° copie di hTERT-FL (AT)/106 copie
GAPDH.
La quantificazione dei trascritti di c-myc, p53 e mad-1 è stata valutata sempre in real-time
PCR con sonde a idrolisi, utilizzando sonde e primer disegnati con il software Primer3
(http://frodo.wi.mit.edu/primer3/) o acquistati come TaqMan® Gene Expression Assay
(Applied Biosystems, Life Technologies,
p53 ID: Hs 00153349_m1; GAPDH ID:
Hs99999905_m1). Le sequenze dei primer e le sonde utilizzate nella quantificazione e nella
generazione degli standard di riferimento, nonché le coordinate NCBI delle sequenze usate
per progettarli sono riassunte in Tabella 3.2 e 3.3. La curva standard di riferimento viene
costruita con diluizioni scalari dell’amplicone purificato di c-myc, p53 e mad-1 ottenuto da
CMN di midollo osseo di donatore secondo la metodica utilizzata per hTERT. I risultati sono
61
stati normalizzati per l’espressione di GAPDH e sono la media dei duplicati espressi come n°
copie del gene in studio/n° di copie di GAPDH.
Ogni campione di RNA è stato estratto da 1x107 di CMN mediante RNeasy Mini Kit (Qiagen)
seguendo la procedura raccomandata dalla casa fornitrice e quantificato allo spettrofotometro.
La purezza dell’RNA è stata valutata dal rapporto tra l’assorbanza a 260 nm e quella a 280 nm
(>1,8-2,0). Ogni campione di RNA è stato retrotrascritto con questa procedura: 1 μg di RNA
totale viene retrotrascritto in 20 μl finali di reazione contenente RT Buffer 1X (Invitrogen Life
Technologies, Carlsbad, California, USA), 4 mM di dNTPs (Biotech Milan, Italy), 5 mM di
MgCl2 (Promega Milan, Italy), 5 μM di Random examers (Invitrogen), 10 mM di DTT
(Invitrogen), 20 U di RNase inhibitor (Takara Shiga, Japan) e 200 U di M-MuLV Reverse
trascriptase (Invitrogen). Le condizioni di retrotrascrizione erano: un primo step di
denaturazione a 70°C per 10 minuti, un secondo di annealing a 20°C per 10 minuti, un terzo
di sintesi del cDNA a 42°C per 45 minuti ed uno step finale a 99°C per 3 minuti.
I prodotti di retrotrascrizione (cDNA) sono stati utilizzati direttamente nelle reazioni di RealTime PCR eseguite nel termociclatore Biorad iCyclerTM Optical Module System.
Per ogni Real Time PCR, 2 μl di cDNA sono stati amplificati amplificati in 25 μl finali di
reazione contenente Hot Start Taq Master Mix 1X (Qiagen), 0,4 μΜ di ciascun primer
(Sigma-Aldrich, St Louis, Missouri, USA) e 0,1 Μ di sonda.
L’amplificazione consiste in un primo step di denaturazione iniziale a 94°C per 15 minuti,
quindi un secondo step con 50 cicli di denaturazione a 94°C per 30 secondi e
annealing/estensione a 60°C per 1 minuto.
62
Tabella 3.2 Primer e sonde per la quantificazione dell’espressione genica utilizzate in questo
lavoro.
Gene
Sequenza primer e sonde 5’-3’
c-myc
TTCGGGTAGTGGAAAACCAG (Fw)
CAGCAGCTCGAATTTCTTCC
(Rv)
BHQ1 CCCTCAACGTTAGCTTCACC 6-FAM (Sonda)
mad1
AGTGGAGCTGGAGAGAGCAG (Fw)
GCATCCAAGTTCTGCTGACA (Rv)
BHQ1 GGAACTACGAGCGTGAGGTC 6-FAM (Sonda)
GAPDH
CCTGTTCGACAGTCAGCCG
(Fw)
CGACCAAATCCGTTGACTCC (Rv)
BHQ1 AGCCACATCGCTCAGACACCATGG 6-FAM (Sonda)
hTERT-AT
CGGAAGAGTGTCTGGAGCAAG (Fw)
GGATGAAGCGGAGTCTGGA
(Rv)
BHQ1 TTGCAAAGCATTGGAATCAGACAGCAC 6-FAM (Sonda)
hTERT-FL
TGTACTTTGTCAAGGTGGATGTGA (Fw)
GCTGGAGGTCTGTCAAGGTAGAG (Rv)
BHQ1 AACCCCAGAACACGTACTGC 6-FAM (Sonda)
63
Tabella 3.3 Primer utilizzati per la generazione degli standard di riferimento.
Gene
Sequenza primer 5’-3’
ID Number
p53
CATGAGCGCTGCTCAGATAG (Fw)
NM_001126117.1
TCAGTCTGAGTCAGGCCCTT (Rv)
c-myc
TCGGGGCTTTATCTAACTCG (Fw)
NM_002467.4
TAGGAGGCCAGCTTCTCTGA (Rv)
mad1
TCATCTCTCAGCGTGTGGAG (Fw)
NM_002357.3
GCCGTACCAGCTCAGACTTC (Rv)
GAPDH
AAATTGAGCCCGCAGCCTCC (Fw)
NM_002046
CTGCAAATGAGCCCCAGCCT (Rv)
hTERT
AAGTTCCTGCACTGGCTGATG (Fw)
AF015950
GGCACATGAAGCGTAGGAAGA (Rv)
64
3.6 ANALISI DEL CICLO CELLULARE
Per analizzare il ciclo cellulare sono state saggiate 1x106 CMN per ogni campione. Le cellule
sono state sottoposte a due lavaggi con PBS e poi risospese in 0,5 ml di PBS. In seguito le
cellule sono state fissate con 4,5 ml di etanolo al 75% a 4°C per almeno 30 min.
Successivamente le cellule sono state lavate con PBS e colorate con una soluzione contenente
Propidium Iodide alla concentrazione di 50 µg/ml addizionato con RNase alla concentrazione
di 100 µg/ml e poste a 37°C, al buio per 15 min. Per determinare il ciclo cellulare le cellule
colorate sono state acquisite con il citofluorimetro BD FACSCalibur (BD Biosciences, San
Jose, CA) ed analizzate mediante il software CellQuest.
3.7 ANALISI STATISTICA
I dati relativi alle caratteristiche cliniche dei pazienti e i dati sperimentali sono stati raccolti in
un database e analizzati con il software statistico SPSS 17 per Windows. I dati sono stati
espressi come la media dei duplicati ± la deviazione standard. Il confronto tra i sottogruppi di
rilevanza clinica per i parametri analizzati sperimentalmente è stato studiato con la metodica
ANOVA univariata (ANOVA, SPSS 17.0 package, USA and multiple comparison). Le
correlazioni sono state analizzate con il test di Spearman. Le differenze della lunghezza dei
telomeri, dell’attività telomerasica e dell’espressione genica di h-TERT, c-myc, mad1 e p53
tra controlli e i diversi gruppi di pazienti sono state analizzate con il test di Student. Il test non
parametrico per due campioni indipendenti, Mann-Whitney U test, è stato utilizzato per
confrontare l’età dei pazienti con quella dei controlli. Il limite per la significatività statistica è
stato posto con p< 0,05.
65
4. RISULTATI
Le indagini sull'omeostasi dei telomeri nelle SMD e nelle LAM, al fine di valutarne il
possibile ruolo prognostico, si sono rivolte su due fronti. In primis è stata valutata la
lunghezza delle sequenze telomeriche, l'espressione dell'attività telomerasica e del gene
codificante la porzione catalitica di tale enzima (hTERT), quindi l’ attenzione è stata rivolta
all'analisi dei fattori trascrizionali coinvolti nella regolazione, sia positiva che negativa,
dell'espressione di tale gene.
4.1 LUNGHEZZA DEI TELOMERI
Come ampiamente descritto in letteratura (Mather et al., 2011), la lunghezza dei telomeri
varia in funzione dell’età dell'individuo, in particolare è stato dimostrato che i telomeri si
accorciano con l’avanzare dell’età. In questo lavoro quindi è stato suddiviso il gruppo di
controllo in due sottogruppi: il primo con età inferiore ai 65 anni (range 24/64 anni) ed il
secondo con età superiore ai 65 anni (range 65/81 anni). Quest’ultimo aveva la lunghezza
media dei telomeri (TRF) significatamente più corta del primo gruppo (Fig. 4.1). I valori di
TRF erano pari a 10,13 ± 0,77 Kb (range 9,16 Kb / 11,00 Kb) per i il primo gruppo e pari a
8,08 ± 0.097 Kb (range 4.07 Kb / 11.05 Kb; p<0,05) per il secondo gruppo.
Figura. 4.1 Analisi della lunghezza dei telomeri nei due gruppi di controlli suddivisi in base all’età (<65 anni;
>65 anni).
66
In tutti i campioni analizzati la TRF era significativamente inferiore rispetto ai due gruppi di
controlli (p<0.02, Fig. 4.2). Tutte le succesive analisi sono state effettuate paragonando i
pazienti al gruppo di controlli anziani, infatti la maggior parte dei pazienti studiati erano
anziani (il 75% aveva più di 65 anni), i dati riguardanti l’età dei pazienti e dei controlli erano
normalmente distriubuiti (Mann-Whitney U test, p=0.087). In particolare, i pazienti con
SMD-BR (n= 83) mostravano una TRF di 7,13 ± 1,43 Kb (range 4,07 Kb / 11.03 Kb), i
pazienti con SMD-AR (n= 20) avevano una TRF pari a 6,33 ± 1,02 Kb (range 4.73 Kb /8.58
Kb), i pazienti con LMMC (n= 8) una TRF di 5.64 ± 1,61 Kb (range 3,23 Kb / 7,33 Kb), i
pazienti affetti da LAM (n= 48) una TRF di 6,16 ± 1,77 Kb (range 3,55 Kb / 11,40 Kb).
Figura. 4.2 Analisi della lunghezza dei telomeri in pazienti affetti da SMD a basso rischio (SMD-BR), SMD ad
alto rischio (SMD-AR), Leucemia mielomonocitica cronica (LMMC) e Leucemia acuta mieloide (LAM)
Analizzando le differenze tra gruppi, le SMD-BR mostravano una TRF significativamente
maggiore rispetto alle SMD-AR (p<0,02), alle LMMC (p<0,01) e alle LAM (P<0.001)
Suddividendo i pazienti in quattro gruppi in base alla percentuale di blasti AAM (Fig. 4.3). I
pazienti con <5% di blasti (TRF 7,15 ± 1,22 Kb) avevano i telomeri significativamente più
lunghi dei pazienti con blasti compresi tra 11% e il 20% (TRF 6,11 ± 1,9 Kb, p= 0,025) e di
quelli con >20% blasti (TRF 5,59 ± 1,09 Kb, p=0.013).
67
Figura 4.3 Analisi dei telomeri in pazienti affetti da SMD suddivisi in base alla percentuale dei blasti midollari.
4.2 ESPRESSIONE DI hTERT
Il trascritto hTERT-AT, in tutti i campioni analizzati controlli compresi, era dalle 5 alle 10
volte più abbondante del trascritto hTERT-FL. L'andamento è stato confermato dall'analisi
d'espressione dei due trascritti in cellule HL60 (hTERT-AT 3088 copie / 106 copie GAPDH,
hTERT-FL 419 copie /106 copie GAPDH) e HeLa (hTERT-AT 1436 copie / 106 copie
GAPDH, hTERT-FL 203 copie /106 copie GAPDH; Fig. 4.4).
I livelli di espressione di hTERT-FL erano molto eterogenei sia nei pazienti con SMD che nei
pazienti con LAM (Fig.4.5). L’elevata eterogeneità non permetteva di rilevare differenze
significative tra SMD-BR, SMD-AR e LAM se si considerava la totalità dei pazienti
sottoposti ad analisi.
68
Figura 4.4 Esperimento rappresentativo: espressione di hTERT-AT e hTERT-FL in due campioni di soggetti
sani (Normale 1 e 2), in due campioni di pazienti affetti da sindrome mielodisplastica a basso rischio (MSD-BR
1 e 2), in due campioni di pazienti affetti da sindrome mielodisplastica a alto rischio (MSD-AR 1 e 2), in due
campioni di pazienti affetti da leucemia mielomonocitica cronica (LMMC 1 e 2), in due campioni di pazienti
affetti da leucemia acuta mieloide (LAM 1 e 2), in cellule HL60 e Hela.
Figura 4.5 Espressione di hTERT in pazienti affetti da SMD a basso rischio (SMD-BR), SMD ad alto rischio
(SMD-AR), Leucemia mielomonocitica cronica (LMMC) e Leucemia acuta mieloide (LAM)
69
È stato possibile tuttavia suddividere i pazienti in sottogruppi in base all'espressione di
hTERT-FL utilizzando come discriminante un valore pari alla media dei valori dei controlli
(13,27 ± 7,51 copie hTERT-FL/106 copie GAPDH) addizionata della sua deviazione standard
(pari a 20,78 copie hTERT-FL/106 copie GAPDH, Fig. 4.6). Si osservava che ca il 55% dei
pazienti con SMD-BR mostravano hTERT-FL significativamente più espresso dei controlli
(56,48 ± 33,26 copie hTERT-FL/106 copie GAPDH, p<0,01), il restante 45% mostrava livelli
di espressione del tutto paragonabili ai controlli (15,46 ± 9,88 copie hTERT-FL/106 copie
GAPDH). Oscillazioni più evidenti si osservavano nei pazienti affetti da SMD-AR e da LAM.
Il 65% dei pazienti SMD-AR aveva livelli di espressione significativamente più elevati dei
controlli (89,60 ± 78,96 copie hTERT-FL/106 copie GAPDH, p<0.005), il 35 % non mostrava
differenze (10,98 ± 10,15 copie hTERT-FL/106 copie GAPDH). Analogamente il 55% delle
LAM aveva hTERT-FL significativamente più espresso (80,72 ± 75,52 copie hTERT-FL/106
copie GAPDH, p<0.005) mentre il restante 45% mostrava livelli analoghi ai controlli (9,98 ±
6,14 copie hTERT-FL/106 copie GAPDH). Il 40% delle LMMC (53,29 ± 23,57 copie hTERTFL/106 copie GAPDH) esprimevano valori di hTERT-FL significativamente più elevati dei
controlli (p<0.01), mentre i livelli di espressione del restante 60% era nella norma (10,69 ±
7,09 copie hTERT-FL/106 copie GAPDH). A causa dell'elevata eterogeneità dei livelli di
espressione, non è stato possibile effettuare analisi univariate in base alla percentuale di blasti,
al cariotipo e alle classificazioni FAB e WHO. È stato comunque possibile notare che nel
sottogruppo delle SMD-AR con elevati livelli di hTERT, l’espressione di tale gene era
significativamente superiore rispetto al sottogruppo delle SMD-BR (p=0,004) e delle LAM
(p=0,028) con elevati livelli di espressione di hTERT.
70
Figura 4.6 Espressione di hTERT-FL in pazienti affetti da SMD a basso rischio (SMD-BR), SMD ad alto rischio
(SMD-AR), Leucemia mielomonocitica cronica (LMMC) e Leucemia acuta mieloide (LAM). I pazienti sono
ulteriormente suddivisi in sotto-gruppi: SMD-BR/alto, SMD-BR/basso, SMD-AR/alto, SMD-AR/basso,
LMMC/alto LMMC/basso, LAM/alto e LAM/basso a seconda che l'espressione di hTERT-FL superi il valore
soglia di 20,78 copie hTERT-FL/106 copie GAPDH. (* p<0,01; ** p<0,005).
4.3 ATTIVITÀ TELOMERASICA
L’estrema variabilità riscontrata nell’espressione di hTERT è stata ritrovata nella valutazione
dell’attività telomerasica (Fig.4.7)
Anche in questo caso i gruppi di pazienti potevano essere suddivisi in sottogruppi a seconda
che la loro attività telomerasica superasse il cut-off posto come la media dei valori dei
controlli (0,00046 ± 0,00032 amoli/g prot) addizionata alla deviazione standard (0.00078
amoli/g prot Fig.4.8). In questo caso solo il 20% delle SMD-BR (0,0017 ± 0,00087 amoli/g
prot, p>0,001) e delle SMD-AR (0,0022 ± 0,00082 amoli/g prot, p<0,005), il 50% delle
LMMC (0,0024 ± 0,001 amoli/g prot, p<0,005) e il 35% delle LAM (0,0026 ± 0,002
amoli/g prot, p<0,005) mostrava un’ attività telomerasica superiore al cut-off.
