Italian Journal of Gynaecology and Obstetrics

Transcript

Italian Journal
of
Gynaecology
& Obstetrics
June 2016 - Vol. 28 - N. 2 - Quarterly - ISSN 2385 - 0868
The Official Journal of the
Società Italiana di Ginecologia e Ostetricia
(SIGO)
Quarterly
Partner-Graf
1
Italian Journal
of
Gynaecology
& Obstetrics
The Official Journal of the
Società Italiana di Ginecologia e Ostetricia
(SIGO)
Quarterly
Partner-Graf
Editor in Chief
Paolo Scollo, Catania
Editors
Herbert Valensise, Roma
Enrico Vizza, Roma
Editorial Board
Cervigni Mauro, Roma
Chiantera Vito, Napoli
Costa Mauro, Genova
De Stefano Cristofaro, Avellino
De Vita Davide, Salerno
La Sala Giovanni Battista, Reggio Emilia
Locci Maria Vittoria, Napoli
Marci Roberto, Roma
Monni Giovanni, Cagliari
Ragusa Antonio Franco, Milano
Sirimarco Fabio, Napoli
Trojano Vito, Bari
Viora Elsa, Torino
Editorial Staff
Roberto Zerbinati
Serena Zerbinati
Management, Administrative office
Partner-Graf Srl - Via F. Ferrucci, 73 - 59100 Prato
Tel 0574 527949 - Fax 0574 636250
E-mail: [email protected]
The Italian Journal of Gynaecology & Obstetrics is a digital magazine.
You can download it freely from
www.italianjournalofgynaecologyandobstetrics.com or
www.italianjog.com
It. J. Gynaecol. Obstet.
2016, 28: N.2
Table of contents
5
Editorial.
Oncofertility: a new medical discipline
7
Magnetic Resonance guided Focused ultrasound in uterine fibroids treatment:
a cost analysis
9
Lymphoplasmacytic lymphoma or Plasmacytoma of the Ovary? A case report
and a literature Review
17
Paolo Scollo
Federica Romano, Sabrina Livolsi, Sarah Tardino, Francesca Ganguzza, Silvia Coretti,
Matteo Ruggeri, Americo Cicchetti, Massimo Midiri, Adelmo Grimaldi, Paolo Scollo
Tiziana Tomaselli, Drusilla Rollo, Francesco Tarsitano, Rosangela Trezzi, Claudio Crescini
Correlation between Amniotic Fluid Index at Admission and Intrapartum Foetal
Wellbeing in Women with Pre-labour Rupture of membranes at Term
21
Leiomyosarcoma of the vulva: a case report and review of the literature
29
Terrorism and the male to female ratio at birth: “Anni di Piombo” in Italy
32
Management of adnexal masses during the third trimester of pregnancy: a case
report in twin-pregnancy and review of the literature
36
Laparoscopic treatment of Interstitial Ectopic Pregnancy: a Case Report
41
Transient osteoporosis and pathological fractures in pregnancy and puerperium:
a case report and review of literature
45
The timing of elective caesarean delivery at term in Lombardy: a comparison of
2010 and 2014
48
Centiles of weight at term birth according to maternal nationality in a Northern
Italian region
52
Altered lamin A expression as a possible prognostic biomarker in endometrioid
endometrial cancers
57
Ashwini Mallesara, Pralhad Kushtagi
Giuseppe Comerci, Venelia Picarelli, Emilia Crisanti, Giandomenico Raulli
Victor Grech, Julian Mamo
Luciana Cacciottola, Eugenio Solima,Giuseppe Trojano, Marzia Montesano, Mauro Busacca,
Michele Vignali
Marta Mancini, Francesco Cassanelli, Nicola Santomarco, Matteo Collamarini, Arianna Olivieri,
Emilio Piccione, Michelangelo Boninfante
Guido Formelli, Giorgio Scagliarini,Mauro Girolami, Giuseppe Mignani
Giuseppe Trojano, Michele Vignali, Mauro Busacca, Sonia Cipriani, Giovanna Esposito,
Camilla Bulfoni, Fabio Parazzini
Fabio Parazzini, Sonia Cipriani, Giuseppe Bulfoni, Paola Agnese Mauri, Giorgia Carraro,
Salvatore Andrea Mastrolia, Mauro Busacca, Giuseppe Trojano
Lucia Cicchillitti, Giacomo Corrado, Mariantonia Carosi, Rossella Loria, Malgorzata Ewa Dabrowska,
Giuseppe Trojano, Emanuela Mancini, Giuseppe Cutillo, Rita Falcioni, Giulia Piaggio, Enrico Vizza
5
Editorial
Oncofertility: a new medical discipline
Paolo Scollo
In recent years vast progress has been made in the treatment of oncological diseases. Today the 5
year survival rate is estimated to be approximately 65% and for some cancers (lymphomas and breast
cancer) more than 85%. This data clearly reveals that oncologists can no longer limit medical care
within the realm of patient survival but forces them to take responsibility of patients’ quality of life
carefully considering future prospects and the possibility of having children. The topic of fertility and
procreation is increasingly gaining a voice in the field of oncology, not only due to the abovementioned
improvement of the prospects towards healing but also as a result of the decrease in age of the onset
of certain cancers and the average age at first pregnancy which have led to a rise in the number of
women of childbearing age developing a disease before completing the reproductive path. With easy
and regular access to information as well as a greater awareness of being able to play an active role
in the care, more and more women are seeking informed and explicitly demanding to address issues
related to fertility and procreation.
As a result, the emergence of a new medical discipline arose combining oncology and reproductive
medicine: Oncofertility. Specialists in oncologic gynecology with specific expertise in the field of
infertility treatment and medically assisted procreation, deals with all issues related to fertility and
procreation in oncology: fertility preservation, seeking pregnancy after cancer and cancer during
pregnancy.
ASCO (American Society of Clinical Oncology) provides recommendations on fertility preservation
for cancer patients, highlighting the importance of discussing the risks of infertility with patients of
childbearing age referring them to a specialist in order to evaluate the possibility of fertility preservation.
Bringing the issue of fertility at diagnosis allows the patient to have the time to reflect, gather information
and decide whether to undergo fertility preservation treatment. This choice should be offered to all
women of childbearing age, regardless of the treatment they will undergo, and their procreative history.
Fertility is in fact part of every young woman’s life, no matter what her maternity projects are. It is a
resource that the patients may not be able to use during cancer. It is comforting and reassuring for many
women knowing that they will be able to take up this issue once treatment ends (of course, with the use
of their cryopreserved gametes or otherwise).
