docAncient introgression of Lepus timidus mtDNA into L. granatensis
download 
Reclamo Transcript
Ancient introgression of Lepus timidus mtDNA into L. granatensis
MOLECULAR PHYLOGENETICS AND EVOLUTION Molecular Phylogenetics and Evolution 27 (2003) 70–80 www.elsevier.com/locate/ympev Ancient introgression of Lepus timidus mtDNA into L. granatensis and L. europaeus in the Iberian Peninsula P.C. Alves,a,b,* N. Ferrand,a,b F. Suchentrunk,c and D.J. Harrisa a Centro de Investigacßa~o em Biodiversidade e Recursos Gen eticos (CIBIO/UP), Campus Agr ario de Vair~ ao, 4485-661 Vair~ ao, Vila do Conde, Portugal b Departamento de Zoologia e Antropologia da Faculdade de Ci^ encias, Universidade do Porto, 4099-002 Porto, Portugal c Research Institute of Wildlife Ecology, University of Veterinary Medicine Vienna, Savoyenstr. 1, A1160 Vienna, Austria Received 8 February 2002; revised 25 July 2002 Abstract A 587 bp fragment of cytochrome b sequences from 90 individuals of 15 hare (Lepus) species and two outgroups were phylogenetically analysed and compared to an analysis derived from 474 bp sequences of the nuclear transferrin gene. Mountain hare (Lepus timidus) type mtDNA was observed in L. granatensis and L. europaeus from the Iberian Peninsula, far away from the extant distributional range of L. timidus. In addition to these two hare species, other hare species may also contain mtDNA from L. timidus. This species may have introgressed with other species of Lepus that occur within its present range, or where fossils indicate its historical presence during glacial periods. L. timidus mtDNA is common in the northern part of the L. granatensis range. Finally, we reassessed the phylogenetic relationships of the five European hare species based on both mitochondrial and nuclear DNA sequences. Ó 2002 Elsevier Science (USA). All rights reserved. Keywords: Lepus; Introgression; Cytochrome b; Transferrin; Iberian Peninsula 1. Introduction Historically, two hare species have been identified from the Iberian Peninsula, the Iberian hare, Lepus granatensis, and the Brown hare, L. europaeus (Miller, 1912), but there is little agreement on the taxonomy of Lepus in this region or Europe in general. The presence of only L. capensis in Iberia was suggested by Petter (1959), while Ellermann and Morrison-Scott (1951) accepted L. europaeus and L. capensis, where L. granatensis was a form of L. capensis. Corbet (1978) and Flux and Angermann (1990) acknowledged the view of Ellermann and Morrison-Scott (1951), and considered the Iberian hare a subspecies, L. capensis granatensis. A third hare species, L. castroviejoi, was described by Palacios (1976) from the Cantabrian Mountains in Northwest Spain. This author (Palacios, 1983, 1989), based on a more detailed morphological analysis, also supported the presence of L. europaeus and L. granat* Corresponding author. Fax: +351-252-661780. E-mail address: [email protected] (P.C. Alves). ensis, as proposed by Miller (1912). However, Angermann (1983) and Schneider and Leipoldt (1983) did not accept the specific status of L. castroviejoi based on morphological and molecular data, respectively, and were uncertain about L. granatensis. Corbet (1986) considered that the morphological differences between L. castroviejoi and L. europaeus were not enough to justify the specific status of L. castroviejoi. Nevertheless, additional information from protein markers (Bonhomme et al., 1986) and mtDNA variation (Perez-Su arez et al., 1994) support the existence of the three species in the Iberian Peninsula. Taxonomic controversy is also found among hares from Italy. L. corsicanus was initially considered a separate species by De Winton (1898), but was later included in L. europaeus (Ellermann and Morrison-Scott, 1951; Flux and Angermann, 1990; Wilson and Reeder, 1993). More recently morphological and molecular data have been used to provide support for L. corsicanus (Palacios, 1996; Pierpaoli et al., 1999; Riga et al., 2001). Hybridization and introgression are common phenomena in many plant and animal groups (e.g., Avise, 1055-7903/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved. doi:10.1016/S1055-7903(02)00417-7 P.C. Alves et al. / Molecular Phylogenetics and Evolution 27 (2003) 70–80 1994). They have been well studied in some mammalian groups, especially between domesticated animals and their wild counterparts, such as dogs and wolves in which introgression can be a threat to the genetic integrity of native populations (Rhymer and Simberloff, 1996). There are further examples of hybridization and introgression in the wild, such as in mice (Ferris et al., 1983; Gyllensten and Wilson, 1987), voles (Tegelstr€ om, 1987), pocket gophers (Ruedi et al., 1997), and Red and Sika deer (Goodman et al., 1999). All these examples involve closely related species in sympatry or in secondary contact zones. The taxonomical uncertainties within Lepus might result from low gene pool divergence or occasional hybridization between hare species. Indeed, unidirectional introgression of L. timidus mtDNA into L. europaeus introduced during the 19th century in Sweden has been reported