71
Figura 4.7. Analisi dell’Attivita telomerasica nei gruppi di pazienti SMD-BR, SMD-AR, LMMC, LAM.
Figura 4.8 Attività telomerasica in pazienti affetti da SMD-BR, SMD-AR, LAM e LMMC. I pazienti sono
ulteriormente suddivisi in sotto-gruppi: SMD-BR/alto, SMD-BR/basso, SMD-AR/alto, SMD-AR/basso,
LAM/alto e LAM/basso a seconda che l'espressione di hTERT-FL superi il valore soglia di 0.00078 amoli/g
prot. (* p<0,01; ** p<0,005).
72
Non è stato possibile effettuare analisi univariate in base alla percentuale di blasti, al cariotipo
e alle classificazioni FAB e WHO, a causa dell'elevata eterogeneità dei livelli di AT.
4.4 ESPRESSIONE DEI FATTORI DELLA TRASCRIZIONE: MAD-1, C-MYC, P53
L’espressione del fattore della trascrizione mad-1 era significativamente superiore in tutti i
gruppi di pazienti affetti da SMD rispetto al gruppo dei controlli. In particolare nei pazienti
SMD-BR era di 0.0064± 0,003 n° copie / n° copie GAPDH (p<0.01), nei SMD-AR di
0.0086± 0,0028 n° copie / n° copie GAPDH (p<0.005) e nelle LMMC di 0.0088± 0,0047 n°
copie / n° copie GAPDH (p<0.005) mentre nei controlli era pari a 0.0031± 0,00089 n° copie /
n° copie GAPDH. Nelle LAM i livelli di mad-1 (0,0055 ± 0.0025 n° copie / n° copie
GAPDH) erano comparabili ai controlli (Fig.4.9).
Figura 4.9 Espressione del fattore della trascrizione mad-1 in pazienti affetti da SMD a basso rischio (SMDBR), SMD ad alto rischio (SMD-AR), Leucemia mielomonocitica cronica (LMMC) e Leucemia acuta mieloide
(LAM). (* p<0,01; ** p<0,005).
Analizzando i pazienti secondo la classificazione WHO, emergevano ulteriori differenze
nell'espressione di mad-1. In particolare, le AREB-2 (0,012 ± 0,0078 n° copie / n° copie
GAPDH) esprimevano livelli di mad-1 superiori a tutte le altre classi di pazienti (p<0.05; Fig.
4.10). Suddividendo i pazienti in tre gruppi sulla base della valutazione del cariotipo (Fig
73
4.11), si osservava che i pazienti con cariotipo intermedio (0,012 ± 0,0049 n° copie / n° copie
GAPDH) e non favorevole (0,016 ± 0,0019 n° copie / n° copie GAPDH) mostravano una
maggiore espressione di mad-1 rispetto ai pazienti con un cariotipo favorevole (0,006 ±
0,0029 n° copie / n° copie GAPDH, rispettivamente p=0.008, p=0.002).
L’espressione di p53 non subiva variazioni tra pazienti e controlli (Fig. 4.12), l'espressione di
c-myc nelle LAM, pari a 0,044 ± 0,02 n° copie / n° copie GAPDH e nelle SMD-AR, pari a
0,036 ± 0,026 n° copie / n° copie GAPDH era significativamente superiore ai controlli (0,022
± 0,0076 n° copie / n° copie GAPDH, p<0,01 e p<0,05 rispettivamente; Figura 4.12).
Figura 4.10 Espressione del fattore della trascrizione mad-1 in pazienti affetti da Anemia Refrattaria (AR),
Sindrome 5q- (SND 5q-), Citopenia Refrattaria con Displasia Multilineare (CRDM), Anemia Refrattaria con
eccesso di blasti di tipo 1 (AREB-1), Anemia Refrattaria con eccesso di blasti di tipo 2 (AREB-2), Leucemia
mielomonocitica cronica (LMMC) e Leucemia acuta mieloide (LAM). (* p<0,05; ** p<0,005).
74
Figura 4.11 Espressione del fattore della trascrizione mad-1 nei pazienti suddivisi in base al cariotipo.
Figura 4.12 Espressione dei fattori della trascrizione c-myc e p53 in pazienti affetti da SMD a basso rischio
(SMD-BR), SMD ad alto rischio (SMD-AR), Leucemia mielomonocitica cronica (LMMC) e Leucemia acuta
mieloide (LAM,* p<0,05; ** p<0,01).
75
Seguendo la classificazione WHO, le AREB-2 erano quelle che esprimevano i maggiori livelli
di c-myc, significativamente più alti che nelle altre tipologie di SMD (0,052 ± 0,025 n° copie
/ n° copie GAPDH; p<0,05; Figura 4.13). Da notare che i pazienti con SND 5q- e AREB-1
mostravano i livelli più bassi di c-myc (0,012 ± 0,003 n° copie / n° copie GAPDH e 0,0099 ±
0,006 n° copie / n° copie GAPDH, rispettivamente, p<0.05; Fig.4.13).
Suddividendo i pazienti in base al numero di blasti all’aspirato midollare si notava che il
gruppo con l’11-20% di blasti aveva un’aumentata espressione di c-myc (0,061 ± 0,060 n°
copie / n° copie GAPDH) rispetto ai gruppi con numero di blasti <5% (0,027± 0,021 n° copie
/ n° copie GAPDH, p=0.026), con blasti 5-10% (0,021 ± 0,024 n° copie / n° copie GAPDH,
p=0.018) e con >20% di blasti (0,023 ± 0,014 n° copie / n° copie GAPDH, p=0.052, Fig.
4.14). Un’ulteriore suddivisione in base al cariotipo rivelava che i pazienti con cariotipo
intermedio (0,050 ± 0,034 n° copie / n° copie GAPDH) e non favorevole (0,072 ± 0,079 n°
copie / n° copie GAPDH) avevano livelli di espressione di c-myc superiori rispetto ai pazienti
con cariotipo favorevole (0,023 ± 0,016 n° copie / n° copie GAPDH, p=0.018 e p=0.005
rispettivamente; Fig.4.15)
Figura 4.13 Espressione del fattore della trascrizione c-myc in pazienti affetti da Anemia Refrattaria (AR),
Sindrome 5q- (SND 5q-), Displasia Multilineare (CRDM), Anemia Refrattaria con eccesso di blasti di tipo 1
(AREB-1), Anemia Refrattaria con eccesso di blasti di tipo 2 (AREB-2), Citopenia Refrattaria con Leucemia
mielomonocitica cronica (LMMC) e Leucemia acuta mieloide (LAM). (* p<0,05).
76
Figura 4.14 Espressione del fattore della trascrizione c-myc nei pazienti suddivisi in base al numero di blasti.
Figura 4.15 Espressione del fattore della trascrizione c-myc nei pazienti suddivisi in base al cariotipo.
77
4.5 CICLO CELLULARE
L’analisi del ciclo cellulare è stata effettuate analizzando la distribuzione del contenuto di
DNA presente nei campioni nelle fasi G1, S, G2. La percentuale di cellule in divisione è stata
calcolata come la media delle percentuali delle cellule in fase S e G2 presenti nei campioni. I
dati ottenuti dimostravano che i pazienti affetti da L-MDS avevano una percentuale media di
cellule in divisione (18,47±12.11%) significativamente più alta rispetto ai pazienti con HMDS (6.81±4.02%, Fig.4.16).
Figura 4.16 Analisi del ciclo cellulare valutato mediante citofluorimetria. I risultati sono rappresentativi di un
singolo esperimento (A-B): (A) campione rappresentativo del gruppo di pazienti H-MDS, (B) campione
rappresentativo del gruppo L-MDS. (C) Percentuale di cellule in fase S/G2 nei due gruppi di pazienti L-MDS e
H-MDS. I dati sono espessi come valore medio ± SD.
78
5. DISCUSSIONE
I telomeri sono formati da un complesso di DNA non codificante e proteine localizzato
all’estremità dei cromosomi eucariotici (Moyzis et al., 1988; de Lange 2005 e 2009). La loro
funzione è quella di proteggere i cromosomi dai possibili riarrangiamenti che porterebbero
alla perdita o alla duplicazione di materiale genetico. A causa del “problema della
replicazione terminale” del DNA (Watson 1972), le sequenze telomeriche si accorciano
progressivamente ad ogni divisione cellulare a meno che non intervenga il meccanismo di
allungamento dei telomeri che si basa sull’attività dell’enzima telomerasi, una
ribonucleoproteina (hTERT) con attività di trascrittasi inversa che utilizza un proprio stampo
a RNA (hTR) per sintetizzare le sequenze telomeriche (Greider & Blackburn, 1985;
Harrington et al., 1997; Feng et al., 1995). Alcuni tipi cellulari hanno un meccanismo
alternativo di allungamento dei telomeri indipendente dalla telomerasi (meccanismo ALT;
Bryan et al., 1995). La lunghezza dei telomeri dipende dal tessuto, dall’organo, dall’età, dal
corredo genetico e da fattori ambientali (Takubo et al., 2002). Può cambiare anche tra cellule
dello stesso tessuto e tra cromosomi della stessa cellula (Rufer et al., 1998). Sia hTR che
hTERT, presenti in singola copia nel genoma, sono finemente regolati a più livelli (Soder et
al., 1997; Bryce et al., 2000; Cong et al., 2002). Nella regolazione trascrizionale di hTERT
intervengono i fattori della famiglia Sp1, della famiglia c-myc/max/mad e molti altri, sia con
effetto positivo che negativo (Cairney & Keith, 2008). Un meccanismo di splicing alternativo,
soprattutto a livello embrionale, è importante per la regolazione tessuto specifica (Ulaner et
al., 2000). Molti tipi di cancro presentano anomalie sia nella lunghezza dei telomeri che
nell’espressione della telomerasi (Sieglovà et al., 2004; McGrath et al., 2007; Wu et al., 2003;
Jang et al., 2008; Shay & Bacchetti, 1997). La lunghezza dei telomeri è stata molto studiata a
livello genetico e le informazioni acquisite dagli studiosi negli anni fanno ipotizzare anche un
collegamento tra l’attività telomerasica e i disordini delle cellule staminali ematopoietiche
(Beakert, 2004).
Le sindromi mielodisplastiche sono un insieme di disordini del midollo osseo caratterizzate
dalla incapacità delle cellule progenitrici di maturare normalmente, causando la riduzione
quantitativa e qualitativa degli elementi cellulati del sangue periferico, citopenia, (Lichtman
2000). L’incidenza delle SMD è variabile, ha 3 e 12 casi su 100000 abitanti/anno, con
variazioni legate in parte alle differenze geografiche ed etniche ed in parte alla diversa
capacità di diagnosi e selezione dei singoli centri. L’incidenza aumenta considerevolmente
79
con l’età, soprattutto dopo i 70 anni (Bauduer et al., 1998; Iglesias Gallego et al., 2003; Ma et
al., 2007). Le sindromi mielodisplastiche sono anche dette “sindromi preleucemiche” in
quanto possono evolvere verso forme di leucemia acuta (Hamilton-Paterson 1949). L’IPSS,
pubblicato nel 1997, è il più noto e diffuso sistema di classificazione prognostica delle SMD,
un metodo empirico utilizzato per valutare l'entità del rischio di trasformazione leucemica. I
pazienti vengono suddivisi in tre gruppi di rischio considerando le anomalie genetiche, la
percentuale di blasti midollari ed il numero di citopenie. I tre gruppi di rischio per la
sopravvivenza mediana sono: basso rischio (5,7 anni); INT-1 (3,5 anni); INT-2 ( 1.2 anni);
alto rischio (0.4 anni). L’instabilità genetica è associata all’accorciamento dei telomeri
(Ohyashiki et al, 2001) ed il mantenimento della stabilità della lungezza dei telomeri è
associato all’attivazione della telomerasi (Morin et al, 1989). La regolazione dell’attività
telomerasica avviene su vari livelli: durante la trascrizione, il trasporto e la localizzazione
subcellulare di ogni componente, l’assemblaggio della ribonucleoproteina telomerasi attiva,
l’accessibilità della telomerasi stessa sul telomero. In molti casi l’espressione di hTERT è
strettamente correlata con l’attività telomerasica e con l’inizio e la progressione del cancro. La
telomerasi è trascrizionalmente repressa nelle cellule somatiche, mentre è nella forma attiva
nelle cellule immortalizzate (Cong et al, 2002). L’espressione di hTERT è regolata
positivamente e negativamente da numerosi fattori della trascrizione (Cairney et al, 2008).
In questo lavoro sono stati valutati la lunghezza dei telomeri, definita come terminal
restriction fragment (TRF), l’espressione del gene codificante la porzione catalitica della
telomerasi (hTERT), l’attività telomerasica (AT) ed alcuni fattori della trascrizione coinvolti
nella regolazione dell’espressione di hTERT: c-myc, mad-1, p53 in 156 pazienti affetti da
SMD (n=109) e da LAM de novo e secondarie a SMD (n=47). I pazienti sono stati confrontati
con un gruppo di 24 controlli. Come già descritto precedentemente (Mather et al, 2011) nel
nostro studio si è osservato che i telomeri si accorciano con l’età. Per questo motivo il gruppo
dei controlli è stato suddiviso in due sottogruppi in base all’età: inferiore e superiore ai 65
anni. Il gruppo più giovane ha TRF media più lunga di ca. 2 Kb rispetto al gruppo più
anziano. I pazienti affetti da SMD sono stati suddivisi in due sottogruppi in base allo score
IPSS: SMD-BR (IPSS basso e INT-1) e SMD-AR (IPSS INT-2 ed alto); inoltre le LMMC e
LAM sono state analizzate come categorie separate. Tutti i gruppi di pazienti analizzati hanno
TRF significativamente inferiore rispetto ai controlli sia giovani che anziani; inoltre le SMDBR hanno telomeri più lunghi rispetto alle SMD-AR, LMMC e LAM. Si può concludere che
esiste un’evidente anomala erosione delle regioni telomeriche nelle SMD che aumenta con la
severità della malattia, tali risultati sono in accordo con quelli precedentemente pubblicati
80
sebbene i precedenti lavori consideravano un gruppo inferiore di pazienti (Ohyashiki et al.,
1997; Sieglovà et al., 2004; Boultwood et al., 1997). Le successive analisi comparative casocontrollo sono state effettuate considerando il gruppo dei controlli anziani in quanto il 75%
dei pazienti aveva un’età superiore ai 65 anni.
Numerosi lavori dimostrano che l’espressione di hTERT e l’attività telomerasica possono
essere considerati marker comuni di malignità (Kim, 1997; Shay e Bachetti, 1997). In
letteratura i risultati riguardanti i livelli di espressione di hTERT e dell’attività telomerasica
nelle SMD sono discordanti. In particolare nel nostro studio è stato osservato che i valori di
hTERT e di AT erano molto eterogenei sia nelle SMD che nelle LAM, ciò sta ad indicare che
l’andamento della TFR può essere indipendente dai livelli di AT (Yan et al., 2002; Briatore et
al., 2009; Swiggers et al., 2006). È stato possibile comunque suddividere i pazienti, per
quanto riguarda l’espressione di hTERT e l’ attività telomerasica, utilizzando come cut off la
media dei valori dei controlli addizionata della deviazione standard. In tutti i gruppi è stato
possibile distinguere i pazienti con un’espressione di hTERT e di attività telomerasica simile
ai controlli e con un’espressione e un’attività maggiori rispetto ai controlli. Le oscillazioni
maggiori si sono osservate nei pazienti affetti da SMD-AR e da LAM. È interessante notare
una sostanziale discrepanza nella percentuale di pazienti che esprime elevati valori di hTERT
rispetto a quelli che hanno elevata attività telomerasica. Mentre oltre la metà dei pazienti
hanno incrementati livelli di hTERT, solo il 20% delle SMD e il 35% delle LAM hanno
un’attività telomerasica superiore alla norma. Ciò fa si che in ca. un terzo dei pazienti in
esame l’espressione del mRNA di hTERT non sia sufficiente per avere una telomerasi attiva.
Questi valori sono concordi con i dati pubblicati (Gürkan et al., 2005; Ohshima et al., 2003;
Briatore et al., 2009) secondo cui l’espressione di hTERT e, in misura minore, l’attività
telomerasica oltre ad essere estremamente variabili sono incrementate nelle SMD-AR rispetto
alle SMD-BR.