At diagnosis the doctor should offer patients the opportunity and time to reflect on their reproductive
health and fertility treatment options by providing them with the tools to make informed decisions
which patients deem appropriate. The first wave of information on the issue of fertility should be
generic, inviting patients to consider issues on fertility and procreation as well as providing patients
with the option on whether to obtain specific information via a referral to a fertility specialist. Such
information should be accompanied by a structured support pathway, providing a decision-making aid
and a clear understanding of the potential benefits and risks of fertility preservation methods available
today.
Prof. Paolo Scollo
S.I.G.O. President
7
V
E
M
ICA
UT
E
IA
C
G
A
O
FARM INECOL
IN G
LA NATURA CHE AIUTA
ClimaMEV
IncontinenzaMEV
VenaMEV
FARMACEUTICA MEV - Strada Cassia Sud, 175 - 53100 Siena (SI)
Tel. 0577 378091/ Fax 0577 379970 - www.farmaceutica-mev.it
Italian Journal of
Gynaecology & Obstetrics
Magnetic Resonance guided Focused ultrasound in uterine fibroids
treatment: a cost analysis
Federica Romano 1, Sabrina Livolsi 1, Sarah Tardino 2, Francesca Ganguzza 2, Silvia Coretti 4,
Matteo Ruggeri 4, Americo Cicchetti 4, Massimo Midiri 2,3, Adelmo Grimaldi 1,3, Paolo Scollo 5
LATO HSR Giglio, Cefalù, Palermo, Italy.
Fondazione Istituto “San Raffaele - G. Giglio”, Cefalù, Palermo, Italy.
3
University of Palermo, Palermo, Italy.
4
Catholic University of the Sacred Heart, Rome, Italy.
5
Cannizzaro Hospital Catania, Italy.
1
2
ABSTRACT
Introduction: uterine fibroids are the most common
benign tumors of reproductive-age women. Different
treatment options exist such as myomectomy,
isterectomy, drugs and uterine artery embolization
(UAE). Recently, technological progress provides noninvasive and conservative treatments such as MRgFUS
(Magnetic Resonance-guided Focused Ultrasound
Surgery).
Objective: the aim of this study was to estimate the
mean cost per treatment with MRgFUS.
Methods: cost analysis was performed from the
hospital perspective. Total costs were considered. They
were defined as the sum of fixed costs (equipment
and maintenance costs) and variable costs (personnel,
materials and drugs costs). A deterministic approach
was followed assuming that all patients require an
equal resources utilization. The average materials
and drugs consumption was quantified by reviewing
medical records of patients treated and through experts’
opinion. Cost data were provided by the hospital
accounting office.
Results: the mean cost of a single treatment with
MRgFUS was equal to € 2.101,85, lower than the DRG
tariffs paid for alternative treatments.
Conclusions: the MRgFUS could be an evaluable
alternative to standard techniques, as it would allow an
immediate improvement in patients’ quality of life and
cost savings for the hospital as well as for healthcare
system.
SOMMARIO
Introduzione: i fibromi uterini costituiscono la forma
più diffusa di tumore benigno nelle donne in età
fertile. Esistono diverse opzioni di trattamento quali
miomectomia, isterectomia, trattamenti farmacologici
ed embolizzazione dell’arteria uterina. Negli ultimi
anni il progresso scientifico punta sempre di più all’uso
di tecniche sempre meno invasive e più conservative
tra le quali l’MRgFUS (Magnetic Resonance-guided
Focused Ultrasound Surgery).
Obiettivo: stimare il costo medio di un singolo
trattamento tramite MRgFUS.
Metodi: la valorizzazione delle risorse utilizzate è
stata effettuata secondo la prospettiva dell’ospedale.
Sono stati considerati i costi totali definiti come somma
dei costi fissi (costo delle apparecchiature e delle
manutenzioni) e dei costi variabili (costo del personale,
dei materiali e dei farmaci). È stato seguito un approccio
deterministico ipotizzando che tutti i soggetti trattati
comportino un uguale uso di risorse. Il consumo medio
di materiali e farmaci è stato quantificato mediante
l’opinione di personale medico. I dati di costo sono stati
forniti dall’ufficio contabilità e bilancio dell’ospedale.
Risultati: il costo medio di un trattamento con MRgFUS
pari € 2.101,85 risulta inferiore alle tariffe previste dai
DRG per i trattamenti alternativi.
Conclusioni: l’MRgFUS potrebbe essere una
valida alternativa alle tecniche standard, in quanto
permetterebbe un miglioramento immediato della
qualità di vita delle pazienti e un possibile risparmio di
costi per il sistema sanitario.
Keywords: MRgFUS, uterine fibroids, costs, cost
analysis.
Correspondence to: [email protected]
Copyright 2015, Partner-Graf srl, Prato
DOI: 10.14660/2385-0868-35
9
2016, 28: N.2
INTRODUCTION
10
Magnetic Resonance guided Focused ultrasound in uterine fibroids treatment: a cost analysis
Uterine fibroids are the most common benign
tumors in women in reproductive-age. In
Italy, the diagnosed fibroids prevalence equals
23.6% (1). Common symptoms are abnormal
vaginal bleeding, abdominal pressure, urinary
or bowel discomfort, back pain and reproductive
dysfunction. Diagnosis is based on clinical signs
and gynecological examination which allows
evaluating the increase in uterine volume,
the degree of mobility and the possible site of
myomatous nodule.
Diagnostic imaging allows a precise
determination of fibroids’ location and number.
In addition, ultrasound examination usually
provides all the necessary information to
therapeutic planning, but magnetic resonance
imaging (MRI) is necessary in particular cases.
MRI, although more expensive than ultrasound
examination, is more sensitive, less operatordependent and very precise in both location of
fibroids and identification of stalked fibroids. MRI
allows the diagnosis and the study of other pelvic
pathologies, such as adenomyosis, which could
modify treatment strategies and increase surgical
risk(2). Imaging, therefore, is essential to confirm
or rule out the diagnosis and to select the most
appropriate and effective therapeutic strategy.
Treatment options for symptomatic uterine
fibroids include conservative (myomectomy)
or radical (hysterectomy) surgery, drugs and
uterine artery embolization (UAE). In recent
years, the MRgFUS (Magnetic ResonanceGuided Ultrasound Surgery), a new non-invasive
technique in the treatment of uterine fibroids, is
emerging at a local and international level. This
technique is based on the application of a focused
ultrasound surgery (FUS) under real-time MRI
guidance and control(3). Treatment is performed
transcutaneously in a state of conscious sedation
in order to have a constant feedback from the
patient during the procedure. The FUS produces
coagulative necrosis in a precise focal point
(sonication) through a rapid increase of local
temperature (60-80 °C) with a fibroid volume
reduction relieving from the pathology associated
symptoms(3). The innovation consists in the ability
to monitor in real time the temperature variations
of trading volumes and tissues crossed by the ultra
sound. MR images are acquired before, during
and after the session. Information from images
are essential to plan treatment, to identify target
volumes, to monitor in real time the evolution
of the temperature and to find the exact point of
ablation and distribution of the thermal dose.