by Thulin et al. (1997a), and occasional hybridization between these two species has been suspected in other regions (e.g., Baldenstein, 1893; Fraguglione, 1966; Suchentrunk et al., 1999). As there was no indication of introgression among Brown hares on the European continent (Hartl et al., 1993; Pierpaoli et al., 1999), Thulin (2000) asserted that it was unlikely that introgression pre-dated the human introduction of Brown hare in Sweden. Therefore, it would be unlikely to find individuals with introgressed mtDNA outside present areas of contact between the two species. The finding of Mountain hare haplotypes in ‘‘Swedish’’ Brown hares, that were closely related to haplotypes of Finnish and Russian mountain hares was explained by hybridization of the two species in captivity prior to releases (Thulin et al., 1997b; Thulin, 2000). In this work we reanalysed the phylogenetic relationships within the genus Lepus, especially among the five European hare species. We are particularly interested in addressing two questions: (1) is there evidence for introgressive hybridisation among hares from the Iberian Peninsula, and (2) how informative is the joint analysis of mitochondrial and nuclear gene trees in revealing the evolutionary histories of European hare species. 2. Materials and methods Localities of the 64 specimens (63 hares and 1 Sylvilagus floridanus) from which DNA was extracted are given in Table 1 and shown in Fig. 1. Species identification of the seven hare species in Table 1 was assessed in the field on the basis of phenotype. Total genomic DNA was extracted from frozen liver or blood using standard methods (Hillis et al., 1990). Polymerase Chain Reaction (PCR) primers LGCYF (50 AGCCTGATGA AACTTTGGCTC30 ) and LGCYR (50 GGATTTTAT TCTCGACTAAGC30 ) were designed to amplify a 71 1046 bp long cytochrome b fragment based on a published brown hare sequence (Halanych et al., 1999). PCR reactions were performed using conditions set at 35 cycles of 92 °C for 30 s, 52 °C for 30 s and 72 °C for 30 s followed by 72 °C for 5 min. A 474 bp fragment of the transferrin gene (between exons 6 and 7) was amplified using the primers 50 GCCTTTGTCAAGCAAGA GACC30 and 50 CACAGCAGCTCATACTGATCC30 (Wallner et al., 2001). The same amplification conditions were used as for the cytochrome b but with an annealing temperature of 57 °C. PCR products were purified using a QIAEX II kit (Qiagen) and sequenced using the primers reported above. Sequences were analysed on an Applied Biosystems Model 310 DNA Sequencing System. All new sequences were deposited on GenBank (Table 1; Accession No. AY176187–AY176280). 2.1. Phylogenetic analyses Partial cytochrome b sequences were aligned against published sequences including the following additional species: L. americanus, L arcticus, L. californicus, L. callotis, L. comus, L. oiostolus, L. othus, and L. townsendii. The data appear to be mitochondrial DNA sequences and not nuclear integrated copies (see Nielsen and Arctander, 2001), because the cytochrome b sequences contain no introns or stop codons, and the strong strand bias in the third position is typical (A 38% C 33% G 3% T 26%, compared to average in mammals of A 39% C 36% G 3% T 21%, Johns and Avise, 1998). Transferrin sequences were aligned against Oryctolagus cuniculus (Wallner et al., 2001) using Clustal W (Thompson et al., 1994), and then imported into PAUP* (Swofford, 2001) for phylogenetic analyses. To choose a sequence evolution model, we used the approach outlined by Huelsenbeck and Crandall (1997) to test 56 alternative models of evolution, employing PAUP* (Swofford, 2001) and Modeltest (Posada and Crandall, 1998), as discussed in Harris and Crandall (2000). Once a model of evolution was chosen, it was used to estimate a phylogeny using neighbor joining (NJ). Confidence in resulting nodes was assessed using the bootstrap technique (Felsenstein, 1985) with 1000 replicates. Maximum Parsimony (MP) analyses were also performed (100 replicate heuristic searches using TBR branch swapping), and confidence in nodes was assessed using the bootstrap technique (1000 replicates). 3. Results 3.1. Cytochrome b sequence variation In this study we sequenced 587 base pairs of the cytochrome b gene for 62 hare individuals that were analysed in combination with 28 previously published 72 P.C. Alves et al. / Molecular Phylogenetics and Evolution 27 (2003) 70–80 Table 1 New taxa used in phylogenetic analysis, sample locations, abbreviated codes, and GenBank accession numbers for cytochrome b (Cyt b) and transferrin (TF) sequences Species Collection locality Local code Tissue codes Cyt b L. granatensis Bragancßa, Portugal Bragancßa, Portugal Sendim, Portugal Idanha, Portugal Idanha, Portugal Idanha, Portugal Idanha, Portugal Santarem, Portugal Santarem, Portugal Santarem, Portugal Benavente, Portugal Benavente, Portugal Benavente, Portugal Aljustrel, Portugal Aljustrel, Portugal Aljustrel, Portugal Portim~ao, Portugal Portim~ao, Portugal Portim~ao, Portugal Victoria, Spain Lugo, Spain Astorga, Spain Pontevedra, Spain Pontevedra, Spain Sesma, Spain Sesma, Spain Sesma, Spain Sesma, Spain Sesma, Spain