L’analisi dell’espressione dei fattori della trascrizione agenti sul promotore di hTERT ha dato
risultati parzialmente concordi con quanto già pubblicato (Briatore et al, 2009). c-Myc è un
fattore trascrizionale che interascisce direttamente sul promotore di hTERT attivando
l’espressione genica (Oh et al,1999). Nel nostro studio c-myc risulta significativamente
iperespresso nelle SMD-AR ( in particolare nelle AREB2) e nelle LAM, mentre i livelli di cmyc sono comparabili con i controlli nelle SMD-BR. Si evidenzia, inoltre, che nelle SMD-BR
il sottogruppo delle Sindromi 5q- mostra in assoluto i più bassi valori di c-myc. Suddividendo
i pazienti i base al cariotipo i valori di c-myc aumentano nei pazienti con cariotipo intermedio
e non favorevole; inoltre la suddivisione dei pazienti in base al numero di blasti evidenzia che
81
i pazienti con un numero di blasti compreso tra 11% ed il 20% mostrano una iperespressione
di c-myc. Si può concludere, quindi, che è evidente un incremento dell’espressione di c-myc
nelle SMD più severe e tale dato potrebbe essere utilizzato come fattore prognostico. Infatti cmyc è coinvolto nella regolazione della crescita cellulare ed il ruolo di stimolazione della
crescita cellulare potrebbe favorive la progressione delle SMD in LAM. Comunque l’aumento
dell’espressione di c-myc non è riferibile al fatto che in queste patologie si ha un aumento
della proliferazione cellulare; infatti l’analisi del ciclo cellulare evidenzia che i pazienti con
SMD-AR, in cui i livelli di espressione di c-myc sono elevati, hanno una percentuale di
cellule in divisione più bassa rispetto alle SMD-BR.
Il fattore trascrizionale mad-1, che agisce negativamente sull’espressione di hTERT, è
significativamente iperespresso nelle SMD rispetto ai controlli. Inoltre l’espressione risulta
aumentata nelle SMD-AR (in particolare nelle AREB-2) rispetto alle SMD-BR. Infatti
l’incremento dell’espressione di c-myc nelle AREB2 potrebbe favorive l’iperespressione del
gene antagonista mad-1. Questi dati potrebbero spiegare la notevole variabilità
dell’espressione di hTERT dimostrata in questo studio. Comunque i livelli relativi di c-myc
versus mad-1 mediano l’equilibrio tra la proliferazione cellulare e la differenziazione
terminale (Foley et al, 1998), questo fenomeno ci potrebbe far asserire che l’anormale
incremento di mad-1 nelle AREB2 potrebbe favorire la riduzione del numero di cellule in
divisione nel midollo osseo dei pazienti affetti da SMD-AR, come dimostrato anche
dall’analisi del ciclo cellulare.
Si è analizzata l’espressione del gene p53 per analizzare l’induzione dell’ apoptosi nei
pazienti affetti da SMD e da LAM. Nel nostro studio non si sono notate differenze
significative dei livelli di espressione di p53 tra i pazienti ed i controlli. In accordo con i dati
riportati in precendenti studi, si può concludere che il livello di apoptosi nelle SMD è basso
(Briatore et al, 2009; Sekeres et al, 2007), anche se altri autori hanno dimostrano mediante
analisi immunoistochimiche un incremento di cellule p53 positive nei pazienti affetti SMD in
trasformazione (Kurotaki et al, 2000). Studi recenti di analisi mutazionale piuttosto che di
espressione genica hanno evidenziato come le mutazioni nel gene p53 sono presenti nei
pazienti con SMD anni prima dell’evoluzione leucemica ed i pazienti con p53 mutata hanno
una prognosi peggiore con diminuzione della sopravvivenza globale e della sopravvivenza
libera da malattia (Kulasekararaj et al, 2010; Jadersten et al, 2011). Lo stesso fenomeno è
stato visto nei pazienti affetti da Sindrome 5q- e p53 mutato, infatti questi pazienti avevano la
mediana della sopravvivenza globale più corta rispetto a quelli con Sindrome 5q- e p53 wild
type (Kulasekararaj et al, 2013). Nonostante per decenni alcune anomalie cariotipiche
82
specifiche sono state associate alle SMD, studi più recenti hanno dimostrato l’importanza
dell’analisi mutazionale di singoli geni, alterazioni che non sono individuabili grazie alla
citogenetica standard, e dell’analisi epigenetica, in quanto alterazioni epigentiche deregolano
l’espressione genica (Bejar et al, 2011).
In conclusione, questo studio conferma che la lunghezza media dei telomeri nei pazienti
affetti da SMD è più bassa che nei controlli della stessa fascia di età. L’accorciamento
aumenta con il progredire della leucemia e con l’aumento della percentuale di blasti nel
midollo osseo. I valori di hTERT e di AT sono molto eterogenei ed hanno il simile andamento
di aumentare nelle SMD-AR e nelle LAM. Mad-1 sembra essere più elevato nei pazienti con
prognosi peggiore, ma è un marker comune nelle SMD. Al contrario c-myc è iperespresso
solamente nei pazienti con IPSS intermedio-2 o alto e nelle LAM. Comunque si evidenzia una
correlazione positiva tra l’aumento dell’espressione di c-myc e mad-1 da un lato e l’instabilità
genomica dall’altro, instabilità che si mostra a livello citogenetico come cariotipo complesso.
Si può concludere, infine, che la lunghezza dei telomeri e l’espressione di mad-1 e c-myc,
piuttosto che l’attività telomerasica e l’espressione di hTERT potrebbero essere utilizzati in
futuro per stratificare i pazienti in accordo con il sistema di classificazione del rischio.
83
6. BIBLIOGRAFIA
 Aggerholm A., Holm MS., Guldberg P., Olesen LH., Hokland P. 2006. Promoter
hypermethylation of p15INK4B, HIC1, CDH1, and ER is frequent in myelodysplastic
syndrome and predicts poor prognosis in early-stage patients. Eur J Haematol 76:2332.
 Aisner DL., Wright WE., and Shay JW. 2002. Telomerase regulation: not just flipping
the switch. Curr Opin Genet Dev 12:80–85.
 Alessandrino EP., Della Porta MG., Bacigalupo A., Van Lint MT., Falda M., Onida F.,
Bernardi M., Iori AP., Rambaldi A., Cerretti R., Marenco P., Pioltelli P., Malcovati L.,
Pascutto C., Oneto R., Fanin R., Bosi A.. Gruppo Italiano Trapianto di Midollo Osseo
(GITMO). 2008. WHO classification and WPSS predict posttransplantation outcome
in patients with myelodysplastic syndrome: a study from the Gruppo Italiano
Trapianto di Midollo Osseo (GITMO). Blood 112(3):895-902.
 Aloe Spiriti MA., Cortelezzi A., Finelli C., Ghio R., Levis A., Liso V., Musto P.,
Oliva EN., Poloni A., Santini V., Semenzato G., Terenzi A. 2007. Sindromi
mielodisplastiche. Dalla teoria alla pratica clinica. Elsevier Masson.
 Alter BP., Giri N., Savage SA., Rosenberg PS. 2009. Cancer in dyskeratosis
congenita. Blood 113(26):6549-6557.
 Andrew T., Aviv A., Falchi M., Surdulescu GL., Gardner JP., Lu X., Kimura M., Kato
BS., Valdes AM., Spector TD. 2006. Mapping genetic loci that determine leukocyte
telomere length in a large sample of unselected female sibling pairs. Am J Hum Genet
78: 480–486.
 Armanios M., Chen JL., Chang YP., Brodsky RA., Hawkins A., Griffin CA.,
Eshleman JR., Cohen AR., Chakravarti A., Hamosh A., Greider CW. 2005.
Haploinsufficiency of telomerase reverse transcriptase leads to anticipation in
autosomal dominant dyskeratosis congenita. Proc Natl Acad Sci U S A
102(44):15960-15964.
 Asker C., Wiman KG., Selivanova G. 1999. p53-induced apoptosis as a safeguard
against cancer. Biochem Biophys Res Commun 265(1):1-6.
 Atkinson SP., Hoare SF., Glasspool RM., Keith WN. 2005. Lack of telomerase gene
expression in alternative lengthening of telomere cells is associated with chromatin
remodeling of the hTR and hTERT gene promoters. Cancer Res 65:7585–7590.
84
 Aul C., Gattermann N., Heyll A., Germing U., Derigs G., Schneider W. 1992. Primary
myelodysplastic syndromes: analysis of prognostic factors in 235 patients and
proposals for an improved scoring system. Leukemia 6(1):52-59.
 Aul C., Gattermann N., Schneider W. 1992. Age-related incidence and other
epidemiological aspects of myelodysplastic syndromes. Br J Haematol 82(2):358-367.
 Avilion AA., Piatyszek MA., Gupta J., Shay JW., Bacchetti S., Greider CW. 1996.
Human telomerase RNA and telomerase activity in immortal cell lines and tumor
tissues. Cancer Res 56(3):645-650.
 Bachor C., Bachor OA., Boukamp PJ. 1999. Telomerase is active in normal
gastrointestinal mucosa and not up-regulated in precancerous lesions. Cancer Res Clin
Oncol 125(8-9):453-460.
 Baird DM., Rowson J., Wynford-Thomas D., Kipling D. 2003. Extensive allelic
variation and ultrashort telomeres in senescent human cells. Nat Genet 33:203–207.
 Ball SE., Gibson FM., Rizzo S., Tooze JA., Marsh JC., Gordon-Smith EC. 1998.
Progressive telomere shortening in aplastic anemia. Blood 91(10):3582-3592.
 Bauduer F., Ducout L., Dastugue N., Capdupuy C., Renoux M. 1998. Epidemiology of
myelodysplastic syndromes in a French general hospital of the Basque country. Leuk
Res 22(3):205-208.
 Beattie TL., Zhou W., Robinson MO., and Harrington L. 2000. Polymerization defects
within human telomerase are distinct from telomerase RNA and TEP1 binding. Mol
Biol Cell 11:3329–3340.
 Beattie TL., Zhou W., Robinson MO., and Harrington L. 2001. Functional
multimerization of the human telomerase reverse transcriptase. Mol Cell Biol
21:6151–6160.
 Bechter OE., Eisterer W., Pall G., Hilbe W., Kühr T., Thaler J. 1998. Telomere length
and telomerase activity predict survival in patients with B cell chronic lymphocytic
leukemia. Cancer Res 58(21):4918-4922.
 Bekaert S, Derradji H, Baatout S. Telomere biology in mammalian germ cells and
during development. Dev Biol. 2004 Oct 1; 274(1):15-30.
 Bennett JM., Catovsky D., Daniel MT., Flandrin G., Galton DA., Gralnick HR., Sultan
C. 1982. Proposals for the classification of the myelodysplastic syndromes. Br J
Haematol 51(2):189-199.
85
 Bejar R, Levine R, Ebert BL. 2011. Unraveling the molecular pathophysiology of
myelodysplastic syndromes. J Clin Oncol.10;29(5):504-15.
 Bilsland AE., Stevenson K., Atkinson S., Kolch W., Keith WN. 2006. Transcriptional
repression of telomerase RNA gene expression by c-Jun-NH2-kinase and Sp1/Sp3.
Cancer Res 66(3):1363-1370.
 Birmingham K. 2001. Elizabeth Blackburn. Nature Med 7:520.
 Blackburn EH. 2005. Telomeres and telomerase: their mechanisms of action and the
effects of altering their functions. FEBS Lett 579:859–862.
 Blasco MA., Funk W., Villeponteau B., Greider CW. 1995. Functional
characterization and developmental regulation of mouse telomerase RNA. Science
269(5228):1267-1270.
 Blasco MA., Lee HW., Hande MP., Samper E., Lansdorp PM, DePinho RA, and
Greider CW. 1997. Telomere shortening and tumor formation by mouse cells lacking
telomerase RNA. Cell 91:25–34.
 Bock O., Serinsöz E., Schlué J., Kreipe H. 2004. Different expression levels of the
telomerase catalytic subunit hTERT in myeloproliferative and myelodysplastic
diseases. Leuk Res 28(5):457-460.
 Boissinot M., Garand R., Hamidou M., Hermouet S. 2006. The JAK2-V617F mutation
and essential thrombocythemia features in a subset of patients with refractory anemia
with ring sideroblasts (RARS). Blood 108(5):1781-1782.
 Boogaerts MA., Nelissen V., Roelant C., Goossens W. 1983. Blood neutrophil
function in primary myelodysplastic syndromes. Br J Haematol 55(2):217-227.
 Boultwood J., Fidler C., Kusec R., Rack K., Elliott PJ., Atoyebi O., Chapman R.,
Oscier DG., Wainscoat JS. 1997. Telomere length in myelodysplastic syndromes. Am
J Hematol 56(4):266-271.
 Boultwood J., Pellagatti A., Cattan H., Lawrie CH., Giagounidis A., Malcovati L.,
Della Porta MG., Jädersten M., Killick S., Fidler C., Cazzola M., Hellström-Lindberg
E., Wainscoat JS. 2007. Gene expression profiling of CD34+ cells in patients with the
5q- syndrome. Br J Haematol 139(4):578-589.
 Bowles KM., Warner BA., Baglin TP. 2006. Platelet mass has prognostic value in
patients with myelodysplastic syndromes. Br J Haematol 135:198-200.
86
 Breitschopf KA., Zeiher M., and Dimmeler S. 2001. Pro-atherogenic factors induce
telomerase inactivation in endothelial cells through an Akt dependent mechanism.
FEBS Lett 493:21–25.
 Briatore F., Barrera G., Pizzimenti S., Toaldo C., Casa CD., Laurora S., Pettazzoni P.,
Dianzani MU., Ferrero D. 2009. Increase of telomerase activity and hTERT
expression in myelodysplastic syndromes. Cancer Biol Ther 8(10):883-889.
 Broberg K., Björk J., Paulsson K., Höglund M., Albin M. 2005. Constitutional short
telomeres are strong genetic susceptibility markers for bladder cancer. Carcinogenesis
26(7):1263-1271.
 Broccoli D., Young JW., de Lange T. 1995. Telomerase activity in normal and
malignant hematopoietic cells. Proc Natl Acad Sci USA 92(20):9082-9086.
 Brummendorf TH., Maciejewski JP., Young NS., Lansdorp PL. 2001. Telomere length
in leukocyte subpopulations of patients with aplastic anemia. Blood 97:895-900.
 Bryan TM., and Reddel RR. 1997. Telomere dynamics and telomerase activity in in
vitro immortalised human cells. Eur J Cancer 33:767–773.
 Bryan TM., Englezou A., Gupta J., Bacchetti S., and Reddel RR. 1995. Telomere
elongation in immortal human cells without detectable telomerase activity. EMBO J
14:4240–4248.
 Bryce LA., Morrison N., Hoare SF., Muir S., Keith WN. 2000. Mapping of the gene
for the human telomerase reverse transcriptase, hTERT, to chromosome 5p15.33 by
fluorescence in situ hybridization Neoplasia 2(3):197-201.
 Cairney CJ., Keith WN. 2008. Telomerase redefined: integrated regulation of hTR and
hTERT for telomere maintenance and telomerase activity. Biochimie 90(1):13-23.
 Calado RT., Young NS. 2008. Telomere maintenance and human bone marrow failure.
Blood 111(9):4446-4455.
 Campbell LJ., Fidler C., Eagleton H., Peniket A., Kusec R., Gal S., Littlewood TJ.,
Wainscoat JS., Boultwood J. 2006. hTERT, the catalytic component of telomerase, is
downregulated in the haematopoietic stem cells of patients with chronic myeloid
leukaemia. Leukemia 20(4):671-679.
 Candoni A., Raza A., Silvestri F., Lisak L., Galili N., Mumtaz M., Kikic F., Fanin R.
2005. Response rate and survival after thalidomide-based therapy in 248 patients with
myelodysplastic syndromes. Ann Hematol 84:479-481.
87
 Capper R., Britt-Compton B., Tankimanova M., Rowson J., Letsolo B., Man S.,
Haughton M., Baird DM. 2007. The nature of telomere fusion and a definition of the
critical telomere length in human cells. Genes Dev 21:2495–2508.
 Cesare AJ., Griffith JD. 2004. Telomeric DNA in ALT cells is characterized by free
telomeric circles and heterogeneous t-loops. Mol Cell Biol 24:9948–9957.
 Cesare AJ., Reddel RR. 2010. Alternative lengthening of telomeres: models,
mechanisms and implications. Nat Rev Genet 11(5):319-330.
 Chen JL., Blasco MA., and Greider CW. 2000. Secondary structure of vertebrate
telomerase RNA. Cell 100:503–514.