In 2004, the United States Food and Drug
Administration (FDA) approved the MRgFUS(4),
which obtained CE mark in 2007 and was
recommended in United Kingdom (UK) by
NICE (National Institute for Clinical Excellence)
for uterine fibroids treatment in 2011. In Italy,
the technique is being tested in five specialized
centers such as Niguarda Ca’ Granda Hospital in
Milan, Umberto I University Hospital in Rome,
San Salvatore Hospital in L’Aquila, San Raffaele
G. Giglio Hospital in Cefalù and P. Giaccone
University Hospital in Palermo. The adoption
of a new technology in healthcare is the result
of a complex process that involves researchers,
citizens, public institutions and industry. In
recent decades, the widespread of highly costly
innovative technologies and the increasing costs
of research and development have been raising
questions about the financial sustainability of
healthcare systems. The major challenge for
decision makers is to face potentially unlimited
healthcare needs relying on limited resources
availability. Therefore, it is essential to balance
the need for a fair acknowledgement of the value
of new technologies, on the one hand, and the
request for costs containment on the other hand.
Currently, a few studies have investigated the
cost-effectiveness of MRgFUS versus the standard
practice, showing that MRgFUS therapy results as
a dominant strategy being characterized by lower
costs and higher benefits. Results from a study
conducted in the UK(5) show that MRgFUS is costsaving compared to the alternative treatments,
yielding an average saving of about £295 per
patient. Taking into account indirect costs, savings
rise to more than £500 for each woman treated.
A significant increase in benefits for patients in
terms of QALYs (Quality Adjusted Life Years)
is associated with this cost saving. In the U.S.
study conducted by O’Sullivan et al. in 2009(6), the
annual cost of uterine fibroids has been estimated
at $2.2 billion and the MRgFUS proves to be a costeffective technology.
Scientific evidence currently available suggests
that MRgFUS exibits equal or superior efficacy
than alternative treatments, in addition to relevant
advantages of allowing rapid symptoms remission
and being mini invasive technique. However,
being an innovative technology not yet codified in
any Regional Health Care Range of Fees, MRgFUS
needs a careful evaluation of costs and benefits,
in order to encourage rational and well-informed
decisions. At the moment, there are no studies and
cost analyses of MRgFUS in Italy.
Given this background, the aim of this study
was to conduct a cost analysis in order to provide
information on costs and potential savings
associated with fibroids MRgFUS treatment in the
Italian context.
MATERIALS AND METHODS
The cost analysis was performed from a
hospital perspective and resource consumption
was quantified taking into account costs actually
incurred by the health facility. Data on treatment
time and drugs consumption were derived from
medical records of patients treated. Disposables
consumption has been identified and quantified
through experts’ opinion. Cost data were provided
by the accounting office of San Raffaele Giglio
hospital in Cefalù, Sicily. Total costs defined as the
sum of fixed costs (equipment and maintenance)
and variable costs (staff, supplies and drugs)
were considered in the analysis. A deterministic
approach was followed, assuming that costs are
not patient-specific but equal for all patients,
that is, all patients give rise to the same resource
use. The equipment cost was the most relevant
item among fixed costs. San Raffaele-Giglio
Hospital utilizes the ExAblate 2100 system, by
InSightec company. The ExAblate system consists
of a patient mobile table and an emission and
conduction system of ultrasound beam placed
inside a last generation magnetic resonance
(MR) GE Sigma HDtx. A workstation is used for
planning and remote execution of treatment from
the control room. Moreover, an emergency button
inside can be used by the patient to report any
problems during the treatment session.
In order to compute the equipment cost per
procedure, the number of treatments potentially
feasible in one year was calculated by keeping
in account work shifts, department logistic and
needs and the annual depreciation rate was first
calculated for the dedicated equipment, assuming
that these devices have an average life cycle of
8 years. Since the MRgFUS system includes an
ultrasound ExAblate 2100 and a MR GE Sigma
HDTX, the depreciation for the two technologies
was calculated separately. The depreciation rate
per procedure for the device totally dedicated to
MRgFUS treatment (ExAblate 20100) was obtained
by dividing the annual depreciation rate by the
number of procedures potentially feasible each
year. With regard to the non-dedicated equipment
(MR), the annual depreciation rate was divided
by the total number of hours of equipment use
so that the rate allocated to MRgFUS session
F. Romano et al.
was calculated on the basis of the number of
hours devoted to MRgFUS treatments. The cost
of maintenance per procedure was estimated
through the same method.
Staff costs refer to the cost of professional
figures involved in the treatment of uterine fibroids
with MRgFUS: radiologist, anesthesiologist, health
physicist, nurse and radiology technician. For
every unit of staff, costs were calculated based on
their hourly wage (including direct and indirect
charges), obtaining €49/h for the radiologist,
€45/h for the anesthesiologist, €37,66/h for health
physicist, €23,39/h for the nurse, €27,84/h for
the radiology technician. The resulting hourly
cost was then multiplied by the mean treatment
time for each staff unit, as estimated on the basis
of experience and evidences. As a result, the
cost of each professional profile and overall staff
cost was obtained. The duration of treatment of
uterine fibroids with MRgFUS varies between 3
and 6 hours and depends mainly on the size of
the fibroids and subjective parameters such as the
threshold of tolerance of pain or the anxiety of the
patient. For the purpose of this study an average
duration of 4 hours per treatment was assumed,
including the phase of preparation of the patient
before surgery and discharge procedures.
Supply costs included all the materials used
for each procedure (from patient positioning to
discharge) and therefore included anesthetic drugs,
medical contrast mediums, dressing materials and
other disposable items (gloves, coats, syringes,
catheters and disposable kits). Dosage of drugs
administered during the treatment was quantified
by consulting medical records of the patients
treated and through experts’ opinion. Data on
anesthetic drugs consumption were derived from
medical records of patients previously treated,
and the average consumption was quantified
according to experts’ opinion. Drugs and
supplies cost for each treatment was obtained by
multiplying their unit cost by estimated average
consumption. Overhead expenses were assumed
equal to 20% of total costs of MRgFUS treatment.
Training cost of technical staff and follow up costs
were not considered in the analysis.
RESULTS
To evaluate the mean cost per procedure, we
considered equipment costs, staff, drugs and
supplies costs. The overall equipment costs
of € 1.854.846,20 for MRgFUS and € 2.034.000
for MR, include the cost of acquisition, as well as
maintenance and upgrades.