Zaragoza, Spain Zaragoza, Spain Teruel, Spain Segovia, Spain Toledo, Spain Toledo, Spain Toledo, Spain Granada, Spain Granada, Spain Perpignan, France Alsasua, Spain Pamplona, Spain Pamplona, Spain Pamplona, Spain Burgui, Spain Burgui, Spain Paris, France Vienna, Austria Lassee, Austria Remolina, Spain Remolina, Spain Castello Porziano, Italy Irland Mull, Scotland Norway Sweden France (Alpes) Switzerland Tetouan, Morocco Tetouan, Morocco Rabat, Morocco Rabat, Morocco 1a 1b 2 3a 3b 3c 3d 4a 4b 4c 5a 5b 5c 6a 6b 6c 7a 7b 7c 8 9 10 11a 11b 12a 12b 12c 12d 12e 13a 13b 14 15 16a 16b 16c 17a 17b 18 19 20a 20b 20c 21a 21b 22 23a 23b 24a 24b 25 26 27 28 29 30 31 32a 32b 33a 33b Brag218 Brag315 Send Cbr154 Cbr161 Cbr222 Cbr226 Sant40 Sant56 Sant58 Panc11 Panc13 Panc15 Alj264 Alj107 Alj108 Ptm68 Ptm69 Ptm70 Vict3 Lugo1 Ast Pv5 Pv6 Nav1 Nav26 Nav27 Nav32 Nav33 Zara9 Zara10 Ter6 Sego8 Tol13 Tol20 Tol21 Gran7 Gran26 Perp10 Nav46 Nav43 Nav44 Nav45 Nav42 Nav47 Franc10 Aust988 Lass1 Castr1 Castr2 Cors1 Irl Scot Nor34 Swe Franc301 Switz23 Tet1 Tet2 Raba2 Raba5 AY176187 AY176188 AY176189 AY176190 AY176191 AY176192 AY176193 AY176194 AY176195 AY176196 AY176197 AY176198 AY176199 AY176200 AY176201 AY176202 AY176203 AY176204 AY176205 AY176206 AY176207 AY176208 AY176209 AY176210 AY176211 AY176212 AY176213 AY176214 AY176215 AY176216 AY176217 AY176218 AY176219 AY176220 AY176221 AY176222 AY176223 AY176224 AY176225 AY176226 AY176227 AY176228 AY176229 AY176230 AY176231 AY176232 AY176233 AY176234 AY176235 AY176236 AY176237 L. europaeus L. castroviejoi L. corsicanus L. timidus L. capensis AY176238 AY176239 AY176240 AY176241 AY176242 AY176243 AY176244 AY176245 AY176246 TF AY176249 AY176250 AY176251 AY176252 AY176253 AY176254 AY176255 AY176256 AY176257 AY176258 AY176259 AY176260 AY176261 AY176262 AY176263 AY176264 AY176265 AY176266 AY176267 AY176268 AY176269 AY176270 AY176271 AY176272 AY176273 AY176274 AY176275 AY176276 AY176277 AY176278 P.C. Alves et al. / Molecular Phylogenetics and Evolution 27 (2003) 70–80 73 Table 1 (continued) Species Collection locality Local code Tissue codes Cyt b TF L. saxatilis Maputo, Mozambique Maputo, Mozambique Wyoming, USA 34a 34b 35 Lsax1 Lsax2 Sf1 AY176247 AY176248 AY176279 Sylvilagus floridanus * AY176280 From an introduced population in France. Fig. 1. Map showing the distribution of taxa sequenced in this study (species ranges according to Mitchell-Jones et al., 1999). Circles indicate L. granatensis, squares L. timidus, inverted triangles L. europaeus, triangles L. castroviejoi, ovals L. corsicanus, and asterisks L. capensis. Unfilled symbols indicate populations where introgressed L. timidus mtDNA was found. L. saxatilis (Mozambique) and S. floridanus (USA) were also sequenced in this study. For distribution ranges of other species see Flux and Angermann (1990). sequences from the GenBank (see Appendix A). We also included published sequences of the cottontail, S. floridanus, and the European rabbit, O. cuniculus (Halanych and Robinson, 1997; Irwin and Arnason, 1994, respectively) as outgroups. The most appropriate model of evolution for this data set was the ‘‘K81 unequal frequencies model’’ including a discrete approximation of a Gamma distribution with variable sites (Fig. 2). Under MP, 182 characters were informative, 174 within the ingroup. A 10 replicate heuristic search found 8 equally parsimonious trees of 615 steps. As there were no nodes in conflict between the 50% bootstrap consensus trees, the MP trees are not shown and the bootstrap values of the MP analysis have been overlaid onto the NJ tree (Fig. 2). The phylogenetic topology depicted in Fig. 2 shows that cytochrome b sequences from several species do not form a monophyletic group. For example, 26 (25 from our data plus one from GenBank) out of 40 L. granat- ensis sequences form a distinct monophyletic group (100% support) but the other 14 sequences had a different mtDNA type, quite similar or identical to that found in L. timidus. Geographically, all of the L. granatensis samples that had L. timidus type mtDNA are from the North of the Iberian Peninsula, the southernmost sample being from Toledo (Fig. 1). A similar result was obtained with L. europaeus samples. Four of the six analysed brown hares from Navarra in northeast Spain, had a L. timidus type mtDNA. This could be explained by introgression of L. timidus mtDNA into these species. Uncorrected genetic distances between major mtDNA lineages are shown in Table 2. 