 Codd V., Mangino M., van der Harst P., Braund PS., Kaiser M., Beveridge AJ., Rafelt
S., Moore J., Nelson C., Soranzo N., Zhai G., Valdes AM., Blackburn H., Mateo
Laech I., de Boer RA., Wellcome Trust Case Control Consortium, Goodall AH.,
Ouwehand W., van Veldhuisen DJ., van Gilst WH., Navis G., Burton PR., Tobin MD.,
Hall AS., Thompson JR., Spector T., Samani NJ. 2010. Common variants near TERC
are associated with mean telomere length. Nat. Genet 42:197–199.
 Colgin LM., Reddel RR. 1999. Telomere maintenance mechanisms and cellular
immortalization. Curr Opin Genet Dev 9:97–103.
 Colgin LM., Wilkinson C., Englezou A., Kilian A., Robinson MO., Reddel RR. 2000.
The hTERTalpha splice variant is a dominant negative inhibitor of telomerase activity.
Neoplasia 2(5):426-432.
 Collins K., Gandhi L. 1998. The reverse transcriptase component of the Tetrahymena
telomerase ribonucleoprotein complex. Proc Natl Acad Sci USA 95:8485–8490.
 Collins K., Kobayashi R., Greider CW. 1995. Purification of Tetrahymena telomerase
and cloning of genes encoding the two protein components of the enzyme. Cell
81:677–686.
 Collins M., Renault V., Grobler LA., St Clair Gibson A., Lambert M.I.,WayneDerman
E.,
Butler-Browne
G.S.,
Noakes
T.D.,
Mouly
V.
2003.
Athletes
with
exerciseassociated fatigue have abnormally short muscle DNA telomeres. Med Sci
Sports Exerc 35:1524–1528.
 Cong YS., Bacchetti S. 2000. Histone deacetylation is involved in the transcriptional
repression of hTERT in normal human cells. J Biol Chem 275:35665–35668.
88
 Cong YS., Wen J., Bacchetti S. 1999. The human telomerase catalytic subunit hTERT:
organization of the gene and characterization of the promoter. Hum Mol Genet
8(1):137-142.
 Cong YS., Wright WE., Shay JW. 2002. Human telomerase and its regulation.
Microbiol Mol Biol Rev 66(3):407-425.
 Counter CM., Gupta J., Harley CB., Leber B., Bacchetti S. 1995. Telomerase activity
in normal leukocytes and in hematologic malignancies. Blood 85(9):2315-2320.
 Counter CM., Hahn WC., Wei W., Caddle SD., Beijersbergen RL., Lansdorp PM.,.
Sedivy JM., and Weinberg RA. 1998. Dissociation among in vitro telomerase activity,
telomere maintenance, and cellular immortalization. Proc Natl Acad Sci USA
95:14723–14728.
 Counter CM., Hirte HW., Bacchetti S., Harley CB. 1994. Telomerase activity in
human ovarian carcinoma. Proc Natl Acad Sci USA 91(8):2900-2904.
 Counter CM., Meyerson M., Eaton EN., Weinberg RA. 1997. The catalytic subunit of
yeast telomerase. Proc Natl Acad Sci USA 94:9202–9207.
 Crowe DL., Nguyen DC. 2001. Rb and E2F-1 regulate telomerase activity in human
cancer cells. Biochim Biophys Acta 1518:1–6.
 De Boeck G., Forsyth RG., Praet M., Hogendoorn PC. 2009. Telomere-associated
proteins: cross-talk between telomere maintenance and telomere-lengthening
mechanisms. J Pathol 217(3):327-344.
 de Lange T. 2005. Shelterin: the protein complex that shapes and safeguards human
telomeres. Genes Dev 19(18):2100-2110.
 de Lange T. 2009. How Telomeres Solve the End-Protection Problem. Science
326(5955):948-952.
 de Lange T., Shiue L., Myers RM., Cox DR., Naylor SL., Killery AM., Varmus HE.
1990. Structure and variability of human chromosome ends. Mol Cell Biol 10(2):518527.
 Deininger M., Buchdunger E., Druker BJ. 2005. The development of imatinib as a
therapeutic agent for chronic myeloid leukemia. Blood 105(7):2640-2653.
 Delhommeau F., Dupont S., Della Valle V., James C., Trannoy S., Massé A.,
Kosmider O., Le Couedic JP., Robert F., Alberdi A., Lécluse Y., Plo I., Dreyfus FJ.,
Marzac C., Casadevall N., Lacombe C., Romana SP., Dessen P., Soulier J., Viguié F.,
89
Fontenay M., Vainchenker W., Bernard OA. 2009. Mutation in TET2 in myeloid
cancers. N Engl J Med 360(22):2289-2301.
 Della Porta MG., Malcovati L., Invernizzi R., Travaglino E., Pascutto C., Maffioli M.,
Gallì A., Boggi S., Pietra D., Vanelli L., Marseglia C., Levi S., Arosio P., Lazzarino
M., Cazzola M. 2006. Flow cytometry evaluation of erythroid dysplasia in patients
with myelodysplastic syndrome. Leukemia 20(4):549-555.
 DePinho RA., Schreiber-Agus N., Alt FW. 1991. myc family oncogenes in the
development of normal and neoplastic cells. Adv Cancer Res 57:1–46.
 Dessain SK., Yu H., Reddel RR., Beijersbergen RL., Weinberg R.A. 2000.
Methylation of the human telomerase gene CpG island. Cancer Res 60:537-541.
 Devereux TR., Horikawa I., Anna CH., Annab LA., Afshari C.A. Barrett JC. 1999.
DNA methylation analysis of the promoter region of the human telomerase reverse
transcriptase (hTERT) gene. Cancer Res 59:6087-6090.
 Dez C., Henras A., Faucon B., Lafontaine D., Caizergues-Ferrer M., Henry Y. 2001.
Stable expression in yeast of the mature form of human telomerase RNA depends on
its association with the box H/ACA small nucleolar ribonucleoprotein proteins Cbf5p,
Nhp2p and Nop10p. Nucleic Acids Res 29:598–603.
 Dragon F., Pogacic V., Filipowicz W. 2000. In vitro assembly of human H/ACA small
nucleolar ribonucleoproteins reveals unique features of U17. and telomerase RNAs.
Mol Cell Biol 20:3037–3048.
 Ducrest AL., Szutorisz H., Lingner J., Nabholz M. 2002. Regulation of the human
telomerase reverse transcriptase gene. Oncogene 21(4):541-552.
 Dwyer J., Li H., Xu D., Liu JP. 2007. Transcriptional regulation of telomerase
activity: roles of the the Ets transcription factor family. Ann N Y Acad Sci 1114:3647.
 Ebert BL., Pretz J., Bosco J., Chang CY., Tamayo P., Galili N., Raza A., Root DE.,
Attar E., Ellis SR., Golub TR. 2008. Identification of RPS14 as a 5q- syndrome gene
by RNA interference screen. Nature 451(7176):335-339.
 Eisenstaedt R., Penninx BW., Woodman RC. 2006. Anemia in the elderly: current
understanding and emerging concepts. Blood Rev 20(4):213-226.
 Emili A., Greenblatt J., Ingles CJ. 1994. Species-specific interaction of the glutaminerich activation domains of Sp1 with the TATA box-binding protein. Mol Cell Biol
14:1582–1593.
90
 Engelhardt M., Kumar R., Albanell J., Pettengell R., Han W., Moore M.A. 1997.
Telomerase regulation, cell cycle, and telomere stability in primitive hematopoietic
cells. Blood 90:182–193.
 Englert C. 1998. WT1–more than a transcription factor?. Trends Biochem Sci 23:389–
393.
 Epel ES. 2009. Psychological and metabolic stress: a recipe for accelerated cellular
aging?. Hormones (Athens) 8:7–22.
 Epel ES., Blackburn EH., Lin J., Dhabhar FS., Adler NE., Morrow JD., Cawthon RM.
2004. Accelerated telomere shortening in response to life stress. Proc Natl Acad Sci
USA 101:17312–17315.
 Esteller M. 2002. CpG island hypermethylation and tumor suppressorgenes: a
booming present, a brighter future. Oncogene 21:5427-5440.
 Etheridge KT., Banik SS., Armbruster BN., Zhu Y., Terns RM., Terns MP., Counter
CM. 2002. The nucleolar localization domain of the catalytic subunit of human
telomerase. J Biol Chem 277(27):24764-24770.
 Fenaux P., Rose C. 2009. Impact of iron overload in myelodysplastic syndromes.
Blood Rev 23 Suppl 1:S15-9.
 Feng J., Funk WD., Wang SS., Weinrich SL., Avilion AA., Chiu CP., Adams RR.,
Chang E., Allsopp RC., Yu J., et al. 1995. The RNA component of human telomerase.
Science 269(5228):1236-41.
 Fiset S., Chabot B. 2001. hnRNP A1 may interact simultaneously with telomeric DNA
and the human telomerase RNA in vitro. Nucleic Acids Res 29:2268–2275.
 Flores I., Canela A., Vera E., Tejera A., Cotsarelis G., Blasco MA. 2008. The longest
telomeres: a general signature of adult stem cell compartments. Genes Dev 22:654–
667.
 Foley KP, mcArthur GA, Quéva C, Hurlin PJ, Soriano P, Eisenman RN, 1998.
Targeted disruption of the Myc antagonist MAD1 inhibits cell cycle exit during
granulocyte differentiation. EMBO J. 2;17(3):774-785
 Ford LP., Suh JM., Wright WE., Shay JW. 2000. Heterogeneous nuclear
ribonucleoproteins C1 and C2 associate with the RNA component of human
telomerase. Mol Cell Biol 20:9084–9091.
91
 Forsythe HL., Jarvis JL., Turner JW., Elmore LW., Holt SE. 2001. Stable association
of hsp90 and p23, but Not hsp70, with active human telomerase. J Biol Chem
276:15571–15574.
 Frenck Jr. RW., Blackburn EH., Shannon KM. 1998. The rate of telomere sequence
loss in human leukocytes varies with age. Proc Natl Acad Sci USA 95:5607–5610.
 Fujimoto K., Kyo S., Takakura M., Kanaya T., Kitagawa Y., Itoh H., Takahashi M.,
Inoue M. 2000. Identification and characterization of negative regulatory elements of
the human telomerase catalytic subunit (hTERT) gene promoter: possible role of
MZF-2 in transcriptional repression of hTERT. Nucleic Acids Res 28(13):2557-2562.
 Germing U., Hildebrandt B., Pfeilstöcker M., Nösslinger T., Valent P., Fonatsch C.,
Lübbert M., Haase D., Steidl C., Krieger O., Stauder R., Giagounidis AA., Strupp C.,
Kündgen A., Mueller T., Haas R., Gattermann N., Aul C. 2005. Refinement of the
international prognostic scoring system (IPSS) by including LDH as an additional
prognostic variable to improve risk assessment in patients with primary
myelodysplastic syndromes (MDS). Leukemia 19:2223-2231.
 Germing U., Strupp C., Kuendgen A., Aivado M., Giagounidis A., Hildebrandt B., Aul
C., Haas R., Gattermann N. 2006a. Refractory anaemia with excess of blasts (RAEB):
analysis of reclassification according to the WHO proposals. Br J Haematol 132:162167.
 Germing U., Strupp C., Kuendgen A., Isa S., Knipp S., Hildebrandt B., Giagounidis
A., Aul C., Gattermann N., Haas R. 2006b. Prospective validation of the WHO
proposals for the classification of myelodysplastic syndromes. Haematologica
91:1596-1604.
 Giagounidis AA., Germing U., Haase S., Hildebrandt B., Schlegelberger B., Schoch
C., Wilkens L., Heinsch M., Willems H., Aivado M., Aul C. 2004. Clinical,
morphological, cytogenetic, and prognostic features of patients with myelodysplastic
syndromes and del(5q) including band q31. Leukemia 18:113-119.
 Gisselsson D., Jonson T., Petersén A., Strömbeck B., Dal Cin P., Höglund M.,
Mitelman F., Mertens F., Mandahl N. 2001. Telomere dysfunction triggers extensive
DNA fragmentation and evolution of complex chromosome abnormalities in human
malignant tumors. Proc Natl Acad Sci USA 98(22):12683-12688.
92
 Goasguen JE., Bennett JM., Cox C., Hambley H., Mufti G., Flandrin G. 1991.
Prognostic implication and characterization of the blast cell population in the
myelodysplastic syndrome. Leuk Res 15(12):1159-1165.
 Graakjaer J., Bischoff C., Korsholm L., Holstebroe S., Vach W., Bohr VA.,
Christensen K., Kolvraa S. 2003. The pattern of chromosome-specific variations in
telomere length in humans is determined by inherited, telomere-near factors and is
maintained throughout life. Mech Ageing Dev 124:629–640.
 Graakjaer J., Der-Sarkissian H., Schmitz A., Bayer J., Thomas G., Kolvraa S.,
Londono-Vallejo JA. 2006. Allele-specific relative telomere lengths are inherited.
Hum Genet 119:344–350.
 Grandori C., Cowley SM., James LP., Eisenman RN. 2000. The Myc/Max/Mad
network and the transcriptional control of cell behavior. Annu Rev Cell Dev Biol
16:653-699.
 Greenberg P., Cox C., LeBeau MM., Fenaux P., Morel P., Sanz G., Sanz M., Vallespi
T., Hamblin T., Oscier D., Ohyashiki K., Toyama K., Aul C., Mufti G., Bennett J.
1998. International scoring system for evaluating prognosis in myelodysplastic
syndromes. Blood 89(6):2079-2088.
 Greenberg RA., Allsopp RC., Chin L., Morin GB., DePinho RA. 1998. Expression of
mouse telomerase reverse transcriptase during development, differentiation and
proliferation. Oncogene 16:1723–1730.
 Greider CW., Blackburn EH. 1985. Identification of a specific telomere terminal
transferase activity in Tetrahymena extracts. Cell 43:405-413.
 Greiner J., Bullinger L., Guinn BA., Döhner H., Schmitt M. 2008. Leukemiaassociated antigens are critical for the proliferation of acute myeloid leukemia cells.
Clin Cancer Res 14(22):7161-7166.
 Griffith JD., Comeau L., Rosenfield S., Stansel RM., Bianchi A., Moss H., de Lange
T. 1999. Mammalian telomeres end in a large duplex loop. Cell 97:503–514.
 Groupe Francais de Morphologie Hematologique. 1987. French registry of acute
leukemia and myelodysplastic syndromes. Age distribution and hemogram analysis of
the 4496 cases recorded during 1982-1983 and classified according to FAB criteria.
Groupe Francais de Morphologie Hematologique. Cancer 60(6):1385-1394.
93
 Guilleret I., Yan P., Grange F., Braunschweig R., Bosman FT., Benhattar J. 2002b.
Hypermethylation of the human telomerase catalytic subunit (hTERT) gene correlates
with telomerase activity. Int J Cancer 101:335–341.
 Guilleret I., Yan P., Guillou L., Braunschweig R., Coindre JM., Benhattar J. 2002a.
The human telomerase RNA gene (hTERC) is regulated during carcinogenesis but is
not dependent on DNA methylation. Carcinogenesis 23(12):2025-2030.
 Gupta V., Brooker C., Tooze JA., Yi QL., Sage D., Turner D., Kangasabapathy P.,
Marsh JC. 2006. Clinical relevance of cytogenetic abnormalities at diagnosis of
acquired aplastic anaemia in adults. Br J Haematol 134(1):95-99.
 Gürkan E., Tanriverdi K., Başlamişli F. 2005. Telomerase activity in myelodysplastic
syndromes. Leuk Res 29(10):1131-1139.
 Haase D., Germing U., Schanz J., Pfeilstöcker M., Nösslinger T., Hildebrandt B.,
Kundgen A., Lübbert M., Kunzmann R., Giagounidis AA., Aul C., Trümper L.,
Krieger O., Stauder R., Müller TH., Wimazal F., Valent P., Fonatsch C., Steidl C.
2007. New insights into the prognostic impact of the karyotype in MDS and
correlation with subtypes: evidence from a core dataset of 2124 patients. Blood
110(13):4385-4395.
 Hamilton-Paterson JL. 1949. Pre-leukaemic anaemia. Acta Haematol 2(5):309-316.
 Harley CB., Futcher AB., Greider CW. 1990. Telomeres shorten during ageing of
human fibroblasts. Nature 345:458–460.
 Harrington L., McPhail T., Mar V., Zhou W., Oulton R., Bass MB., Arruda I.,
Robinson MO. 1997. A mammalian telomerase-associated protein. Science
275(5302):973-977.
 Hasle H., Niemeyer CM., Chessells JM., Baumann I., Bennett JM., Kerndrup G., Head
DR. 2003. A pediatric approach to the WHO classification of myelodysplastic and
myeloproliferative diseases. Leukemia 17(2):277-282.