11
2016, 28: N.2
Table 1.
Equipment costs.
Table 3.
Supplies and drugs cost.
Table 2.
Staff cost per hour.
12
These cost items are reported in Table 1. Staff
costs refer to hospital cost per hour including
social charges (Table 2). Staff cost is a fixed cost
for the hospital, but it could be considered variable
in the current analysis since the share of cost per
procedure depends on the duration of treatment.
The cost of drugs and materials was obtained
based on the estimated average consumption for
each treatment. Supplies and drugs used are listed
in Table 3 including their average consumption
and unit costs. MRgFUS treatment requires a low
consumption of materials and drugs: only the
disposable KIT FUS is the most considerable cost
driver in this category.
Table 4.
Mean cost per treatment.
Finally, the current cost-analysis resulted in an
overall cost of € 2.101,85 for MRgFUS treatment.
The mean costs per procedure are summarized in
Table 4.
DISCUSSION
Uterine fibroids have a negative impact on
the National Health Service budget in terms of
F. Romano et al.
costs of visits, hospitalizations and treatments.
Considering the societal perspective the disease
also imposes high costs to the general population
in terms of absenteeism and productivity losses. In
a cross-sectional study conducted on 1756 women
from five European countries including Italy(1),
19.6% of Italian women reported to have been
hospitalized. Of these more than 30% received
pharmacological or surgical treatments. Uterine
fibroids are traditionally treated surgically.
Surgical approaches are usually associated with
intra operative complications such as bleeding,
deformation of the uterine cavity, risk of
emergency hysterectomy and subsequent uterine
rupture in future pregnancies(7). MRgFUS is an
innovative technology in radiology for the local
treatment of tumor lesions with the advantage
of preserving the surrounding healthy tissues.
In Italy, this procedure has not been codified yet
in any Regional Health Care Range of Fees and,
therefore, patients enrollment in clinical trials is
still limited.
The MRgFUS procedure was initially
approved by FDA for premenopausal women
with symptomatic fibroids who had no desire
for future fertility. However, a few years later,
based on the experience accrued in the field
of MRgFUS and a deeper understanding of
outcomes in pregnant women, the FDA amended
the labeling of the device recommending to take
into account desire for future pregnancy but not
to consider this as an absolute contraindication.
Women who desire further fertility can undergo
MRgFUS since 2007(8). There is some scientific
evidence on safety and efficacy of this technique
in terms of lesion reduction, remission of
symptoms and improved patients’ quality of
life(3,9-13). In particular, two studies show a 33%
volume reduction and significant symptoms
improvement six months after MRgFUS(11, 12).
Recent studies(14) on effectiveness of MRgFUS
report a percentage of non-perfused volume (NPV)
of 98%(3), 80%(15), 90%(16), 90 %(17) and 88%(18, 19). Moreover,
an average rate of NPV greater than 70% was
observed during 15 treatments carried out at
San Raffaele Giglio hospital. In addition, several
analyses(20-26) describe the effect of treatment on
fertility (when this problem is associated with
fibroids); in particular, Rabinovici et. al(27) reports
findings of an high successful pregnancies rate
after MRgFUS. Concerning re-intervention rates,
one non-randomized study reported a rate of 4%
at 6 months follow-up(13), whereas re-intervention
rates range between 5% and 10% in studies with
12 months follow-up(28, 29) and between 14% and
13
2016, 28: N.2
21.6% at month 24(30). A re-intervention rate of
15% was recorded during a study with 34 months
follow-up period(28). Kim et al.(31) reported that 69%
of patients did not need a second surgery three
years after MRgFUS, while a study conducted
in Germany(32) from 2002 to 2009 shows a reintervention rate of 66% after 60 month follow-up.
Finally, the innovative technology is associated
with fewer adverse events and complications than
the myomectomy, as well as with a reduction
of hospital stay and a rapid return to usual
activities(7, 8, 28).
As all innovative technologies, MRgFUS has
relevant costs of investment and management
against benefits previously described. In the
present work, overall costs associated with
MRgFUS treatment were quantified as the sum
of fixed costs (equipment and maintenance) and
variable costs (staff and supplies costs). The staff is
multidisciplinary and highly specialized: medical
personnel, nurses and technicians involved during
pre-treatment, treatment and follow-up phases.
Our cost analysis estimates a cost per procedure
of 2,100 Euro. An average duration of four hours
per procedure was hypothesized, although some
sources indicate a shorter duration, from two
to three hours per session(8), so that the cost per
procedure could be lower. The estimated cost per
MRgFUS procedure is lower than the Diagnosis
Related Group (DRG) tariffs used for alternative
therapies. More in detail, we can consider DRG
tariffs 354 and 355 related to intervention on uterus
and adnexa not for malignant neoplasm with or
without complications, respectively, and DRG
number 356 about female reproductive system
reconstructive procedures(33). DRG tariff 356, equal
€ 2.901, being the lowest value among three DRG
tariffs considered, but it is still higher than the cost
of MRgFUS in uterine fibroids treatment herein
estimated. Also the average value of these tariffs
(€3.415) is more than 1,000 higher than our result.
MRgFUS is a minimally invasive technique that
allows patients to avoid intraoperative and postsurgical risks, to get total symptoms remission and
to become pregnant if they are in reproductive-age.
14
This technique allows a maximization of available
resources because it can be performed in a
single session in outpatient setting. Evidence
from the literature and our cost analysis suggest
that focused ultrasound treatment results in
an improvement in symptoms and patients’
quality of life and eventually in a cost saving for
National Health Service. The use of an innovative
technology like MRgFUS is usually associated
with a lack of long-term data on efficacy and
safety. In addition, although several preclinical
studies on FUS treatments have been carried out,
this option has not yet been studied in women
with uterine fibroids within an experimental
setting. Moreover, several analyses compare
findings from women treated with uterine artery
embolization (UAE) with conventional surgical
procedures, but there are no studies that compare
MRgFUS treatment with other conventional
techniques. Even though international literature
demonstrates the cost-effectiveness of MRgFUS,
economic evaluations should be performed
also in Italy, since resource consumption data
are scarcely transferable from foreign contexts.
This would allow to develop context-specific to
comparisons of benefits and costs associated with
MRgFUS with those of standard techniques, such
as myomectomy, in order to inform decisions at
a local or hospital level. Further developments
of this research could concern long-term benefits
and costs, including in the analysis follow-up
costs (hospitalizations, visits) and indirect costs of
absenteeism and productivity losses. Finally, our
analysis is based on a small sample of patient in a
single medical center, so it would be preferable to
extend the analysis to the rest of the Italian medical
centers in order to obtain more generalizable and
representative results.