3.2. Transferrin sequence variation The most appropriate model to represent the phylogenetic relationships of the 31 hare sequences plus those ones from the outgroups (S. floridanus and O. cuniculus) 74 P.C. Alves et al. / Molecular Phylogenetics and Evolution 27 (2003) 70–80 Fig. 2. Phylogenetic relationships derived from a NJ analysis of the cytochrome b region. Site locations for each taxon are given by the local code (see Table 1). Additional taxa from GenBank sequences are noted with a number in parenthesis (see Appendix A). Outgroups sequences, S. floridanus and O. cuniculus, were obtained from Halanych and Robinson (1997) and Irwin and Arnason (1994), respectively. Bootstrap values over 50 (1000 replicates) from NJ and MP are given above and below nodes, respectively. The samples that were sequenced for transferrin are indicated in bold. P.C. Alves et al. / Molecular Phylogenetics and Evolution 27 (2003) 70–80 75 Table 2 Uncorrected distances for cytochrome b (below diagonal) and tranferrin (above diagonal) sequences between the major mtDNA lineages Lcast Lcast Lcors Lgran LgrLt Leuro LeuLt Lcape Ltimi 0.012 0.109 0.027 0.104 0.032 0.111 0.027 Lcors Lgran LgrLt Leuro LeuLt Lcape Ltimi 0.000 0.009 0.009 – – – 0.008 0.008 0.008 – – – – – – 0.026 0.026 0.024 – 0.023 – 0.009 0.009 0.009 – 0.004 – 0.024 0.102 0.023 0.106 0.031 0.105 0.022 0.097 0.077 0.101 0.102 0.097 0.093 0.004 0.089 0.000 0.098 0.084 0.094 0.092 0.006 0.089 Lepus granatensis and L. europaeus are split into two groups, respectively, according to introgressed (LgrLt and LeuLt) or not introgressed specimens (Lgran and Leuro). Lcast (L. castroviejoi), L. cors (L. corsicanus), Lcape (L. capensis), Ltimi (L. timidus). was the ‘‘TVM model’’ with a discrete approximation of the gamma distribution (Fig. 3). Under MP, 66 of the 474 nucleotides were variable and 38 informative. A 100 replicate heuristic search found 80 trees of 92 steps. The strict consensus produces an identical estimate of relationship between species as the NJ analysis, differing only in being less well resolved within species. Therefore the consensus is not shown, but the bootstrap values have been overlaid onto the NJ tree (Fig. 3). Uncorrected distances ranged from 0-2.6% among the European hare species (Table 2), and increased to 6.3% between L. capensis and S. floridanus. The phylogenetic relationships derived from the partial transferrin gene show a scenario different from that given by the cytochrome b. L. granatensis, L. europaeus and L. timidus form three monophyletic groups. Using this marker, L. castroviejoi and L. corsicanus are identical. For the African species (L. capensis and L. saxatilis) the results for the partial transferrin gene are congruent with the mtDNA data as they form a monophyletic group, and are genetically different from L. granatensis and L. europaeus. 4. Discussion 4.1. Phylogenetic evidence of mtDNA introgression in Iberian hares Using the cytochrome b data, a considerable number of individuals of L. granatensis and L. europaeus are not distinguishable from L. timidus, although these three species are ecologically and morphologically clearly distinct (Flux and Angermann, 1990; Mitchell-Jones et al., 1999). Further, in both L. granatensis and L. europaeus the majority of mtDNA sequences cluster separately from L. timidus. Cytochrome b genetic divergence between these three species (7.7–9.7%, Table 2) is typical of mammalian species (Johns and Avise, 1998). Therefore, it seems likely that the existence of L. timidus type mtDNA in these species is due to ancient introgression. This is supported by our phylogenetic analysis of the nuclear gene, transferrin, which demonstrates the monophyly of both L. granatensis and L. europaeus, including specimens that showed L. timidus type mtDNA. Interestingly, in L. europaeus introgressed individuals have so far only been reported from the Iberian Peninsula, despite RFLP of total or partial mtDNA and control region sequence analysis of large numbers of L. europaeus from central and southeastern Europe (Hartl et al., 1993; Pierpaoli et al., 1999; Mamuris et al., 2001) and the UK (Suchentrunk et al., 2001). We interpret these results as introgression and not incomplete lineage sorting, since the species are otherwise genetically highly differentiated, and the introgressed individuals show identical haplotypes to L. timidus (Table 2). Further, the patchy distribution of introgressed haplotypes matches expectations from possible ancient introgression. It is known from paleontological data that during the last glacial period the range of L. timidus extended into the Iberian Peninsula reaching the Cantabrian mountains (Altuna, 1970, 1971). During this period, other European hare species would have been confined to southern refugia, for example L. granatensis in the Iberian Peninsula. Moreover, a comparison of allozyme diversity of L. europaeus from central and southeastern Europe is not incongruent with the hypothesis of an isolated population in Iberia as well as in southeast Europe (Suchentrunk et al., 2000). Therefore, during these periods, L. timidus mtDNA introgression in L. granatensis and L. europaeus could have occurred in the Iberian Peninsula. This would explain the present day distribution of individuals with mtDNA introgression in the two species. Within the introgressed clade there are two groups. L. granatensis haplotypes are found in both groups, but L. europaeus haplotypes are only found in the more derived group. This could reflect two separate waves of introgression. Interestingly, we have not found L. granatensis or L. europaeus mtDNA in any L. timidus individuals which could imply that introgression is unidirectional, a phenomenon that has been reported in other mammals (Gyllensten and Wilson, 1987). However, more extensive