 Hastie ND., Dempster M., Dunlop MG., Thompson AM., Green DK., Allshire RC.
1990. Telomere reduction in human colorectal carcinoma and with ageing. Nature
346(6287):866-868.
 Haugen BR., Nawaz S., Markham N., Hashizumi T., Shroyer AL., Werness B.,
Shroyer KR. 1997. Telomerase activity in benign and malignant thyroid tumors.
Thyroid 7(3):337-342.
94
 Hayflick L. 1965. The limited in vitro lifetime of human diploid cell strains. Exp Cell
Res 37:614-636.
 Heaney ML., Golde DW. 1999. Myelodysplasia. N Engl J Med 340(21):1649-1660.
 Henson JD., Cao Y., Huschtscha LI., Chang AC., Au AY., Pickett HA., Reddel RR.
2009. DNA C-circles are specific and quantifable markers of alternative-lengtheningoftelomeres activity. Nature Biotech 27:1181–1185.
 Henson JD., Neumann AA., Yeager TR., Reddel RR. 2002. Alternative lengthening of
telomeres in mammalian cells. Oncogene 21:598–610.
 Henson JD., Reddel RR. 2010. Assaying and investigating Alternative Lengthening of
Telomeres activity in human cells and cancers. FEBS Lett 584(17):3800-3811.
 Herranz M., Esteller M. 2007. DNA methylation and histone modifications in patients
with cancer: potential prognostic and therapeutic targets. Methods Mol Biol 361:2562.
 Hiyama E., Yokoyama T., Tatsumoto N., Hiyama K., Imamura Y., Murakami Y.,
Kodama T., Piatyszek MA., Shay JW., Matsuura Y. 1995. Telomerase activity in
gastric cancer. Cancer Res 55(15):3258-3562.
 Hoare SF., Bryce LA., Wisman GB., Burns S., Going JJ., van der Zee AG., Keith WN.
2001. Lack of telomerase RNA gene hTERC expression in alternative lengthening of
telomeres cells is associated with methylation of the hTERC promoter. Cancer Res
61(1):27-32.
 Hockemeyer D., Sfeir AJ., Shay JW., Wright WE., de Lange T. 2005. POT1 protects
telomeres from a transient DNA damage response and determines how human
chromosomes end. EMBO J 20:2667–2678.
 Hoffmann J., Erben Y., Zeiher AM., Dimmeler S., Spyridopoulos I. 2009. Telomere
length-heterogeneity among myeloid cells is a predictor for chronological ageing. Exp
Gerontol 44:363–366.
 Holt SE., Aisner DL., Baur J., Tesmer VM., Dy M., Ouellette M., Trager JB., Morin
GB., Toft DO., Shay JW., Wright WE., White MA. 1999. Functional requirement of
p23 and Hsp90 in telomerase complexes. Genes Dev 13:817–826.
 Hopfer O., Komor M., Koehler IS., Freitag C., Schulze M., Hoelzer D., Thiel E.,
Hofmann WK. 2009. Aberrant promotor methylation in MDS hematopoietic cells
during in vitro lineage specific differentiation is differently associated with DNMT
isoforms. Leuk Res 33:434-442.
95
 Horikawa I., Barrett JC. 2003. Transcriptional regulation of the telomerase hTERT
gene as a target for cellular and viral oncogenic mechanisms. Carcinogenesis
24(7):1167-1176.
 Horikawa I., Cable PL., Afshari C., Barrett JC. 1999. Cloning and characterization of
the promoter region of human telomerase reverse transcriptase gene. Cancer Res
59(4):826-830.
 Howe RB., Porwit-MacDonald A., Wanat R., Tehranchi R., Hellström-Lindberg E.
2004. The WHO classification of MDS does make a difference. Blood 103:3265-3270.
 Huh HJ., Huh JW., Yoo ES., Seong CM., Lee M., Hong KS., Chung WS. 2005.
hTERT mRNA levels by real-time RT-PCR in acute myelogenous leukemia. Am J
Hematol 79(4):267-273.
 Iglesias Gallego M., Sastre Moral JL., Gayoso Diz P., García Costa A., Ros Forteza S.,
Mayán Santos JM. 2003. Incidence and characteristics of myelodysplastic syndromes
in Ourense (Spain) between 1994-1998. Haematologica 88(10):1197-1199.
 Ingram W., Lea NC., Cervera J., Germing U., Fenaux P., Cassinat B., Kiladjian JJ.,
Varkonyi J., Antunovic P., Westwood NB., Arno MJ., Mohamedali A., Gaken J.,
Kontou T., Czepulkowski BH., Twine NA., Tamaska J., Csomer J., Benedek S.,
Gattermann N., Zipperer E., Giagounidis A., Garcia-Casado Z., Sanz G., Mufti GJ.
2006. The JAK2 V617F mutation identifies a subgroup of MDS patients with isolated
deletion 5q and a proliferative bone marrow. Leukemia 20(7):1319-1321.
 Jädersten M, Saft L, Smith A, Kulasekararaj A, Pomplun S, Göhring G, Hedlund A,
Hast R, Schlegelberger B, Porwit A, Hellström-Lindberg E, Mufti GJ.TP53. 2011
Mutations in Low-Risk Myelodysplastic Syndromes With del(5q) Predict Disease
Progression. J Clin Oncol.; 20;29(15):1971-9.
 Ishii A., Nakamura K., Kishimoto H., Honma N., Aida J., Sawabe M., Arai T.,
Fujiwara M., Takeuchi F., Kato M., Oshimura M., Izumiyama N., Takubo K. 2006.
Telomere shortening with aging in the human pancreas. Exp Gerontol 41:882–886.
 Issa JP. 2010. Epigenetic changes in the myelodysplastic syndrome. Hematol Oncol
Clin North Am 24:317-330.
 Jaffe ES., Harris NL., Stein H., Vardiman JV. 2001. Classification of tumors:
pathology and genetics of tumors of haematopoietic and lymphoid tissues. Ed. World
Health Organization IARC Press, Lyon.
96
 Jang JS., Choi YY., Lee WK., Choi JE., Cha SI., Kim YJ., Kim CH., Kam S., Jung
TH., Park JY. 2008. Telomere length and the risk of lung cancer. Cancer Sci
99(7):1385-1389.
 Jankowska AM., Szpurka H., Tiu RV., Makishima H., Afable M., Huh J., O'Keefe
CL., Ganetzky R., McDevitt MA., Maciejewski JP. 2009. Loss of heterozygosity 4q24
and TET2 mutations associated with myelodysplastic/myeloproliferative neoplasms.
Blood 113(25):6403-6410.
 Jensen K., Shiels C., Freemont PS. 2001. PML protein isoforms and the RBCC/TRIM
motif. Oncogene 20(49):7223-7233.
 Jiang Y., Dunbar A., Gondek LP., Mohan S., Rataul M., O'Keefe C., Sekeres M.,
Saunthararajah Y., Maciejewski JP. 2009. Aberrant DNA methylation is a dominant
mechanism in MDS progression to AML. Blood 113:1315-1325.
 Kang SS., Kwon T., Kwon DY., Do SI. 1999. Akt protein kinase enhances human
telomerase activity through phosphorylation of telomerase reverse transcriptase
subunit. J Biol Chem 274:13085–13090.
 Kantarjian H., Giles F., List A., Lyons R., Sekeres MA., Pierce S., Deuson R.,
Leveque J. 2007. The incidence and impact of thrombocytopenia in myelodysplastic
syndromes. Cancer 109(9):1705-1714.
 Kardos G., Baumann I., Passmore SJ., Locatelli F., Hasle H., Schultz KR., Starý J.,
Schmitt-Graeff A., Fischer A., Harbott J., Chessells JM., Hann I., Fenu S., Rajnoldi
AC., Kerndrup G., Van Wering E., Rogge T., Nollke P., Niemeyer CM. 2003.
Refractory anemia in childhood: a retrospective analysis of 67 patients with particular
reference to monosomy 7. Blood 102(6):1997-2003.
 Kastl L., Brown I., Schofield AC. 2010. Altered DNA methylation is associated with
docetaxel resistance in human breast cancer cells. Int J Oncol 36:1235-1241.
 Kaszubowska L. 2008. Telomere shortening and ageing of the immune system. J
Physiol Pharmacol 59 Suppl 9:169-186.
 Kelleher C., Teixeira MT., Förstemann K., Lingner J. 2002. Telomerase: biochemical
considerations for enzyme and substrate. Trends Biochem Sci 27(11):572-579.
 Keller G., Brassat U., Braig M., Heim D., Wege H., Brümmendorf TH. 2009.
Telomeres and telomerase in chronic myeloid leukaemia: impact for pathogenesis,
disease progression and targeted therapy. Hematol Oncol 27(3):123-129.
97
 Kharbanda S., Kumar V., Dhar S., Pandey P., Chen C., Majumder P., Yuan ZM.,
Whang Y., Strauss W., Pandita TK., Weaver D., Kufe D. 2000. Regulation of the
hTERT telomerase catalytic subunit by the c-Abl tyrosine kinase. Curr Biol 10:568–
575.
 Kiechl S., Lorenz E., Reindl M., Wiedermann CJ., Oberhollenzer F., Bonora E.,
Willeit J., Schwartz DA. 2002. Toll-like receptor 4 polymorphisms and atherogenesis.
N Engl J Med 347(3):185-192.
 Kilian A., Bowtell DD., Abud HE., Hime GR., Venter DJ., Keese PK., Duncan EL.,
Reddel RR., Jefferson RA. 1997. Isolation of a candidate human telomerase catalytic
subunit gene, which reveals complex splicing patterns in different cell types. Hum
Mol Genet 6(12):2011-2019.
 Kim NW. 1997. Clinical implications of telomerase in cancer. Eur J Cancer 33(5):781786.
 Kim M., Long TI., Arakawa K., Wang R., Yu MC., Laird PW. 2010. DNA
methylation as a biomarker for cardiovascular disease risk. PLoS One 5:9692e.
 Kim NW., Piatyszek MA., Prowse KR., Harley CB., West MD., Ho PL., Coviello
GM., Wright WE., Weinrich SL., Shay JW. 1994. Specific association of human
telomerase activity with immortal cells and cancer. Science 266:2011–2015.
 Kimura M., Cherkas LF., Kato BS., Demissie S., Hjelmborg JB., Brimacombe M.,
Cupples A., Hunkin JL., Gardner JP., Lu X., Cao X., Sastrasinh M., Province MA.,
Hunt SC., Christensen K., Levy d., Spectori TD., Aviv A. 2008. Offspring’s leukocyte
telomere length, paternal age, and telomere elongation in sperm. PLoS Genet 4(2):e37.
 Kirkpatrick KL., Clark G., Ghilchick M., Newbold RF., Mokbel K. 2003. hTERT
mRNA expression correlates with telomerase activity in human breast cancer. Eur J
Surg Oncol 29(4):321-326.
 Kosmider O., Gelsi-Boyer V., Cheok M., Grabar S., Della-Valle V., Picard F., Viguié
F., Quesnel B., Beyne-Rauzy O., Solary E., Vey N., Hunault-Berger M., Fenaux P.,
Mansat-De Mas V., Delabesse E., Guardiola P., Lacombe C., Vainchenker W.,
Preudhomme C., Dreyfus F., Bernard OA., Birnbaum D., Fontenay M., Groupe
Francophone des Myélodysplasies. 2009. TET2 mutation is an independent favorable
prognostic factor in myelodysplastic syndromes (MDSs). Blood 114(15):3285-3291.
98
 Kuendgen A., Strupp C., Aivado M., Hildebrandt B., Haas R., Gattermann N.,
Germing U. 2006. Myelodysplastic syndromes in patients younger than age 50. J Clin
Oncol 24(34):5358-5365.
 Kulasekararaj AG., Mohamedali AM., Smith AE., Nicholas CL., Kizilors A., Abdallah
A., Nasser EE., Mian SA., Yiu R., Gaken J., Pomplun S., Jiang J., Gaymes TJ.,
Pasipanodya P., Hayden J., Ireland RM., Lim ZY., Ho AY., Marsh J., Mufti GJ. 2010.
Polycomb complex group gene mutations and their prognostic relevance in 5Azacitidine treated Myelodysplastic Syndrome patients. Blood 116:125.
 Kulasekararaj AG, Smith AE, Mian SA, Mohamedali AM, Krishnamurthy P, Lea NC,
Gäken J, Pennaneach C, Ireland R, Czepulkowski B, Pomplun S, Marsh JC, Mufti GJ.
2013.TP53 mutations in myelodysplastic syndrome are strongly correlated with
aberrations of chromosome 5, and correlate with adverse prognosis. Br J Haematol.
160(5):660-72
 Polycomb Complex Group Gene Mutations and Their Prognostic Relevance In 5Azacitidine Treated Myelodysplastic Syndrome Patients
 Blood (ASH Annual Meeting Abstracts), Nov 2010; 116: 125.
 Kurotaki H., Tsushima Y., Nagai K., Yagihashi S. 2000. Apoptosis, bcl-2 expression
and p53 accumulation in myelodysplastic syndrome, myelodysplastic-syndromederived acute myelogenous leukemia and de novo acute myelogenous leukemia. Acta
Haematol 102(3):115-123.
 Kyo S., Kanaya T., Takakura M., Tanaka M., Inoue M. 1999. Human telomerase
reverse transcriptase as a critical determinant of telomerase activity in normal and
malignant endometrial tissues. Int J Cancer 80(1):60-63.
 Kyo S., Takakura M., Kohama T., Inoue M. 1997. Telomerase activity in human
endometrium. Cancer Res 57:610–614.
 Kyo S., Takakura M., Taira T., Kanaya T., Itoh H., Yutsudo M., Ariga H., Inoue M.
2000. Sp1 cooperates with c-Myc to activate transcription of the human telomerase
reverse transcriptase gene (hTERT). Nucleic Acids Res 28(3):669-677.
 LaBranche H., Dupuis S., Ben-David Y., Bani MR., Wellinger RJ., Chabot B. 1998.
Telomere elongation by hnRNP A1 and a derivative that interacts with telomeric
repeats and telomerase. Nat Genet 19:199–202.
 Ladetto M., Compagno M., Ricca I., Pagano M., Rocci A., Astolfi M., Drandi D., di
Celle PF., Dell'Aquila M., Mantoan B., Vallet S., Pagliano G., De Marco F., Francese
99
R., Santo L., Cuttica A., Marinone C., Boccadoro M., Tarella C. 2004. Telomere
length correlates with histopathogenesis according to the germinal center in mature Bcell lymphoproliferative disorders. Blood 103(12):4644-4649.
 Laing ME., Cummins R., O'Grady A., O'Kelly P., Kay EW., Murphy GM. 2010.
Aberrant DNA Methylation associated with MTHFR C677T Genetic Polymorphism in
cutaneous squamous cell carcinoma in renal transplant patients. Br J Dermatol
 Lange K., Holm L., Vang Nielsen K., Hahn A., Hofmann W., Kreipe H.,
Schlegelberger B., Göhring G. 2010. Telomere shortening and chromosomal
instability in myelodysplastic syndromes. Genes Chromosomes Cancer 49(3):260-269.
 Lansdorp PM. 2009. Telomeres and disease. EMBO J 28(17):2532-2540.
 Lansdorp PM., Verwoerd NP., van de Rijke FM., Dragowska V., Little MT., Dirks
RW., Raap AK., Tanke HJ. 1996. Heterogeneity in telomere length of human
chromosomes. Hum Mol Genet 5:685–691.
 Lee JJ., Nam CE., Kook H., Maciejewski JP., Kim YK., Chung IJ., Park KS., Lee IK.,
Hwang TJ., Kim HJ. 2003. Constitution and telomere dynamics of bone marrow
stromal cells in patients undergoing allogeneic bone marrow transplantation. Bone
Marrow Transplant 32:947–952.
 Lendvay TS., Morris DK., Sah J., Balasubramanian B., Lundblad V. 1996. Senescence
mutants of Saccharomyces cerevisiae with a defect in telomere replication identify
three additional EST genes. Genetics 144:1399–1412.
 Levine AJ. 1997. p53, the cellular gatekeeper for growth and division. Cell 88(3):323331.
 Li H., Zhao L., Yang Z., Funder JW., Liu JP. 1998. Telomerase is controlled by
protein kinase Calpha in human breast cancer cells.J Biol Chem 273(50):3343633442.
 Li H., Zhao LL., Funder JW., Liu JP. 1997. Protein phosphatase 2A inhibits nuclear
telomerase activity in human breast cancer cells.J Biol Chem 272(27):16729-16732.
 Lichtman MA. 2000. Myelodysplasia or myeloneoplasia: thoughts on the nosology of
clonal myeloid diseases. Blood Cells Mol Dis 26(6):572-581.