DISCLOSURE
This work was carried out as part of the project
“Proteogenomica e Bioimaging in Medicina” (DM
No. 45602) funded by MIUR (Italian Ministry of
University and Research).
REFERENCES
1) Downes E, Sikirica V, Gilabert-Estelles J, Bolge SC,
Dodd SL, Maroulis C, Subramanian D. (2010) The
burden of uterine fibroids in five European countries
Eur J Obstet Gynecol Reprod Biol. Sep;152(1):96-102.
doi: 10.1016/j.ejogrb.2010.05.012.
2) Spies J, Roth A, Gonsalves S, Murphy-Skrzyniarz
K. (2001) Ovarian function after uterine artery
embolization: assessment using serum folliclestimulating hormone assay. J Vasc Interv Radiol
12:437-442.
3) Gizzo et. Al. (2013) Magnetic resonanceguided focused ultrasound Myomectomy: Safety,
Efficacy, Subsequent Fertility and Quality of life
Improvements, A systematic Review. Reproductive
Science.
4) Manyonda IT, Gorti M. (2008) Costing magnetic
resonance-guided focused ultrasound surgery, a
new treatment for symptomatic fibroids. BJOG.
Apr;115(5):551-3. doi: 10.1111/j.1471-0528.2007.01656.x.
5) Zowall H, Cairns JA, Brewer C, Lamping DL, Gedroyc
WM, Regan L. (2008) Cost-effectiveness of magnetic
resonance guided focused ultrasound surgery for
treatment of uterine fibroids. BJOG 2008;115(5):653–
662. doi: 10.1111/j.1471-0528.2007.01657.x.
6) O’Sullivan AK, Thompson D, Chu P, Lee DW,
Stewart EA, Weinstein MC. (2009) Cost-effectiveness
of magnetic resonance guided focused ultrasound
for the treatment of uterine fibroids. Int J Technol
Assess Health Care 25(1):14–25. doi: 10.1017/
S0266462309090035.
7) Griffiths A, D’Angelo A, Amso N. (2006) Surgical
treatment of fibroids for s ubfertility. Cochrane
Database Syst Rev. Jul 19;(3):CD003857.
8) Al Hilli MM, Stewart EA. (2010) Magnetic resonanceguided focused ultrasound surgery. Semin Reprod
Med. May;28(3):242-9. doi: 10.1055/s-0030-1251481.
9) Stewart E, Rabinovici J, Tempany C, Inbar Y, Regan
L, Gastout B, et al. (2006) Clinical outcomes of focused
ultrasound surgery for the treatment of uterine
fibroids. Fertil Steril 85:22–9.
10) Harding G, Coyne KS, Thompson CL, Spies JB. (2008)
The responsiveness of the uterine fibroid symptom
and health-related quality of life questionnaire
(UFS-QOL). Health Qual Life Outcomes 12;6:99. doi:
10.1186/1477-7525-6-99.
11) Morita Y, Ito N, Hikida H, Takeuchi S, Nakamura
K, Ohashi H. ( 2007) Non-invasive magnetic resonance
imaging-guided focused ultrasound treatment for
uterine fibroids – early experience. Eur J Obstet
Gynecol Reprod Biol. 139(2):199-203.
12) Fukunishi H., Funaki K, Sawada K, Yamaguchi
K, Maeda T, Kaji Y. (2008) Early Results of Magnetic
Resonance–guided Focused Ultrasound Surgery of
Adenomyosis: Analysis of 20 Cases. J Minim Invasive
Gynecol. 2008 Sep-Oct;15(5):571-9. doi: 10.1016/j.
jmig.2008.06.010.
13) Taran F.A. C.M.C.Tempany, L.Regan, Y.Inbar,
A.Revel, E.A.Stewart (2009) Magnetic resonanceguided focused ultrasound (MRgFUS) compared
with abdominal hysterectomy for treatment of
F. Romano et al.
uterine leiomyomas. Ultrasound Obstet Gynecol.
Nov;34(5):572-8. doi: 10.1002/uog.7435.
14) Stewart EA, Gostout B, Rabinovici J, Kim HS, Regan
L, Tempany CM. (2007) Sustained Relief of Leiomyoma
Symptoms by Using Focused Ultrasound Surgery,
Obstetrics & Gynecology 110(2):279-287.
15) de Melo FC, Diacoyannis L, Moll A, TovarMoll F. (2009) Reduction by 98% in uterine myoma
volume associated with signficant symptom relief
after peropheral treatment with magnetic resonance
imaging-guided focused ultrasound surgery. J
Minim Invasive Gynecol. 16(4): 501-503. doi: 10.1016/j.
jmig.2009.04.007.
16) Kim KA, Yoon SW, Yoon BS, Park CT, Kim SH,
Lee JT. (2011) Spontaneous vaginal expulsion of
uterine myoma after magnetic resonance-guided
focused ultrasound surgery. J Minim Invasive Gynecol.
18(1):131-4. doi: 10.1016/j.jmig.2010.09.015.
17) Zaher S, Lyons D, Regan L. (2010) Uncomplicated
term vaginal delivery following magnetic resonanceguided focused ultrasound surgery for uterine
fibroids. Biomed Imaging Interv J. 6(2). doi: 10.2349/
biij.6.2.e28.
18) Zaher S, Lyons D, Regan L. J (2011) Successful in
vitro fertilization pregnancy following magnetic
resonance-guided focused ultrasound surgery for
uterine fibroids. Obstet Gynaecol Res. Apr;37(4):370-3.
doi: 10.1111/j.1447-0756.2010.01344.x.
19) Trumm CG, Stahl R, Clevert DA, Herzog P, Mindjuk
I, Kornprobst S, Schwarz C, Hoffmann RT, Reiser
MF, Matzko M (2013) Magnetic resonance imagingguided focused ultrasound treatment of symptomatic
uterine fibroids: impact of technology advancement
on ablation volumes in 115 patients. Invest Radiol.
Jun;48(6):359-65. doi: 10.1097/RLI.0b013e3182806904.
20) Desai SB, Patil AA, Nikam R, Desai AS, Bachhav
V. (2012) Magnetic Resonance-guided Focused
Ultrasound Treatment for Uterine Fibroids: First
Study in Indian Women. J Clin Imaging Sci. 2:74. doi:
10.4103/2156-7514.104307.
21) Millan Cantero H, Suárez J, Garcia E, Gomez E.
(2011) First three cases in Spain of term pregnancy
after treatment of uterine fibroid with non-invasive
MRgFUS surgery, Caso clinico, Prog Obstet Ginecol.
54(11): 601-4.