sampling would be needed to confirm this. Realization that L. timidus mtDNA is found in L. europaeus in the Iberian Peninsula can explain the paraphyly (3 out of 7 individuals formed a clade with the 76 P.C. Alves et al. / Molecular Phylogenetics and Evolution 27 (2003) 70–80 Fig. 3. Phlylogenetic relationships derived from a NJ analysis of the transferrin region. Site locations for each taxon are given by the local code (see Table 1). Bootstrap values over 50 (1000 replicates) from NJ and MP are given above and below nodes, respectively. samples of L. castroviejoi) and extensive mtDNA diversity (circa 13%) of this species described by PerezSu arez et al. (1994), based on an mtDNA RFLP study. In this last work, samples of individuals from L. castroviejoi, L. europaeus, L. granatensis, and L. capensis were included, but not from L. timidus. Within L. granatensis, Perez-Suarez et al. (1994) reported no introgression in ten individuals from Cadiz in southern Spain. In our study, most of the L. granatensis carrying L. timidus type mtDNA were found in the northern part of the Iberian Peninsula (except one hare from Toledo). Again, this is supported by the P.C. Alves et al. / Molecular Phylogenetics and Evolution 27 (2003) 70–80 paleontological data from Altuna (1970) and fits a scenario of hybridization between L. timidus and L. granatensis in northern Iberia. While L. timidus is no longer present in the Iberian Peninsula, its mtDNA remains in some L. granatensis. 77 lard, 2000). Besides, inclusion of several individuals from geographically diverse regions of species ranges can help to detect introgression. Our results further stress that introgression can occur in genetically, morphologically, and ecologically distinct mammalian species. 4.2. Is there introgression in arctic hares? 4.4. Phylogenetic relationships The two nearctic species L. othus and L. arcticus also contain cytochrome b sequences that are identical to some L. timidus, and are morphologically similar to L. timidus such that some authors suggest that they are conspecific (Dixon et al., 1983; Flux and Angermann, 1990). Because of their similarity Halanych et al. (1999) state that cytochrome b data support the interpretation of a single circumpolar species. However, an alternative hypothesis is that these specimens contained introgressed L. timidus mtDNA. Therefore, without more extensive sampling and inclusion of nuclear loci, the distinctiveness of nearctic hare gene pools and potential relevance of introgression cannot be evaluated. 4.3. Implications of introgression in hares Phylogenetic hypotheses based on mtDNA sequences only allow inferences about mitochondrial genealogy and not that of the species (Avise, 1994; Ballard et al., 2002). When taxonomic and conservation inferences are derived from such data it is sometimes assumed that the mitochondrial genealogy and the species tree are the same (see also Ballard et al., 2002). This is clearly not the case when introgression occurs to a remarkable degree, as in hares from the Iberian Peninsula. The report of introgression between L. europaeus and L. timidus in Sweden (Thulin et al., 1997a) has not prevented later studies from making taxonomic and conservation inferences for hares based primarily on mtDNA (Halanych et al., 1999; Pierpaoli et al., 1999). Introgression was believed to be limited to areas of sympatry as a consequence of human introductions (Thulin, 2000). However, our results suggest that introgression can occur historically between taxa that were once in contact but now are allopatrically distributed. When introgression is reported, especially in animals, it is usually among closely related species, such as mice (Ferris et al., 1983), pocket gophers (Ruedi et al., 1997), and Red and Sika deer (Goodman et al., 1999). In the present study, the introgression concerned species that are genetically clearly distinct, with circa 9% divergence in the cytochrome b gene, a level which is close to the average distance for congeneric mammalian species (Johns and Avise, 1998). This implies that introgression is a possibility in hare species other than those in which it has been observed so far. Our results prompt for the need of multiple loci to be used when assessing species relationships (see also Bal- Our phylogenetic conclusions derived from cytochrome b sequences are similar to those previously suggested (e.g., Halanych et al., 1999), that Lepus is a well defined monophyletic group. This is also supported by the phylogenetic topology derived from the partial transferrin gene sequences. There are three species of hares in the Iberian Peninsula, L. granatensis, L. castroviejoi, and L. europaeus, which are genetically distinct from each other. L. granatensis is clearly not related to the North African hares, referred to as L. capensis (Fig. 3). The transferrin sequence data indicate that L. castroviejoi and L. corsicanus are sister taxa, which is concordant with morphological evidence (Palacios, 1996). The present restricted ranges of these two species in the Cantabrian mountains and in central and southern Italy, respectively, could represent