 Lin J., Wang YL., Qian J., Yao DM., Zhu ZH., Qian Z., Xu WR. 2010. Aberrant
methylation of DNA-damage-inducible transcript 3 promoter is a common event in
patients with myelodysplastic syndrome. Leuk Res
100
 Lingner J., Cech TR. 1996. Purification of telomerase from Euplotes aediculatus:
requirement of a primer 3[1] overhang. Proc Natl Acad Sci USA 93:10712–10717.
 Lingner J., Hughes TR., Shevchenko A., Mann M., Lundblad V., Cech TR. 1997.
Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 276:561–
567.
 List A., Dewald G., Bennett J., Giagounidis A., Raza A., Feldman E., Powell B.,
Greenberg P., Thomas D., Stone R., Reeder C., Wride K., Patin J., Schmidt M., Zeldis
J.,
Knight
R.,
Myelodysplastic
Syndrome-003
Study
Investigators.
2006.
Lenalidomide in the myelodysplastic syndrome with chromosome 5q deletion. N Engl
J Med 355(14):1456-1465.
 Liu C., Fang X., Ge Z., Jalink M., Kyo S., Biörkholm M., Gruber A., Sjöberg J., Xu D.
2007. The telomerase reverse transcriptase (hTERT) gene is a direct target of the
histone methyltransferase SMYD3. Cancer Res 67: 2626–2631.
 Liu D., Safari A., O’Connor MS., Chan DW., Laegeler A., Qin J., Songyang Z. 2004.
PTOP interacts with POT1 and regulates its localization to telomeres. Nat Cell Biol
6:673–680.
 Liu JP. 1996. Protein kinase C and its substrates. Mol Cell Endocrinol 116:1–29.
 Liu L., Saldanha SN., Pate MS., Andrews LG., Tollefsbol TO. 2004. Epigenetic
regulation of human telomerase reverse transcriptase promoter activity during cellular
differentiation. Genes Chromosomes Cancer 41:26–37.
 Liu Y., Snow BE., Hande MP., Yeung D., Erdmann NJ., Wakeham A., Itie A.,
Siderovski DP., Lansdorp PM., Robinson MO., Harrington L. 2000. The telomerase
reverse transcriptase is limiting and necessary for telomerase function in vivo. Curr
Biol 10(22):1459-1462.
 Liu, K., Hodes RJ., Weng N. 2001. Cutting edge: telomerase activation in human T
lymphocytes does not require increase in telomerase reverse transcriptase (hTERT)
protein but is associated with hTERT phosphorylation and nuclear translocation. J
Immunol 166:4826–4830.
 Loayza D., de Lange T. 2003. POT1 as a terminal transducer of TRF1 telomere length
control. Nature 424:1013–1018.
 Loken MR., van de Loosdrecht A., Ogata K., Orfao A., Wells DA. 2008. Flow
cytometry in myelodysplastic syndromes: report from a working conference. Leuk Res
32(1):5-17.
101
 Londono-Vallejo JA., Der-Sarkissian H., Cazes L., Bacchetti S., Reddel RR. 2004.
Alternative lengthening of telomeres is characterized by high rates of telomeric
exchange. Cancer Res 64:2324–2327.
 Londono-Vallejo JA., DerSarkissian H., Cazes L., Thomas G. 2001. Differences in
telomere length between homologous chromosomes in humans. Nucleic Acids Res
29:3164–3171.
 Lopatina NG., Poole JC., Saldanha SN., Hansen NJ., Key JS., Pita MA., Andrews
LG., Tollfsbol TO. 2003. Control mechanisms in the regulation of telomerase reverse
transcriptase expression in differentiating human teratocarcinoma cells. Biochem
Biophys Res Commun 306:650–659.
 Luna-Fineman S., Shannon KM., Atwater SK., Davis J., Masterson M., Ortega J.,
Sanders J., Steinherz P., Weinberg V., Lange BJ. 1999. Myelodysplastic and
myeloproliferative disorders of childhood: a study of 167 patients. Blood 93(2):459466.
 Ma X., Does M., Raza A., Mayne ST. 2007. Myelodysplastic syndromes: incidence
and survival in the United States. Cancer 109(8):1536-1542.
 Maciejewski JP., Risitano A., Sloand EM., Nunez O., Young NS. 2002. Distinct
clinical outcomes for cytogenetic abnormalities evolving from aplastic anemia. Blood
99(9):3129-3135.
 Majumdar AS., Hughes DE., Lichtsteiner SP., Wang Z., Lebkowski JS., Vasserot AP.
2001. The telomerase reverse transcriptase promoter drives efficacious tumor suicide
gene therapy while preventing hepatotoxicity encountered with constitutive promoters.
Gene Ther 8:568–578.
 Makarov VL., Hirose Y., Langmore JP. 1997. Long G Tails at Both Ends of Human
Chromosomes Suggest a C Strand Degradation Mechanism for Telomere Shortening.
Cell 88: 657–666.
 Malcovati L., Della Porta MG., Lunghi M., Pascutto C., Vanelli L., Travaglino E.,
Maffioli M., Bernasconi P., Lazzarino M., Invernizzi R., Cazzola M. 2005a. Flow
cytometry evaluation of erythroid and myeloid dysplasia in patients with
myelodysplastic syndrome. Leukemia 19(5):776-783.
 Malcovati L., Della Porta MG., Pascutto C., Invernizzi R., Boni M., Travaglino E.,
Passamonti F., Arcaini L., Maffioli M., Bernasconi P., Lazzarino M., Cazzola M.
2005b. Prognostic factors and life expectancy in myelodysplastic syndromes classified
102
according to WHO criteria: a basis for clinical decision making. J Clin Oncol 23:75947603.
 Malcovati L., Germing U., Kuendgen A., Della Porta MG., Pascutto C., Invernizzi R.,
Giagounidis A., Hildebrandt B., Bernasconi P., Knipp S., Strupp C., Lazzarino M.,
Aul C., Cazzola M. 2007. Time-dependent prognostic scoring system for predicting
survival and leukemic evolution in myelodysplastic syndromes. J Clin Oncol
25:3503-3510.
 Mangino M., Brouilette S., Braund P., Tirmizi N., Vasa-Nicotera M., Thompson JR.,
Samani NJ. 2008. A regulatory SNP of the BICD1 gene contributes to telomere length
variation in humans. Hum Mol Genet 17:2518–2523.
 Marciniak R., Guarente L. 2001. Human genetics. Testing telomerase. Nature
413:370–371,373.
 Martens UM., Brass V., Sedlacek L., Pantic M., Exner C., Guo Y., Engelhardt M.,
Lansdorp PM., Waller CF., Lange W. 2002. Telomere maintenance in human B
lymphocytes. Br J Haematol 119:810–818.
 Martens UM., Zijlmans JM., Poon SS., Dragowska W., Yui J., Chavez EA., Ward
RK., Lansdorp PM. 1998 Short telomeres on human chromosome 17p. Nat Genet
18(1):76-80.
 Mason DX., Autexier C., Greider CW. 2001. Tetrahymena proteins p80 and p95 are
not core telomerase components. Proc Natl Acad Sci USA 98:12368–12373.
 Mather KA., Jorm AF., Parslow RA., Christensen H. 2011. Is telomere length a
biomarker of aging? J Gerontol A Biol Sci Med Sci 66(2):202-213.
 Matsubara Y., Murata M., Yoshida T., Watanabe K., Saito I., Miyaki K., Omae K.,
Ikeda Y. 2006b. Telomere length of normal leukocytes is affected by a functional
polymorphism of hTERT. Biochem Biophys Res Commun 341:128–131.
 Matsubara Y., Murata M.,Watanabe K., Saito I., Miyaki K., Omae K., Ishikawa M.,
Matsushita K., Iwanaga S., Ogawa S., Ikeda Y. 2006a. Coronary artery disease and a
functional polymorphism of hTERT. Biochem Biophys Res Commun 348:669–672.
 Mayer S., Bruderlein S., Perner S., Waibel I., Holdenried A., Ciloglu N., Hasel C.,
Mattfeldt T., Nielsen KV., Moller P. 2006. Sex-specific telomere length profiles and
age-dependent erosion dynamics of individual chromosome arms in humans.
Cytogenet Genome Res 112:194–201.
103
 Maynadié M., Picard F., Husson B., Chatelain B., Cornet Y., Le Roux G., Campos L.,
Dromelet A., Lepelley P., Jouault H., Imbert M., Rosenwadj M., Vergé V., Bissières
P., Raphaël M., Béné MC., Feuillard J., Groupe d'Etude Immunologique des
Leucémies (GEIL). 2002. Immunophenotypic clustering of myelodysplastic sindrome.
Blood 100(7):2349-2356.
 Maynadié M., Verret C., Moskovtchenko P., Mugneret F., Petrella T., Caillot D., Carli
PM. 1996. Epidemiological characteristics of myelodysplastic syndrome in a welldefined French population. Br J Cancer 74(2):288-290.
 McClintock B. 1941. The stability of broken ends of chromosomes in Zea mays.
Genetics 26:234-282.
 McGrath M., Wong JY., Michaud D., Hunter DJ., De Vivo I. 2007. Telomere length,
cigarette smoking, and bladder cancer risk in men and women. Cancer Epidemiol
Biomarkers Prev 16(4):815-819.
 McNally RJ., Rowland D., Roman E., Cartwright RA. 1997. Age and sex distributions
of hematological malignancies in the U.K. Hematol Oncol 15(4):173-189.
 Miller MC., Collins K. 2000. The Tetrahymena p80/p95 complex is required for
proper telomere length maintenance and micronuclear genome stability. Mol Cell
6:827–837.
 Minamino T., Mitsialis SA., Kourembanas S. 2001. Hypoxia extends the life span of
vascular smooth muscle cells through telomerase activation. Mol Cell Biol 21:3336–
3342.
 Minardi D., Lucarini G., Filosa A., Milanese G., Zizzi A., Di Primio R., Montironi R.,
Muzzonigro G. 2009. Prognostic role of global DNA-methylation and histone
acetylation in pT1a clear cell renal carcinoma in partial nephrectomy specimens. J Cell
Mol Med 13:2115-2121.
 Misiti S., Nanni S., Fontemaggi G., Cong YS., Wen J., Hirte HW., Piaggio G., Sacchi
A., Pontecorvi A., Bacchetti S., Farsetti A. 2000. Induction of hTERT expression and
telomerase activity by estrogens in human ovary epithelium cells. Mol Cell Biol
20:3764–3771.
 Mitchell JR., Cheng J., Collins K. 1999. A box H/ACA small nucleolar RNA-like
domain at the human telomerase RNA 3' end. Mol Cell Biol 19:567–576.
104
 Mitchell JR., Collins K. 2000. Human telomerase activation requires two independent
interactions between telomerase RNA and telomerase reverse transcriptase. Mol Cell
6:361–371.
 Mitchell JR., Wood E., Collins K. 1999. A telomerase component is defective in the
human disease dyskeratosis congenita. Nature 402(6761):551-555.
 Mitchell JR., Wood E., Collins K. 1999a. A telomerase component is defective in the
human disease dyskeratosis congenita. Nature 402:551–555.
 Molenaar C., Wiesmeijer K., Verwoerd NP., Khazen S., Eils R, Tanke HJ., Dirks RW.
2003. Visualizing telomere dynamics in living mammalian cells using PNA probes.
EMBO J 22:6631–6641.
 Moller P., Mayer S., Mattfeldt T., Muller K., Wiegand P., Bruderlein S. 2009.
Sexrelated differences in length and erosion dynamics of human telomeres favor
females. Aging (Albany NY) 1(8):733-739.
 Moon JH., Kim SN., Kang BW., Chae YS., Kim JG., Baek JH., Park JH., Song M.,
Chung JS., Won JH., Lee SM., Joo YD., Kim YK., Kim HJ., Jo DY., Sohn SK. 2010.
Predictive value of pretreatment risk group and baseline LDH levels in MDS patients
receiving azacitidine treatment. Ann Hematol.
 Morel P., Hebbar M., Lai JL., Duhamel A., Preudhomme C., Wattel E., Bauters F.,
Fenaux P. 1993. Cytogenetic analysis has strong independent prognostic value in de
novo myelodysplastic syndromes and can be incorporated in a new scoring system: a
report on 408 cases. Leukemia 7(9):1315-1323.
 Moriarty TJ., Huard S., Dupuis S., Autexier C. 2002. Functional multimerization of
human telomerase requires an RNA interaction domain in the N terminus of the
catalytic subunit. Mol Cell Biol 22:1253–1265.
 Morin GB. The human telomerase terminal transferase enzyme is a ribonucleoprotein
that synthesizes TTAGGG repeats. Cell 1989; 59:521-529.
 Moyzis RK., Buckingham JM., Cram LS., Dani M., Deaven LL., Jones MD., Meyne
J., Ratliff RL., Wu JR. 1988. A Highly conserved repetitive DNA sequence,
(TTAGGG)n, present at the telomeres of human chromosomes. Proc Natl Acad Sci
USA 85:6622-6626.
 Mufti GJ. 1992. Chromosomal deletions in the myelodysplastic syndrome. Leuk Res
16(1):35-41.
105
 Mufti GJ. 1992. Chromosomal deletions in the myelodysplastic syndrome. Leuk Res
16(1):35-41.
 Mufti GJ., Bennett JM., Goasguen J., Bain BJ., Baumann I., Brunning R., Cazzola M.,
Fenaux P., Germing U., Hellström-Lindberg E., Jinnai I., Manabe A., Matsuda A.,
Niemeyer CM., Sanz G., Tomonaga M., Vallespi T., Yoshimi A., International
Working Group on Morphology of Myelodysplastic Syndrome. 2008. Diagnosis and
classification of myelodysplastic syndrome: International Working Group on
Morphology of myelodysplastic syndrome (IWGM-MDS) consensus proposals for the
definition and enumeration of myeloblasts and ring sideroblasts. Haematologica
93(11):1712-1717.
 Mufti GJ., Stevens JR., Oscier DG., Hamblin TJ., Machin D. 1985. Myelodysplastic
syndromes: a scoring system with prognostic significance. Br J Haematol 59(3):425433.
 Müller HJ. 1938. The remaking of chromosomes. Collecting Net 13:181-198.
 Muslin AJ., Xing H. 2000. 14–3–3 proteins: regulation of subcellular localization by
molecular interference. Cell Signal 12:703–709.
 Nabetani A., Ishikawa F. 2009. Unusual telomeric DNAs in human telomerasenegative immortalized cells. Mol Cell Biol 29:703–713.
 Nakamura TM., Morin GB., Chapman KB., Weinrich SL., Andrews WH., Lingner J.,
Harley CB., Cech TR. 1997. Telomerase catalytic subunit homologs from fission yeast
and human. Science 277(5328):955-959.
 Nakayama J., Saito M., Nakamura H., Matsuura A., Ishikawa F. 1997. TLP1: a gene
encoding a protein component of mammalian telomerase is a novel member of WD
repeats family. Cell 88:875–884.
 Nawrot TS., Staessen JA., Gardner JP., Aviv A. 2004. Telomere length and possible
link to X chromosome. Lancet 363:507–510.
 Njajou OT., Cawthon RM., Damcott CM., Wu SH., Ott S., Garant MJ., Blackburn
EH., Mitchell BD., Shuldiner AR., Hsueh WC. 2007. Telomere length is paternally
inherited and is associated with parental lifespan. Proc Natl Acad Sci USA
104:12135–12139.
 Nordfjall K., Larefalk A., Lindgren P., Holmberg D., Roos G. 2005. Telomere length
and heredity: Indications of paternal inheritance. Proc Natl Acad Sci USA 102:16374–
16378.
106
 Nordfjall K., Osterman P., Melander O., Nilsson P., Roos G. 2007. hTERT (-1327)T/C
polymorphism is not associated with age-related telomere attrition in peripheral blood.
Biochem Biophys Res Commun 358:215–218.
 Nordfjall K., Svenson U., Norrback KF., Adolfsson R., Roos G. 2010. Large-scale
parent-child comparison confirms a strong paternal influence on telomere length. Eur J
Hum Genet 18:385–389.
 Novitzky N. 2000. Myelodysplastic syndromes in children. A critical review of the
clinical manifestations and management. Am J Hematol 63(4):212-222.
 Ogata K., Kishikawa Y., Satoh C., Tamura H., Dan K., Hayashi A. 2006. Diagnostic
application of flow cytometric characteristics of CD34+ cells in low-grade
myelodysplastic syndromes. Blood 108(3):1037-1044.