22) Bouwsma EVA, Gorny K, Hesley G, Jensen JR,
Peterson LG, Stewart EA. (2011) Magnetic Resonanceguided Focused Ultrasound Surgery for Leiomyomaassociated Infertility, Fertil Steril.96(1):e9-e12. doi:
10.1016/j.fertnstert.2011.04.056.
23) Yoon SW, Kim KA, Kim SH, Ha DH, Lee C, Lee
SY, Jung SG, Kim SJ. (2010) Pregnancy and Natural
Delivery Following Magnetic Resonance ImagingGuided Focused Ultrasound Surgery of Uterine
Myomas Yonsei Med J. 51(3):451-3. doi: 10.3349/
ymj.2010.51.3.451
24) Hanstede MF, Tempany MC, Stewart EA.
(2007) Focused Ultrasound Surgery of Intramural
Leiomyomas May Facilitate Fertility: A Case Report,
Fertil Steril. 88(2):497.
15
2016, 28: N.2
25) Okada A, Morita Y, Fukunishi H, Takeichi K,
Murakami T. (2009) Non-invasive Magnetic Resonanceguided Focused Ultrasound Treatment of Uterine
Fibroids in a Large Japanese Population: Impact of
the Learning Curve on Patient Outcome, Ultrasound
Obstet Gynecol, 34:579-583. doi: 0.1002/uog.7454
26) Gavrilova-Jordan LP, Rose CH, Traynor KD, Brost
BC, Gostout BS. (2007) Successful Term Pregnancy
Following MR-guided Focused Ultrasound Treatment
of Uterine Leiomyoma, Journal of Perinatology,
27:59-61.
27) Rabinovici J, Inbar Y, Eylon-Cohen S, Schiff E,
Hananel A, Freundlich D. (2006) Pregnancy and
live Birth after Focused Ultrasound Surgery for
Symptomatic Focal Adenomyosis: A Case Report,
Hum Reprod. 21(5):1255-9.
28) Gorny KR, Woodrum DA, Brown DL et al. (2011)
Magnetic resonance-guided focused ultrasound of
uterine leiomyomas: review of a 12-month outcome
of 130 clinical patients. Journal of Vascular and
Interventional Radiology 22: 857–64. doi: 10.1016/j.
jvir.2011.01.458.
29) LeBlang SD, Hoctor K, Steinberg FL. (2010)
Leiomyoma shrinkage after MRI-guided focused
ultrasound treatment: report of 80 patients. American
16
Journal of Roentgenology 194: 274–80. doi: 10.2214/
AJR.09.2842.
30) Funaki K, Fukunishi H, Sawada K. (2009) Clinical
outcomes of magnetic resonance-guided focused
ultrasound surgery for uterine myomas: 24-month
follow-up. Ultrasound Obstet Gynecol 34(5):584–9. doi:
10.1002/uog.7455.
31) Kim HS, Baik JH, Pham LD, Jacobs MA. (2011) MRguided high-intensity focused ultra-sound treatment
for symptomatic uterine leiomyomata: long-term
outcomes. Acad Radiol 18(8):970–6. doi: 10.1016/j.
acra.2011.03.008.
32) Froeling V, Meckelburg K, Schreiter NF, ScheurigMuenkler C, Kamp J, Maurer MH, Beck A, Hamm
B, Kroencke TJ. (2013) Outcome of uterine artery
embolization versus MR-guided high-intensity
focused ultrasound treatment for uterine fibroids:
Long-term results. Eur J Radiol. 82(12):2265-9. doi:
10.1016/j.ejrad.2013.08.045.
33) Ministero della Salute Decreto 18 ottobre 2012.
Allegato 1. Remunerazione prestazioni di assistenza
ospedaliera per acuti, assistenza ospedaliera di
riabilitazione e di lungodegenza post acuzie e di
assistenza specialistica ambulatoriale.
Italian Journal of
Lymphoplasmacytic lymphoma or Plasmacytoma of the Ovary?
A case report and a literature Review
Tiziana Tomaselli 1, Drusilla Rollo 1, Francesco Tarsitano 1, Rosangela Trezzi 2, Claudio Crescini 1
1
2
Department of Gynecology and Obstetrics, ASST Bergamo Ovest, Treviglio, Italy.
Department of Pathology, ASST Papa Giovanni XXIII, Bergamo, Italy.
ABSTRACT
Extramedullary plasmacytoma (EMP) are rare
neoplasms, most commonly occurring in the upper
respiratory tract and rarely arise in the ovary. A 46-yearold woman presented with a history of abdominal
mass associated with acute episodes of pain. A mobile
abdomino-pelvic mass measuring 13.6 x 8.8 cm arising
from the right adnexa. The patient subsequently
underwent an exploratory laparotomy. We report the
nine such case ever identified in the literature. These
tumors are usually large at the time of presentation,
more likely involving the left ovary and usually without
evidence of disseminated disease. Adjuvant treatment
for ovarian plasmacytomas is not clearly established;
however, if complete surgical resection is achieved and
no evidence of multiple myeloma is found, observation
should be strongly considered.
Keywords: extramedullary plasmacytoma, neoplasms,
lymphoplasmacytic.
INTRODUCTION
Extramedullary plasmacytoma (EMP) are rare
neoplasms, most commonly occurring in the upper
respiratory tract and rarely arise in the ovary.
Review of the literature reveals nine previously
reported cases of ovarian plasmacytomas.
Lymphoplasmacytic lymphoma is an indolent
B cell lymphoma commonly with bone marrow
and lymphonode involvement. Extranodal
involvement si rare, and in the ovary extreamly
rare(1). Unfortunately, there has been no consistent
immunologic evaluation of such specimens
nor has systematic workup or follow-up been
discussed.
DOI: 10.14660/2385-0868-36
SOMMARIO
Il plasmocitoma extramidollare (EMP) è una rara
neoplasia, insorge più comunemente a livello delle vie
respiratorie alte e più raramente a livello ovarico. Una
donna di 46 anni si è presentata alla nostra attenzione
con una storia di massa addominale associata a episodi
acuti di dolore. Una massa addomino-pelvica delle
misura 13,6 x 8,8 cm a carico dell’annesso di destra.
La paziente successivamente è stata sottoposta a
laparotomia esplorativa. Riportiamo di seguito il nono
caso di questo tipo di tumore mai descritto in letteratura.
Questi tumori sono solitamente di grandi dimensioni al
momento della diagnosi, più spesso a carico dell’ovaio
di sinistra e di solito senza evidenza di malattia
disseminata. Non è chiaro il ruolo di un trattamento
adiuvante per i plasmocitomi ovarici. Tuttavia, se si
raggiunge la resezione chirurgica completa e non vi è
nessuna evidenza di mieloma multiplo, dovrebbe essere
fortemente considerata un condotta di osservazione.