relics of a common ancestor with a much larger distribution in southern and southwestern Europe (this study; Palacios, 1996). Regarding morphological and molecular data (Palacios, 1996; Pierpaoli et al., 1999; Riga et al., 2001; and present study), L. corsicanus is clearly distinct from L. europaeus, to which it was historically assigned (Ellermann and Morrison-Scott, 1951). The two African taxa studied presently (L. capensis and L. saxatilis) form a monophyletic clade in phylogenetic analysis derived from both cytochrome b and transferrin sequence data. Hares from Morocco are closely related to hares from Sardinia (L. c. mediterraneus), which were probably introduced there from North Africa during the 16th century (Vigne, 1992). Some authors consider L. c. mediterraneus a full species (e.g., Palacios, 1998). Our data are congruent with this hypothesis; average cytochrome b sequence divergence within Sardinian and Moroccan L. c. mediterraneus amounted to 2.1% compared to 9% with L. capensis capensis from South Africa. Based on cytochrome b data, L. capensis from South Africa is more closely related to L. saxatilis from Mozambique. Two other species that do not form monophyletic groups are L. timidus and L. oiostolus. Sequences from two L. timidus individuals do not cluster with the main L. timidus clade; one of these is the sister taxon to L. townsendii. One sequence from an individual of L. oiostolus is the sister taxon to L. comus, while the other two are related to the L. corsicanus/L castroviejoi clade. Clearly further work is needed to assess the taxonomic status and range of these species. 78 P.C. Alves et al. / Molecular Phylogenetics and Evolution 27 (2003) 70–80 Although other species form well supported groups, relationships between them are poorly resolved. This could be due to the fact that cytochrome b is close to saturation at this taxonomic level (Halanych et al., 1999), due to rapid cladogenesis in the early history of the genus, or reticulate evolution through introgressive hybridisation. The region of the transferrin gene used in this analysis is informative for assessing relationships among hare species. The inclusion of additional of characters and hare species will significantly clarify the phylogenetic relationships within the genus Lepus. 5. Conclusions This research was partially funded by a grant from the Direccß~ao-Geral de Florestas, ‘‘Analise de caracterısticas reprodutivas e geneticas da lebre iberica (L. granatensis)’’ and POCTI/41457/BSE/2001. We thank F. Lamarque (ONC-France), for L. europaeus samples, B. Haddane (Zoological Park of Rabbat, Morocco) for L. capensis samples, J. Martinez (Le on, Spain) for L. castroviejoi samples, Sonia Calderola (Ozzano, Italy) for one L. corsicanus sample, M. Vargas (Malaga, Spain), V. Piorno (Pontevedra, Spain), C. Gortazar (Zaragoza, Spain), O. Galaup (Perpignan, France) for L. granatensis samples and R. Sim~ oes, B. Fraguas, J. Castro, C. Ferreira, C. Lima, and H. Goncßalves for help with sampling L. granatensis in Portugal. We also thank C. Pinho and P. Esteves for laboratory assistance, and M. Branco and S. Weiss for comments on an earlier version of the manuscript. Of 15 species of hares examined, L. granatensis and L. europaeus include introgressed L. timidus mtDNA, and perhaps others (L. articus, L. castroviejoi, L. corsicanus, L. oistolus, L. othus, and L. townsendii) as well. Therefore, without data from other sources such as morphological characters or nuclear gene sequences, no conclusions concerning species status or phylogenetic relationships in hares should be drawn. Previous conclusions based on mtDNA analysis, such as the status of L. othus and L. arcticus, need to be reassessed. Cytochrome b sequences are known to be saturated at the deeper nodes, and especially with respect to the outgroups (Halanych et al., 1999). This could explain the short branches and low levels of support for relationships between most hare species using the mtDNA data. Acknowledgments Appendix A Information on cytochrome b sequences downloaded from GenBank. Species designation, individual code (reference number plus individual letter), location, GenBank accession number and reference. For species range information see Flux and Angermann (1990) Species Code Location GenBank Accession No. Reference L. corsicanus (1a) (1b) (1) (2a) AF157464 AF157463 AF157466 AF009732 Pierpaoli et al. (1999) Pierpaoli et al. (1999) Pierpaoli et al. (1999) Halanych et al. (1999) (2b) (3a) (3b) (2) (2) (2) (3a) (3b) (3c) (3a) (3b) (1a) Italy Italy Italy, Alps Scotland, Aberdeen Russia, Chukotsk China China Greenland USA, Alaska USA, Utah China China China China China Italy, Sardinia AF010155 AJ279424 AJ279425 AF010153 AF010154 AF009733 AJ279428 AJ279427 AJ279426 AJ279408 AJ279407 AF157462 Halanych et al. (1999) Wu and Zhang, (unpublished) Wu and Zhang, (unpublished) Halanych et al. (1999) Halanych et al. (1999) Halanych et al. (1999) Wu and Zhang (unpublished) Wu and Zhang (unpublished) Wu and Zhang (unpublished) Wu and Zhang (unpublished) Wu and Zhang (unpublished) Pierpaoli et al. (1999) (1b) (4) Italy, Sardinia Africa