 Oh S., Song Y., Yim J., Kim TK. 1999. The Wilms’ tumor 1 tumor suppressor gene
represses transcription of the human telomerase reverse transcriptase gene. J Biol
Chem 274:37473–37478.
 Ohshima K., Karube K., Shimazaki K., Kamma H., Suzumiya J., Hamasaki M.,
Kikuchi M. 2003. Imbalance between apoptosis and telomerase activity in
myelodysplastic syndromes: possible role in ineffective hemopoiesis. Leuk
Lymphoma 44(8):1339-1346.
 Ohyashiki JH., Hisatomi H., Nagao K., Honda S., Takaku T., Zhang Y., Sashida G.,
Ohyashiki K. 2005. Quantitative relationship between functionally active telomerase
and major telomerase components (hTERT and hTR) in acute leukaemia cells. Br J
Cancer 92(10):1942-1947.
 Ohyashiki JH., Iwama H., Yahata N., Ando K., Hayashi S., Shay JW., Ohyashiki K.
1999. Telomere stability is frequently impaired in high-risk groups of patients with
myelodysplastic syndromes. Clin Cancer Res 5(5):1155-1160.
 Ohyashiki JH., Ohyashiki K., Fujimura T., Kawakubo K., Shimamoto T., Iwabuchi A.,
Toyama K. 1994. Telomere shortening associated with disease evolution patterns in
myelodysplastic syndromes. Cancer Res 54(13):3557-3560.
 Ohyashiki JH., Ohyashiki K., Iwama H., Hayashi S., Toyama K., Shay JW. 1997.
Clinical implications of telomerase activity levels in acute leukemia. Clin Cancer Res
3(4):619-625.
107
 Ohyashiki K., Iwama H., Tauchi T., Shimamoto T., Hayashi S., Ando K., Kawakubo
K., Ohyashiki JH. 2000. Telomere dynamics and genetic instability in disease
progression of chronic myeloid leukemia. Leuk Lymphoma 40(1-2):49-56.
 Ohyashiki K, Iwama H, Yahata N, Tauchi T, Kawakubo K, Shimamoto T, Ohyashiki
JH. 2001. Telomere dynamics in myelodysplastic syndromes and acute leukemic
transformation. Leuk Lymphoma;42(3):291-9. Review.
 Okuda K., Bardeguez A., Gardner JP., Rodriguez P., Ganesh V., Kimura M., Skurnick
J., Awad G., Aviv A. 2002. Telomere length in the newborn. Pediatr Res 52:377–381.
 Oliva EN., Dimitrov BD., Benedetto F., D'Angelo A., Nobile F. 2005. Hemoglobin
level threshold for cardiac remodeling and quality of life in myelodysplastic
syndrome. Leuk Res 29:1217-1219.
 Olney HJ., Le Beau MM. 2001. The cytogenetics of myelodysplastic syndromes. Best
Pract Res Clin Haematol 14(3):479-495.
 Olovnikov AM. 1971. Principle of marginotomy in template synthesis of
polynucleotides. Dokl Akad Nauk SSSR 201:1496-1499.
 Olovnikov AM. 1973. A theory of marginotomy. The incomplete copying of template
margin in enzymic synthesis of polynucleotides and biological significance of the
phenomenon. J Theor Biol 41:181-190.
 Opitz OG., Suliman Y., Hahn WC., Harada H., Blum HE., Rustgi AK. 2001. Cyclin
D1 overexpression and p53 inactivation immortalize primary oral keratinocytes by a
telomerase-independent mechanism. J Clin Invest 108(5):725-732.
 Oriani A., Annaloro C., Soligo D., Pozzoli E., Cortelezzi A., Lambertenghi Deliliers
G. 1996. Bone marrow histology and CD34 immunostaining in the prognostic
evaluation of primary myelodysplastic syndromes. Br J Haematol 92(2):360-364.
 O'Sullivan JN., Bronner MP., Brentnall TA., Finley JC., Shen WT., Emerson S.,
Emond MJ., Gollahon KA., Moskovitz AH., Crispin DA., Potter JD. Rabinovitch PS.
2002. Chromosomal instability in ulcerative colitis is related to telomere shortening.
Nat Genet 32(2):280-284.
 Ouellette MM., Aisner DL., Savre-Train I., Wright WE., Shay JW. 1999. Telomerase
activity does not always imply telomere maintenance. Biochem Biophys Res Commun
254:795–803.
 Park S., Grabar S., Kelaidi C., Beyne-Rauzy O., Picard F., Bardet V., Coiteux V.,
Leroux G., Lepelley P., Daniel MT., Cheze S., Mahé B., Ferrant A., Ravoet C.,
108
Escoffre-Barbe M., Adès L., Vey N., Aljassem L., Stamatoullas A., Mannone L.,
Dombret H., Bourgeois K., Greenberg P., Fenaux P., Dreyfus F., GFM group (Groupe
Francophone des Myélodysplasies). 2008. Predictive factors of response and survival
in myelodysplastic syndrome treated with erythropoietin and G-CSF: the GFM
experience. Blood 111:574-582.
 Perner S., Bruderlein S., Hasel C., Waibel I., Holdenried A., Ciloglu N., Chopurian H.,
Nielsen KV., Plesch A., Hogel J., Moller P. 2003. Quantifying telomere lengths of
human individual chromosome arms by centromere-calibrated fluorescence in situ
hybridization and digital imaging. Am J Pathol 163:1751–1756.
 Perrem K., Colgin LM., Neumann AA., Yeager TR., Reddel RR. 2001. Coexistence of
alternative lengthening of telomeres and telomerase in hTERT transfected GM847
cells. Mol Cell Biol 21:3862–3875.
 Pierre RV., Hoagland HC. 1972. Age-associated aneuploidy: loss of Y chromosome
from human bone marrow cells with aging. Cancer 30(4):889-894.
 Pogacic V., Dragon F., Filipowicz W. 2000. Human H/ACA small nucleolar
ribonucleoproteins and telomerase share evolutionarily conserved proteins NHP2 and
NOP10. Mol Cell Biol 20:9028–9040.
 Poole JC., Andrews LG., Tollefsbol TO. 2001. Activity, function, and gene regulation
of the catalytic subunit of telomerase (hTERT). Gene 269(1-2):1-12.
 Rådlund A., Thiede T., Hansen S., Carlsson M., Engquist L. 1995. Incidence of
myelodysplastic syndromes in a Swedish population. Eur J Haematol 54(3):153-156.
 Renneville A., Quesnel B., Charpentier A., Terriou L., Crinquette A., Laï JL.,
Cossement C., Lionne-Huyghe P., Rose C., Bauters F., Preudhomme C. 2006. High
occurrence of JAK2 V617 mutation in refractory anemia with ringed sideroblasts
associated with marked thrombocytosis. Leukemia 20(11):2067-2070.
 Ribarska T., Ingenwerth M., Goering W., Engers R., Schulz WA. 2010. Epigenetic
inactivation of the placentally imprinted tumor suppressor gene TFPI2 in prostate
carcinoma. Cancer Genomics Proteomics 7:51-60.
 Richmond TJ., Davey CA. 2003. The structure of DNA in the nucleosome core.
Nature 423:145-150.
 Rigolin GM., Cuneo A., Roberti MG., Bardi A., Bigoni R., Piva N., Minotto C.,
Agostini P., De Angeli C., Del Senno L., Spanedda R., Castoldi G. 1998. Exposure to
109
myelotoxic agents and myelodysplasia: case-control study and correlation with
clinicobiological findings. Br J Haematol 103(1):189-197.
 Rogan EM., Bryan TM., Hukku B., Maclean K., Chang AC., Moy EL., Englezou A.,
Warneford SG., Dalla-Pozza L., Reddel RR. 1995. Alterations in p53 and p16INK4
expression and telomere length durino spontaneous immortalization of Li-Fraumeni
syndrome fibroblasts. Mol Cell Biol 15:4745–4753.
 Rohde V., Sattler HP., Bund T., Bonkhoff H., Fixemer T., Bachmann C., Lensch R.,
Unteregger G, Stoeckle M., Wullich B. 2000. Expression of the human telomerase
reverse transcriptase is not related to telomerase activity in normal and malignant renal
tissue. Clin Cancer Res 6(12):4803-4809.
 Romero DP., Blackburn EH. 1991. A conserved secondary structure for telomerase
RNA. Cell 67:343–353.
 Römermann D, Hasemeier B, Metzig K, Schlegelberger B, Länger F, Kreipe H,
Lehmann U. 2007. Methylation status of LINE-1 sequences in patients with MDS or
secondary AML. Verh Dtsch Ges Pathol 91:338-342.
 Rufer N., Brummendorf T.H., Kolvraa S., Bischoff C., Christensen K., Wadsworth L.,
Schulzer M., Lansdorp PM. 1999. Telomere fluorescence measurements in
granulocytes and T lymphocyte subsets point to a high turnover of hematopoietic stem
cells and memory T cells in early childhood. J Exp Med 190:157–167.
 Rufer N., Dragowska W., Thornbury G., Roosnek E., Lansdorp PM. 1998. Telomere
length dynamics in human lymphocyte subpopulations measured by flow cytometry.
Nat Biotechnol 16:743–747.
 Saito K., Kawakami K., Matsumoto I., Oda M., Watanabe G., Minamoto T. 2010.
Long Interspersed Nuclear Element 1 Hypomethylation Is a Marker of Poor Prognosis
in Stage IA Non-Small Cell Lung Cancer. Clin Cancer Res
 Saji M., Westra WH., Chen H., Umbricht CB., Tuttle RM., Box MF., Udelsman R.,
Sukumar S., Zeiger MA. 1997. Telomerase activity in the differential diagnosis of
papillary carcinoma of the thyroid. Surgery 122(6):1137-1140.
 Sakoff JA., De Waal E., Garg MB., Denham J., Scorgie FE., Enno A., Lincz LF.,
Ackland SP. 2002. Telomere length in haemopoietic stem cells can be determined
from that of mononuclear blood cells or whole blood. Leuk Lymphoma 43:2017–
2020.
110
 Samassekou O., Gadji M., Drouin R., Yan J. 2010. Sizing the ends: normal length of
human telomeres. Ann Anat 192(5):284-291.
 Samassekou O., Ntwari A., Hebert J., Yan J. 2009. Individual telomere lengths in
chronic myeloid leukemia. Neoplasia 11:1146–1154.
 Santini V., Kantarjian HM., Issa JP. 2001. Changes in DNA methylation in neoplasia:
pathophysiology and therapeutic implications. Ann Intern Med 134:573-586.
 Sanz GF., Sanz MA., Vallespí T., Cañizo MC., Torrabadella M., García S., Irriguible
D., San Miguel JF. 1989. Two regression models and a scoring system for predicting
survival and planning treatment in myelodysplastic syndromes: a multivariate analysis
of prognostic factors in 370 patients. Blood 74(1):395-408.
 Saretzki G., Petersen S., Petersen I., Kölble K., von Zglinicki T. 2002. hTERT gene
dosage correlates with telomerase activity in human lung cancer cell lines. Cancer Lett
176(1):81-91.
 Savage SA., Alter BP. 2009. Dyskeratosis congenita. Hematol Oncol Clin North Am
3(2):215-231.
 Scott BL., Wells DA., Loken MR., Myerson D., Leisenring WM., Deeg HJ. 2008.
Validation of a flow cytometric scoring system as a prognostic indicator for
posttransplantation outcome in patients with myelodysplastic syndrome. Blood
112(7):2681-2686.
 Sekeres MA. 2007. The myelodysplastic sindrome. Expert Opin Biol Ther 7(3):369377.
 Seimiya H., Sawada H., Muramatsu Y., Shimizu M., Ohko K., Yamane K., Tsuruo T.
2000. Involvement of 14-3-3 proteins in nuclear localization of telomerase. EMBO J
19(11):2652-2661.
 Sfeir AJ., Chai W., Shay JW., Wright WE. 2005. Telomere- end processing the
terminal nucleotides of human chromosomes. Mol Cell 18:131–138.
 Shampay J., Szostak JW., Blackburn EH. 1984. DNA sequences of telomeres
maintained in yeast. Nature 310:154-157.
 Shao L., Wood CG., Zhang D., Tannir NM., Matin S., Dinney CP., Wu X. 2007.
Telomere dysfunction in peripheral lymphocytes as a potential predisposition factor
for renal cancer. J Urol 178(4 Pt 1):1492-1496.
 Shay JW., Bacchetti S. 1997. A survey of telomerase activity in human cancer. Eur J
Cancer 33(5):787-791.
111
 Shay JW., Bacchetti S. 1997. A survey of telomerase activity in human cancer. Eur J
Cancer 33:787–791.
 Shen J., Gammon MD., Terry MB., Wang Q., Bradshaw P., Teitelbaum SL., Neugut
AI., Santella RM. 2009. Telomere length, oxidative damage, antioxidants and breast
cancer risk. Int J Cancer 124(7):1637-1643.
 Shin KH., Kang MK., Dicterow E., Park NH. 2003. Hypermethylation of the hTERT
promoter inhibits the expression of telomerase activity in normal oral fibroblasts and
senescent normal oral keratinocytes. Br J Cancer 89:1473–1478.
 Sieglová Z., Zilovcová S., Cermák J., Ríhová H., Brezinová D., Dvoráková R.,
Marková M., Maaloufová J., Sajdová J., Brezinová J., Zemanová Z., Michalová K.
2004. Dynamics of telomere erosion and its association with genome instability in
myelodysplastic syndromes (MDS) and acute myelogenous leukemia arising from
MDS: a marker of disease prognosis?. Leuk Res 28(10):1013-1021.
 Simon NM., Smoller JW., McNamara KL., Maser RS., Zalta AK., Pollack MH.,
Nierenberg AA., Fava M., Wong KK. 2006. Telomere shortening and mood disorders:
preliminary support for a chronic stress model of accelerated aging. Biol Psychiatry
60(5):432-435.
 Singer MS., Gottschling DE. 1994. TLC1: template RNA component of
Saccharomyces cerevisiae telomerase. Science 266:404–409.
 Slagboom PE., Droog S., Boomsma DI. 1994. Genetic determination of telomere size
in humans: a twin study of three age groups. Am J Hum Genet 55, 876–882.
 Smogorzewska A., de Lange T. 2004. Regulation of telomerase by telomeric proteins.
Annu Rev Biochem 73:177–208.
 Soder AI., Hoare SF., Muir S., Going JJ., Parkinson EK., Keith WN. 1997.
Amplification, increased dosage and in situ expression of the telomerase RNA gene in
human cancer. Oncogene 14(9):1013-1021.
 Spotswood HT., Turner BM. 2002. An increasingly complex code. J Clin Invest
110:577-582.
 Stansel RM., de Lange T., Griffith JD. 2001. T-loop assembly in vitro involves
binding of TRF2 near the 3’ telomeric overhang. EMBO J 20:E5532–E5540.
 Steensma DP., Dewald GW., Hodnefield JM., Tefferi A., Hanson CA. 2003. Clonal
cytogenetic abnormalities in bone marrow specimens without clear morphologic
evidence of dysplasia: a form fruste of myelodysplasia?. Leuk Res 27(3):235-242.
112
 Stein GS., Montecino M., van Wijnen AJ., Stein JL., Lian JB. 2000. Nuclear structuregene expression interrelationships: implications for aberrant gene expression in
cancer. Cancer Res 60:2067–2076.
 Stewart SA., Ben-Porath I., Carey VJ., O'Connor BF., Hahn WC., Weinberg RA.
2003. Erosion of the telomeric single-strand overhang at replicative senescence. Nat
Genet 33(4):492.
 Sugiyama H. 2001. Wilms' tumor gene WT1: its oncogenic function and clinical
application. Int J Hematol 73(2):177-187.
 Surralles J., Hande MP., Marcos R., Lansdorp PM. 1999. Accelerated telomere
shortening in the human inactive X chromosome. Am J Hum Genet 65:1617–1622.
 Suzuki T., Kimura A., Nagai R., Horikoshi M. 2000. Regulation of interaction of the
acetyltransferase region of p300 and the DNA-binding domain of Sp1 on and through
DNA binding. Genes Cells 5:29–41.
 Swerdlow SH., Campo E., Harris NL., Jaffe ES., Pileri SA., Stein H., Thiele J.,
Vardiman JW. 2008. Classification of tumors of haemotopoietic and lymphoid tissues.
Ed World Health Organization IARC Press, Lyon.
 Swiggers SJ., Kuijpers MA., de Cort MJ., Beverloo HB., Zijlmans JM. 2006.
Critically short telomeres in acute myeloid leukemia with loss or gain of parts of
chromosomes. Genes Chromosomes Cancer 45(3):247-256.