CASE REPORT
A 46-year-old woman presented with a history
of abdominal mass associated with acute episodes
of pain.
On vaginal and rectal examination, the uterus
and cervix felt normal. A mobile abdominopelvic mass measuring 13.6 x 8.8 cm arising
from the right adnexa. There was tenderness
during examination. Bilateral parametria were
supple and rectal mucosa was free. Except for a
haemoglobin level of 10.3 g/dl, the remainder
of the haemogram, serum biochemistry, chest
X-ray, serum anti-HbsAg and HCV levels were
normal. Serum cancer antigen Ca125: 25.2 U/ml;
Ca15.3: 35.8 U/ml; Ca19.9: 6.1 U/ml, CEA: 0.4
ng/ml. An ultrasound revealed the presence of
heterogeneous mass measuring 13,6x8,8 cm with
17
2016, 28: N.2
Lymphoplasmacytic lymphoma or Plasmacytoma of the Ovary? A case report and a literature Review
multiple septa. A CT scan of the abdomen showed
a large pelvic mass measuring 12x12x14 cm arising
from the right adnexa with a solid area measuring
8 cm. No ascites and others localitations.
The patient subsequently underwent an
exploratory laparotomy. During surgery a
complete adhesiolysis of pelvic adhesion was
made. A very vascular right ovarian mass
measuring 15x14x10 cm, with solid cystic areas
adherent to the uterus and the sigma rectum, was
seen. The cervix, appendix, omentum, and upper
abdominal viscerae were normal. Left tube and
ovary and right tube were removed previously.
Bulky nodes were not palpable along the paraaortic
and iliac regions. An intraoperative frozen section
revealed the presence of poorly differentiated
neoplasm carcinoma. An extrafascial hysterectomy
with oophorectomy was performed. No residual
tumor. Blood loss was 900 ml. She was submitted
to blood transfusion and was discharged on the
eighth post-operative day. Post-operative PET was
negative, conversely CT scan showed millimetric
peritoneal nodules. The patient was referred to
the haematological oncology service and was
evaluated by the multiple myeloma program to
stage her plasma cell dyscrasia (complete blood
count, serum protein electrophoresis, serum
immunofixation, urine immunofixation and urine
protein electrophoresis). She also underwent
a bone marrow aspirate and biopsy with 10%
plasma cells. In view of the limited anatomical
disease in our case, the patient is receiving
follow-up care and there wasn’t any evidence of
recurrence clinically in the last 16 months. Medical
scans in the follow up included a CT chest,
abdomen and pelvis and abdominal ultrasound.
The Adjuvant treatment is not clearly established;
however, if complete surgical resection is achieved
and no evidence of multiple myeloma is found,
observation should be strongly considered(2).
PATHOLOGY
The isthological examination reveald a
diffuse ovarian infiltrate composed by clonal
well differentiated plasmacells . The neoplastic
population was CD138 positive and CD20
negative, with clonal expression of Lambda ligth
chain (Figure 1).
It requested a second opinion on slides reading.
18
Figure 1.
Sheets of plasmablasts.
DISCUSSION
EMP is a rare primary soft tissue plasma cell
tumor. These tumors are known to originate
in a variety of anatomical sites, although more
than 90% have been reported as developing in
the head or neck area, and most of these arise in
the upper respiratory passages. EMP constitute
fewer than 5% of all plasma cell tumors, generally
remain localized, and are more responsive to
therapy(2-10). Voegt initially reported a case of
ovarian plasmacytoma in 1938; he described
the tumor as the size of a fist(11). Since that
time, eight other cases, have been reported(12-16)
(Table 1). Review of the reported cases reveals
inconsistent evaluations; review of the literature
reveals that in the early years the principal form
of treatment of EMP was surgery for accessible
lesions. However, the current treatment of choice
is radiotherapy for localized disease(2,5,8,10,17,18). The
median survival of patients with EMP is reported
to vary from 4-10 years(2,17,18). Only one experience
exists regarding adjuvant postsurgical therapy
for patient with extramedullary plasmacytoma
of the ovary. Shakuntala et al. reported a patient
start three cycles of single agent carboplatin for
rapidly refilling ascites and pleural effusion(19).
In summary, extramedullary plasmacytomas
is an exceedingly uncommon tumor, especially
with solitary involvement of the ovary. We
report the nine such case ever identified in the
literature. These tumors are usually large at
the time of presentation, more likely involving
the left ovary and usually without evidence of
disseminated disease. Adjuvant treatment for
ovarian plasmacytomas is not clearly established;
however, if complete surgical resection is achieved
and no evidence of multiple myeloma is found,
observation should be strongly considered(2).
A clonal plasma cell proliferation can
be the expression of a plasmacitoma or a
lymphoplasmocytic lymphoma with an extreme
plasma cells differentiation.
This case propose the differential diagnoses
between this two entities. Although the CD20
negativity the patient has also a nodal envolvement
so the clinical data suggested the final diagnosis of
B lymphoma.
Primary lymphoma of ovary is rare and can be
of Burkitt’s, T or B cell types.
Lymphomas secondarily involving ovary are
seen in up to 25% of advanced cases. Majority of
cases will have concomitant lymphadenopathy.
Grossly, the ovarian surface is smooth and
parenchymal involvement can be partial or
complete. Bi-laterality is encountered in 60%
of cases. Burkitt, diffuse large B cell, follicular
T. Tomaselli et al.
lymphoma, plasmacytoma, Hodgkin lymphoma
and many others were reported(20) (Table 1).
Written informed consent was obtained from
the patient for publication of this Case Report and
any accompanying images.
The author(s) declare that they have no
competing interests. All authors deny any financial
and personal relationships with other people or
organizations that could inappropriately influence
their work and affirm that the manuscript has
not been published previously and is not being
considered concurrently by another publication.
Table 1.
Clinical characteristics, pathologic variables, Ca125 and outcome for
the nine reported cases of ovarian plasmacytoma.
19
2016, 28: N.2
REFERENCES
1) A. Albawardi, A. Casella, S.S. Almarzooq:
Lymphoplasmacytic lymphoma-Waldenström
macroglobulinemia: an unusual presentation in
ovaries, fallopian tubes and uterine cervix. Int J Clin
Exp Med. 2013; 6(5): 346–350.
2) Emery JD, Kennedy AW, et al: Plasmacytoma of the
ovary: a case report and literature review. Gynecol
Oncol 73: 151-154, 1999
3) Dolin S, Dewar JP: Extramedullary plasmacytoma.