AF157461 U58934 Pierpaoli et al. (1999) Halanych and Robinson (1999) L. timidus L articus L. othus L. towensendii L. oiostolus L. comus L. capensis mediterranus L. capensis P.C. Alves et al. / Molecular Phylogenetics and Evolution 27 (2003) 70–80 79 Appendix A (continued) Species Code Location GenBank Accession No. Reference L. saxatilis (2) AF009731 Halanych et al. (1999) L. americanus L. callotis (2) (4) (2) AF010152 U58932 AF010158 Halanych et al. (1999) Halanych and Robinson (1999) Halanych et al. (1999) L. californicus (2) South Africa, Kimberly USA, Alaska USA, Maine USA, New Mexico USA, New Mexico USA, Texas Spain Italy Sweden, Vem Sweden, Sibbarp AF010160 Halanych et al. (1999) U58933 AF157465 AF157460 AF010161 AF010162 Halanych and Robinson (1999) Pierpaoli et al. (1999) Pierpaoli et al. (1999) Halanych et al. (1999) Halanych et al. (1999) L. granatensis L. europaeus (4) (1) (1) (2a) (2b) References Altuna, J., 1970. Hallazgo de una liebre artica (Lepus timidus) en el yacimiento prehistorico de Urtiga (Guipuzcoa). Munibe. San Sebastean 22, 165–168. Altuna, J., 1971. Fauna de mamiferos de los Yacinientos pre-hist oricos de Guipuzcoa. Con Catalogo de los Mamiferos Cuaternarios del Cantabrico y del Pirineo Occidental. Arazandi Ciencias Naturales, Munibe, San Sebastian 24, 1–465. Angermann, R., 1983. The taxonomy of Old World Lepus. Acta Zool. Fennica 174, 17–21. Avise, J.C., 1994. Molecular Markers, Natural History and Evolution. Chapman & Hall, New York. Baldenstein, T.C. Zu., 1893. III. Zoologische Mittheilungen. Der Bastardhase. Jahresber. d. Naturf. Gesellsch. Graub€ undens. NF. VIII. Jahrg: 98–101. Ballard, J.W.O., 2000. When one is not enough: introgression of mitochondrial DNA in Drosophila. Mol. Biol. Evol. 17, 1126–1130. Ballard, J.W.O., Chernoff, B., James, A.C., 2002. Divergence of mitochrondial DNA is not corroborated by nuclear DNA, morphology, or behavior in Drosophila simulans. Evolution 56, 527– 545. Bonhomme, F., Fernandez, J., Palacios, F., Catalan, L., Machordon, A., 1986. Caracterisation biochimique du complex dÕespeces du genre Lepus en Espagne. Mammalia 50, 495–506. Corbet, G.B., 1978. In: The mammals of the Palaearctic region: a taxonomic review. British Museum (Natural History). Cornell University Press, Ithaca, New York, 314 pp. Corbet, G.B., 1986. Relationships and origins of the European lagomorphs. Mammal Rev. 16, 105–110. Dixon, K.R., Chapman, J.A., Willner, G.R., Wilson, D.E., LopezForment, W., 1983. The new world Jackrabbits and hares (genus Lepus). 2. Numerical analysis. Acta Zool. Fennica 174, 53–56. Ellermann, J.R., Morrison-Scott, T.C., 1951. Checklist of Paleartic and Indian Mammals 1758–1946. Brit. Mus. (Nat. Hist.), London. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Ferris, S.D., Sage, R.D., Huang, C.M., Nielsen, J.T., Ritte, U., Wilson, A.C., 1983. Flow of mitochondrial DNA across a species boundary. Proc. Natl. Acad. Sci. USA 80, 2290–2294. Flux, J.E., Angermann, R., 1990. The hares and jackrabbits. In: Chapman, J.A., Flux, J.E.C. (Eds.), Rabbits, Hares and Pikas. Status Survey and Conservation Action plan. IUCN, Switzerland, pp. 61–94. Fraguglione, D., 1966. LÕhybridation du lievre commun et du lievre variable, Lepus europaeus L. timidus varronis (Pallas, 1878). S€augetierkunde. Mitt. 14, 92–100. Goodman, S., Barton, N., Swanson, G., Abernethy, K., Pemberteon, J., 1999. Introgression through rare hybridization: a genetic study of a hybrid zone between Red and Sika Deer (genus Cervus) in Argyll, Scotland. Genetics 152, 355–371. Gyllensten, U.B., Wilson, A.C., 1987. Interspecific mitochondrial DNA transfers and the colonization of Scandinavia by mice. Genet. Res. Camb. 49, 25–29. Halanych, K.M., Robinson, T.J., 1997. Phylogenetic relationships of cottontails (Sylvilagus, Lagomorpha): congruence of cytogenetic and 12s rDNA data. Mol. Phylogenet. Evol. 7, 294–302. Halanych, K.M., Demboski, J.R., van Vuuren, B.J., Klein, D.R., Cook, J.A., 1999. Cytochrome b phylogeny of North American hares and jackrabbits (Lepus, Lagomorpha) and the effects of saturation in outgroup taxa. Mol. Phylogenet. Evol. 11, 213– 221. Halanych, K.M., Robinson, T.J., 1999. Multiple substitutions affect the phylogenetic utility of cytochrome b and 12s rDNA data: examining a rapid radiation in leporid (Lagomorpha) evolution. J. Mol. Evol. 48, 369–379. Hartl, G.B., Suchentrunk, F., Nadlinger, K., Willing, R., 1993. An integrative analysis of genetic differentiation in the brown hare Lepus europaeus based on morphology, allozymes and mitochondrial DNA. Acta Theriologica 38 (suppl. 