 Szostak JW., Blackburn EH. 1982. Cloning yeast telomeres on linear plasmid vectors.
Cell 29:245-255.
 Szpurka H., Tiu R., Murugesan G., Aboudola S., Hsi ED., Theil KS., Sekeres MA.,
Maciejewski JP. 2006. Refractory anemia with ringed sideroblasts associated with
marked thrombocytosis (RARS-T), another myeloproliferative condition characterized
by JAK2 V617F mutation. Blood 108(7):2173-2181.
 Takakura M., Kyo S., Kanaya T., Hirano H., Takeda J., Yutsudo M., Inoue M. 1999.
Cloning of human telomerase catalytic subunit (hTERT) gene promoter and
identification of proximal core promoter sequences essential for transcriptional
activation in immortalized and cancer cells. Cancer Res 59(3):551-557.
 Takubo K., Izumiyama-Shimomura N., Honma N., Sawabe M., Arai T., Kato M.,
Oshimura M., Nakamura K., 2002. Telomere lengths are characteristic in each human
individual. Exp Gerontol 37:523–531.
113
 Tatsumoto N., Hiyama E., Murakami Y., Imamura Y., Shay JW., Matsuura Y.,
Yokoyama T. 2000. High telomerase activity is an independent prognostic indicator of
poor outcome in colorectal cancer. Clin Cancer Res 6(7):2696-2701.
 Teofili L., Martini M., Luongo M., Diverio D., Capelli G., Breccia M., Lo Coco F.,
Leone G., Larocca LM. 2003. Hypermethylation of GpG islands in the promoter
region of p15(INK4b) in acute promyelocytic leukemia represses p15(INK4b)
expression and correlates with poor prognosis. Leukemia 17:919-924.
 Tokutake Y., Matsumoto T., Watanabe T., Maeda S., Tahara H., Sakamoto S., Niida
H., Sugimoto M., Ide T., Furuichi Y. 1998. Extra-chromosome telomere repeat DNA
in telomerase-negative immortalized cell lines. Biochem Biophys Res Commun
247:765–772.
 Turner BM. 2005. Reading signals on the nucleosome with a new nomenclature for
modified histones. Nat Struct Mol Biol 12:110-112.
 Ulaner GA., Giudice LC. 1997. Developmental regulation of telomerase activity in
human fetal tissues during gestation. Mol Hum Reprod 3(9):769-773.
 Ulaner GA., Hu JF., Vu TH., Giudice LC., Hoffman AR. 1998. Telomerase activity in
human development is regulated by human telomerase reverse transcriptase (hTERT)
transcription and by alternate splicing of hTERT transcripts. Cancer Res 58(18):41684172.
 Ulaner GA., Hu JF., Vu TH., Oruganti H., Giudice LC., Hoffman AR. 2000.
Regulation of telomerase by alternate splicing of human telomerase reverse
transcriptase (hTERT) in normal and neoplastic ovary, endometrium and
myometrium. Int J Cancer 85(3):330-335.
 Uziel O., Fenig E., Nordenberg J., Beery E., Reshef H., Sandbank J., Birenbaum M.,
Bakhanashvili M., Yerushalmi R., Luria D., Lahav M. 2005. Imatinib mesylate
(Gleevec) downregulates telomerase activity and inhibits proliferation in telomeraseexpressing cell lines. Br J Cancer 92(10):1881-1891.
 Vaissière T., Sawan C., Herceg Z. 2008. Epigenetic interplay between histone
modifications and DNA methylation in gene silencing. Mutat Res 659:40-48.
 Valdes AM., Andrew T., Gardner JP., Kimura M., Oelsner E., Cherkas LF., Aviv A.,
Spector TD. 2005. Obesity, cigarette smoking, and telomere length in women. Lancet
366:662–664.
114
 Valent P., Horny HP., Bennett JM., Fonatsch C., Germing U., Greenberg P., Haferlach
T., Haase D., Kolb HJ., Krieger O., Loken M., van de Loosdrecht A., Ogata K., Orfao
A., Pfeilstöcker M., Rüter B., Sperr WR., Stauder R., Wells DA. 2007. Definitions and
standards in the diagnosis and treatment of the myelodysplastic syndromes: Consensus
statements and report from a working conference. Leuk Res 31(6):727-736.
 van de Loosdrecht AA., Westers TM., Westra AH., Dräger AM., van der Velden VH.,
Ossenkoppele GJ. 2008. Identification of distinct prognostic subgroups in low- and
intermediate-1-risk
myelodysplastic
syndromes
by
flow
cytometry.
Blood
111(3):1067-1077.
 van Steensel B., de Lange T. 1997. Control of telomere length by the human telomeric
protein TRF1. Nature 385(6618):740-743.
 van Steensel B., Smogorzewska A., de Lange T. 1998. TRF2 protects human
telomeres from end-to-end fusions. Cell 92: 401–413.
 Van Ziffle JA., Baerlocher GM., Lansdorp PM. 2003. Telomere length in
subpopulations of human hematopoietic cells. Stem Cells 21:654–660.
 Vardiman JW., Harris NL., Brunning RD. 2002. The World Health Organization
(WHO) classification of the myeloid neoplasms. Blood 100:2292-2302.
 Vardiman JW., Thiele J., Arber DA., Brunning RD., Borowitz MJ., Porwit A., Harris
NL., Le Beau MM., Hellström-Lindberg E., Tefferi A., Bloomfield CD. 2009. The
2008 revision of the World Health Organization (WHO) classification of myeloid
neoplasms and acute leukemia: rationale and important changes. Blood 114(5):937951.
 Vasa-Nicotera M., Brouilette S., Mangino M., Thompson JR., Braund P., Clemitson
JR., Mason A., Bodycote CL., Raleigh SM., Louis E., Samani NJ. 2005. Mapping of
amajor locus that determines telomere length in humans. Am J Hum Genet 76:147–
151.
 Vaziri H., Benchimol S. 1998. Reconstitution of telomerase activity in normal human
cells leads to elongation of telomeres and extended replicative life span. Curr Biol
8:279–282.
 Vaziri H., Dragowska W., Allsopp RC., Thomas TE., Harley CB., Lansdorp PM.
1994. Evidence for a mitotic clock in human hematopoietic stem cells: loss of
telomeric DNA with age. Proc Natl Acad Sci USA.91:9857–9860.
115
 Vaziri H., Schachter F., Uchida I., Wei L., Zhu X., Effros R., Cohen D., Harley CB.
1993. Loss of telomeric DNA during aging of normal and trisomy 21 human
lymphocytes. Am J Hum Genet 52:661–667.
 Veldman T., Horikawa I., Barrett JC., Schlegel R. 2001. Transcriptional activation of
the telomerase hTERT gene by human papillomavirus type 16 E6 oncoprotein. J Virol
75(9):4467-4472.
 Verburgh E., Achten R., Louw VJ., Brusselmans C., Delforge M., Boogaerts M.,
Hagemeijer A., Vandenberghe P., Verhoef G. 2007. A new disease categorization of
low-grade myelodysplastic syndromes based on the expression of cytopenia and
dysplasia in one versus more than one lineage improves on the WHO classification.
Leukemia 21:668-677.
 Voso MT., D'Alò F., Greco M., Fabiani E., Criscuolo M., Migliara G., Pagano L.,
Fianchi L., Guidi F., Hohaus S., Leone G. 2010. Epigenetic changes in therapy-related
MDS/AML. Chem Biol Interact 184:46-49.
 Voso MT., Scardocci A., Guidi F., Zini G., Di Mario A., Pagano L., Hohaus S., Leone
G. 2004. Aberrant methylation of DAP-kinase in therapy-related acute myeloid
leukemia and myelodysplastic syndromes. Blood 103:698-700.
 Vulliamy T., Marrone A., Goldman F., Dearlove A., Bessler M., Mason PJ., Dokal I.
2001. The RNA component of telomerase is mutated in autosomal dominant
dyskeratosis congenita. Nature 413:432–435.
 Vulliamy T., Marrone A., Szydlo R., Walne A., Mason PJ., Dokal I. 2004. Disease
anticipation is associated with progressive telomere shortening in families with
dyskeratosis congenita due to mutations in TERC. Nat Genet 36(5):447-449.
 Walne AJ., Dokal I. 2008. Dyskeratosis Congenita: a historical perspective. Mech
Ageing Dev 129(1-2):48-59.
 Wang J., Xie LY., Allan S., Beach D., Hannon GJ. 1998. Myc activates telomerase.
Genes Dev 12(12):1769-1774.
 Wang Z., Kyo S., Takakura M., Tanaka M., Yatabe N., Maida Y., Fujiwara M.,
Hayakawa J., Ohmichi M., Koike K., Inoue M. 2000. Progesterone regulates human
telomerase reverse transcriptase gene expression via activation of mitogen-activated
protein kinase signaling pathway. Cancer Res 60:5376–5381.
 Watson JD. 1972. Origin of concatemeric T7 DNA. Nat New Biol 239:197-201.
116
 Wells DA., Benesch M., Loken MR., Vallejo C., Myerson D., Leisenring WM., Deeg
HJ. 2003. Myeloid and monocytic dyspoiesis as determined by flow cytometric
scoring in myelodysplastic syndrome correlates with the IPSS and with outcome after
hematopoietic stem cell transplantation. Blood 102(1):394-403.
 Wen J., Cong YS., Bacchetti S. 1998. Reconstitution of wild-type or mutant
telomerase activity in telomerase-negative immortal human cells. Hum Mol Genet
7:1137–1141.
 Weng N., Granger L., Hodes RJ. 1997. Telomere lengthening and telomerase
activation during human B cell differentiation. Proc Natl Acad Sci USA 94:10827–
10832.
 Weng NP. 2008. Telomere and adaptive immunity. Mech Ageing Dev 129(1-2):60-66.
 Weng NP., Granger L., Hodes RJ. 1997. Telomere lengthening and telomerase
activation during human B cell differentiation. Proc Natl Acad Sci USA
94(20):10827-10832.
 Wenning GK., Kiechl S., Seppi K., Müller J., Högl B., Saletu M., Rungger G., Gasperi
A., Willeit J., Poewe W. 2005. Prevalence of movement disorders in men and women
aged 50-89 years (Bruneck Study cohort): a population-based study. Lancet Neurol
4(12):815-820.
 Wenz C., Enenkel B., Amacker M., Kelleher C., Damm K., Lingner J. 2001. Human
telomerase contains two cooperating telomerase RNA molecules. EMBO J 20:3526–
3534.
 Wick M., Zubov D., Hagen G. 1999. Genomic organization and promoter
characterization of the gene encoding the human telomerase reverse transcriptase
(hTERT). Gene 232:97–106.
 Willeit P., Willeit J., Mayr A., Weger S., Oberhollenzer F., Brandstätter A.,
Kronenberg F., Kiechl S. 2010. Telomere length and risk of incident cancer and cancer
mortality. JAMA 304(1):69-75.
 Williamson PJ., Kruger AR., Reynolds PJ., Hamblin TJ., Oscier DG. 1994.
Establishing the incidence of myelodysplastic syndrome. Br J Haematol 87(4):743745.
 Wimazal F., Sperr WR., Kundi M., Vales A., Fonatsch C., Thalhammer-Scherrer R.,
Schwarzinger I., Valent P. 2008. Prognostic significance of serial determinations of
117
lactate dehydrogenase (LDH) in the follow-up of patients with myelodysplastic
syndromes. Ann Oncol 19:970-976.
 Wright WE., Piatyszek MA., Rainey WE., Byrd W., Shay JW. 1996. Telomerase
activity in human germline and embryonic tissues and cells. Dev Genet 18:173–179.
 Wright WE., Shay JW. 2001. Cellular senescence as a tumor-protection mechanism:
the essential role of counting. Curr Opin Genet Dev 11:98-103.
 Wu X., Amos CI., Zhu Y., Zhao H., Grossman BH., Shay JW., Luo S., Hong WK.,
Spitz MR. 2003. Telomere dysfunction: a potential cancer predisposition factor. J Natl
Cancer Inst 95(16):1211-1218.
 Xu D., Popov N., Hou M., Wang Q., Bjorkholm M., Gruber A., Menkel AR.,
Henriksson M. 2001. Switch from Myc/Max to Mad1/Max binding and decrease in
histone acetylation at the telomerase reverse transcriptase promoter during
differentiation of HL60 cells. Proc Natl Acad Sci USA 98:3826–3831.
 Xu D., Wang Q., Gruber A., Bjorkholm M., Chen Z., Zaid A., Selivanova G., Peterson
C., Wiman KG., Pisa P. 2000. Downregulation of telomerase reverse transcriptase
mRNA expression by wild type p53 in human tumor cells. Oncogene 19:5123–5133.
 Xu L., Blackburn EH. 2007. Human cancer cells harbor T-stumps, a distinct class of
extremely short telomeres. Mol Cell 28:315–327.
 Xu Q., Willeit J., Marosi M., Kleindienst R., Oberhollenzer F., Kiechl S., Stulnig T.,
Luef G., Wick G. 1993. Association of serum antibodies to heat-shock protein 65 with
carotid atherosclerosis. Lancet 341(8840):255-259.
 Yamada O., Oshimi K., Motoji T., Mizoguchi H. 1995. Telomeric DNA in normal and
leukemic blood cells. J Clin Invest 95(3):1117-1123.
 Yan P., Benhattar J., Coindre JM., Guillou L. 2002. Telomerase activity and hTERT
mRNA expression can be heterogeneous and does not correlate with telomere length
in soft tissue sarcomas. Int J Cancer 98(6):851-856.
 Yao MC., Blackburn E., Gall J. 1981. Tandemly repeated C-C-C-C-AA
hexanucleotide of Tetrahymena rDNA is present elsewhere in the genome and may be
related to the alteration of the somatic genome. J Cell Biol 90: 515-520.
 Yeager TR., Neumann AA., Englezou A., Huschtscha LI., Noble JR., Reddel RR.
1999. Telomerase-negative immortalized human cells contain a novel type of
promyelocytic leukemia (PML) body. Cancer Res 59:4175–4179.
118
 Yi X., Tesmer VM., Savre-Train I., Shay JW., Wright WE. 1999. Both transcriptional
and posttranscriptional mechanisms regulate human telomerase template RNA levels.
Mol Cell Biol 19(6):3989-3997.
 Yi X., White DM., Aisner DL., Baur JA., Wright WE. Shay JW. 2000. An alternate
splicing variant of the human telomerase catalytic subunit inhibits telomerase activity.
Neoplasia 2(5):433-440.
 Zee RY., Castonguay AJ., Barton NS., Buring JE. 2009. Mean telomere length and
risk of incident colorectal carcinoma: a prospective, nested case-control approach.
Cancer Epidemiol Biomarkers Prev 18(8):2280-2282.
 Zhao J., Bilsland A., Hoare SF., Keith WN. 2003. Involvement of NF-Y and Sp1
binding sequences in basal transcription of the human telomerase RNA gene. FEBS
Lett 536(1-3):111-119.
 Zhao JQ., Glasspool RM., Hoare SF., Bilsland A., Szatmari I., Keith WN. 2000.
Activation of telomerase rna gene promoter activity by NF-Y, Sp1, and the
retinoblastoma protein and repression by Sp3. Neoplasia 2:531-539.
 Zhao JQ., Hoare SF., McFarlane R., Muir S., Parkinson EK., Black DM., Keith WN.
1998. Cloning and characterization of human and mouse telomerase RNA gene
promoter sequences. Oncogene 16:1345-1350.
 Zhu XD., Niedernhofer L., Kuster B., Mann M., Hoeijmakers JH., de Lange T. 2003.
ERCC1/XPF removes the 3’ overhang from uncapped telomeres and represses
formation of telomeric DNA-containing double minute chromosomes. Mol Cell
12:1489–1498.
 Zinn RL., Pruitt K., Eguchi S., Baylin SB., Herman JG. 2007. hTERT is expressed in
cancer cell lines despite promoter DNA methylation by preservation of unmethylated
DNA and active chromatin around the transcription start site. Cancer Res 67:194–201.
 Zur Hausen H. 2000. Papillomaviruses causing cancer: evasion from host-cell control
in early events in carcinogenesis. J Natl Cancer Inst 92(9):690-698.
119
a Giacomo e Nicola…

Documenti analoghi

telomerasi: un` arma a doppio taglio

telomerasi: un` arma a doppio taglio La telomerasi è un enzima ribonucleoproteico in grado di replicare i telomeri, le estremità dei cromosomi eucaristici caratterizzati da una sequenza nucleotidica di ripetizioni in tandem di TTAGGG....

Dettagli