12), 33–57. Harris, D.J., Crandall, K.A., 2000. Intragenomic variation within ITS1 and ITS2 of freshwater crayfishes (Decapoda: Cambaridae): implications for phylogenetic and microsatellite studies. Mol. Biol. Evol. 17, 284–291. Hillis, D.M., Larson, A., Davis, S.K., Zimmer, E.A., 1990. Nucleids acids III: sequencing. In: Hillis, D.M., Moritz, C. (Eds.), Molecular Systematics. Sinauer Associates, Saunderland, MA, pp. 18–370. Huelsenbeck, J.P., Crandall, K.A., 1997. Phylogeny estimation and hypothesis testing using maximum likelihood. Ann. Rev. Ecol. Syst. 28, 437–466. Irwin, D.M., Arnason, U., 1994. Cytochrome b gene of marine mammals: phylogeny and evolution. J. Mamm. Evol. 2, 37–55. Johns, G.C., Avise, J.C., 1998. A comparative summary of genetic distances in the vertebrates from the mitochondrial Cytochrome b gene. Mol. Biol. Evol. 15, 1481–1490. Mamuris, Z., Sfougaris, A.I., Stamatis, C., 2001. Genetic structure of Greek brown hares (Lepus europaeus) populations as revealed by 80 P.C. Alves et al. / Molecular Phylogenetics and Evolution 27 (2003) 70–80 DBNA RFLP-PCR analysis implications for conserving genetic diversity. Biol. Conserv. 101, 187–196. Mitchell-Jones, A.J., Amori, G., Bogdanowicz, W., Krystufek, B., Reijnders, P., Spitzenberger, F., Stubbe, M., Thissen, J., Vohralik, V., Zima, J., 1999. Atlas of European Mammals. Academic Press, London. Miller, G.S., 1912. Catalogue of the Mammals of Western Europe. British Museum, London. Nielsen, H., Arctander, P., 2001. Recombination among multiple mitochondrial pseudogenes from a Passerine genus. Mol. Phylogenet. Evol. 18, 362–369. Palacios, F., 1976. Descripci on de una nueva especie de liebre (Lepus castroviejoi) endemica de la cordillera Cantabrica. Don. Acta Vert. 3, 205–223. Palacios, F., 1983. On the taxonomic status of the genus Lepus in Spain. Acta Zool. Fennica 174, 27–30. Palacios, F., 1989. Biometric and morphologic features of the species of the genus Lepus in Spain. Mammalia 53, 227–264. Palacios, F., 1996. Systematics of the indigeneous hares of Italy traditionally identified as Lepus europaeus Pallas, 1778 (Mammalia: Leporidae). Bonner Zoologische Beitr€age 56, 59–91. Palacios, F., 1998. Diversity of hares in Europe. In: Reig, S. (Ed.), Euro-American Mammal Congress. Universidad de Santiago de Compostela, Spain, p. 85, Abstracts. Perez-Su arez, G., Palacios, F., Boursot, P., 1994. Speciation and paraphyly in western Mediterranean Hares (Lepus castroviejoi, L. europaeus, L. granatensis and L. capensis) revealed by mitochondrial DNA phylogeny. Biochem. Genet. 32, 423–436. Petter, F., 1959. Elements dÕune revision des Lievres africains du sousgenre Lepus. Mammalia 23, 41. Pierpaoli, M., Riga, F., Trocchi, V., Randi, E., 1999. Species distinction and evolutionary relationships of the Italian hare (Lepus corsicanus) as described by mitochondrial DNA sequencing. Mol. Ecol. 8, 1805–1817. Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14, 817–818. Rhymer, J.M., Simberloff, D., 1996. Extinction by hybridization and introgression. Annu. Rev. Ecol. Syst. 27, 83–109. Riga, F., Trocchi, V., Randi, E., Toso, S., 2001. Morphometric differentiation between the Italian hare (Lepus corsicanus De Winton, 1898) and the European Brown hare (Lepus europaeus Pallas, 1778. J. Zool. Lond. 253, 241–252. Ruedi, M., Smith, M.F., Patton, J.L., 1997. Phylogenetic evidence of mitochondrial introgression among pocket gophers in New Mexico (family Geomyidae). Mol. Ecol. 6, 453–462. Schneider, E., Leipoldt, M., 1983. DNA relationship within the genus Lepus in SW Europe. Acta Zool. Fennica 174, 31–33. Suchentrunk, F., Michailov, G., Markov, G., Haiden, A., 2000. Population genetics of Bulgarian brown hares Lepus europaeus: allozymic diversity at zoogeographical crossroads. Acta Theriologica 45, 1–12. Suchentrunk, F., Jaschke, C., Haiden, A., 2001. Little allozyme and mtDNA variability in brown hares (Lepus europaeus) from New Zealand and Britain—A legacy of bottlenecks? Mammalian Biol. 66, 48–59. Suchentrunk, F., Polster, K., Giacometti, M., Thulin, C.-G., Ruhle, C., Vasilev, A.G., Slotta-Bachmayr, L., 1999. Spatial partitioning of allozyme variability in European mountain hares (Lepus timidus): gene pool divergence across a disjunct distributional range. Zeitschrift f€ ur S€augetierkunde 64, 308–318. Swofford, D.L., 2001. PAUP* Phylogenetic Analysis using Parsimony (and other methods). Sinauer Associates, Sunderland, MA, USA. Tegelstr€ om, H., 1987. Transfer of mitochondrial DNA from the northern red-backed vole (Clethrionomys rutilus) to the bank vole (C. glareolus). J. Mol. Evol. 24, 218–227. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acid. Res. 22, 4673–4680. Thulin, C.-G., Jaarola, M., Tegelstr€ om, H., 1997a. The occurrence of mountain hare mitochondrial DNA in wild brown hares. Mol. Ecol. 6, 463–467. Thulin, C.G., Isaksson, M., Tegelstr€ om, H., 1997b. The origin of Scandinavian mountain hares (Lepus timidus). Gibier et faune Sauvage. Game and Wildlife 14, 463–475. Thulin, C.G., 2000. Hybridization between introduced Brown hares and native mountain hares in Sweden. Dissertation Thesis, Uppsala University. Vigne, J.D., 1992. Zooarchaeology and the biogeographical history of mammals of Corsica and Sardinia since the last ice age. Mamm. Rev. 2, 87–89. Wallner, B., Huber, S., Achmann, R., 2001. Non-invasive PCR sexing of rabbits (Oryctolagus cuniculus) and hares (Lepus europaeus). Mammalian Biol. 66, 190–192. Wilson, D.E., Reeder, D.A.M., 1993. Mammal Species of the World a Taxonomical and Geographic Reference, second ed. Smithsonian Inst. Press, Washington, London. De Winton, W.E., 1898. On the hares of western Europe and north Africa. Ann. Mag. Hist. Lond. 1, 158–1489.