Am J Pathol 32:83-103, 1956
4) Batsakis JG, Fried GT, Goldman RT, Karlsberg
RC: Upper respiratory tract plasmacytoma. Arch
Otolaryngol 79:613-618,1964
5) Poole AG, Marchetta FC: Extramedullary
plasmacytoma of the head and neck. Cancer
22:14-21,1968
6) Castro EB, Lewis JS, Strong EW: Plasmacytoma of
paranasal sinuses and nasal cavity. Arch Otolaryngol
97:326-329,1973
7) Webb HE, Harrison EG, Masson JK, Remine WH:
Solitary extramedullary myeloma (plasmacytoma)
of the upper part of the respiratory tract and airway.
Cancer 15:1142-1155, 1962
8) Wiltshaw E: The natural history of extramedullary
plasmacytoma and its relation to solitary myeloma of
bone and myelomatosis. Medicine 55:217-237,1976
9) Woodruff RK, Whittle JM, Malpas JS: Solitary
plasmacytoma. I. Extramedullary soft tissue
plasmacytoma of bone. Cancer 43: 2344-22347, 1979
10) Knowling MA, Harwood AR, Bergsagel DE:
Comparison of etramedullary plasmacytomas with
20
solitary and multiple plasma cell tumors of bone. J
Clin Oncol 1:255-262,1983
11) Voeget H. Extramedullari plasmacytoma: Virchows
Arch (Pathol Anat) 302:497-508,1938
12) Bambirra EA, Miranda D, Magalhaes GMC: Plasma
cell myeloma simulating Krukenberg’s tumor. South
Med J 75:511-512,1982
13) Hautzer NW: Primary plasmacytoma of ovary.
Gynecol Oncol 18:115-118, 1984
14) Talerman A: Nonspecific tumors of the ovary,
including mesenchymal tumors and malignant
lymphoma. In Kurman RJ (ed): Blaustein’s pathology
of the female genital tract, 3rd ed, New York, SpringerVerlag, 1987, p738
15) CooK HT, Boylston AW: Plasmacitoma of the ovary.
Gynecol Oncol 29: 378-381, 1988
16) Andze G, Pagbe JJ, Tchokoteu PF, et al: Le
plasmacytome solitaire extraosseux ovarien. J Chir
130:137-140, 1993
17) Mayr NA, Wen BC, Hussey DH, et al: The role
of radiation therapy in the treatment of solitary
plasmacytomas. Radiother Oncol 17: 293-303, 1990
18) Wasserman TH: Diagnosis and management of
plasmacytomas. Oncology 1(2): 37-41,1987
19) Shakuntala PN, Praveen SR, Shankaranand B, et al:
A rare case of plasmacytoma of the ovary: a case report
and literature review. Ecancer 2013, 7:288
20) Shacham-AbulafiaA. Nagar R et al. Lymphoma of
hte ovary: case report and review of the literature. Acta
Heam 2012;129:169-174
Italian Journal of
Correlation between Amniotic Fluid Index at Admission and
Intrapartum Foetal Wellbeing in Women with Pre-labour Rupture of
membranes at Term
Ashwini Mallesara 1, Pralhad Kushtagi 1
Department of Obstetrics and Gynecology, Kasturba Medical College (A Constituent of Manipal
University), Mangaluru 575001, India.
1
ABSTRACT
Objective: To evaluate measurement of Amniotic Fluid
Index (AFI) at admission as a predictor of intrapartum
foetal compromise in women with pre-labour rupture
of membrane (PROM).
Material and Methods: Sonographic record of AFI was
made on singleton pregnancies at early and full term
admitted in early labour with PROM. The clinical team
treating the cases was not aware of the admission AFI
values. The labour outcome was studied with respect
to the AFI values to find out influence of duration of
rupture of membranes (DROM) on intrapartum foetal
status, neonatal outcome and infective morbidity.
Results: Higher proportion of cases with non-reassuring
foetal status (NRFS) was found when admission AFI
was less than 5 cm. No baby with low Apgar was born to
women recording admission AFI of at least 8 cm. NRFS
was not influenced by DROM or period of gestation.
High specificity (82%) and negative predictive value
(81.9%) was found with low AFI for NRFS.
Conclusion: AFI at admission in women with PROM
is not a sensitive determinant to predict occurrence
of intrapartum foetal compromise. But, AFI less than
5 cm is associated with higher incidence of NRFS in
primipara, women aged between 20 to 25 years, or those
receiving oxytocin.
Keywords: Amniotic fluid index; labour admission test;
pre-labour rupture of membranes; intrapartum foetal
compromise.
INTRODUCTION
It is not uncommon to find women reporting
to labour ward with ruptured membranes much
before start of labour uterine contractions. The
DOI: 10.14660/2385-0868-37
SOMMARIO
Obiettivo: Valutare la misura dell’indice di fluido
amniotico (AFI) al ricovero come fattore predittivo
di compromissione fetale perinatale nelle donne con
rottura della membrana prima del travaglio (PROM).
Materiale e metodi: Il dato ecografico di AFI è stato
fatto su singoli parti prematuri e a scadenza del
termine, in donne ricoverate prima del travaglio con
PROM. Il team clinico che ha trattato i casi non era a
conoscenza dei valori AFI al momento del ricovero. Il
risultato del lavoro è stato studiato nel rispetto dei dati
AFI per trovare l’influenza e la durata della rottura
delle membrane (DROM) sullo stato fetale perinatale,
l’outcome neonatale e la morbidità infettiva.
Risultati: La più alta percentuale dei casi con stato fetale
non rassicurante (NRFS) è stato riscontrato quando,
all’ammissione AFI, era inferiore ai 5 cm. Nessun
bambino con Apgar basso è nato da donne con valore
di ammissione AFI di almeno 8 cm. NRFS non è stato
influenzato dal DROM o dal periodo di gestazione.
Un’alta specificità (82%) e un valore predittivo negativo
(81,9%), è stato trovato in pazienti con AFI basso per
NRFS.
Conclusione: Il valore AFI al ricovero in donne con
PROM non è un fattore sensibilmente determinante nel
predire episodi di compromissione fetale perinatale.
Ma un valore AFI inferiore a 5 cm è associato a una
maggiore incidenza di NRFS in donne primipare, donne
di età compresa fra i 20 e i 25 anni o quelle che ricevono
ossitocina.
pre-labour rupture of membranes (PROM) is
seen in 10% of all pregnancies. The resulting
reduction in amniotic fluid volume in cases with
PROM will lead to umbilical cord and placental
compression, and ascending infection. This is
reflected in increased incidence of non-reassuring
foetal/ neonatal outcomes during labour(1), foetal
21
2016, 28: N.2
and maternal infection(2, 3), and perinatal death(4).
These patients also have a high caesarean rate due
to severe variable decelerations(1).
The concept of admission test in early labour–
labour admission test (LAT) using either an
initial period of foetal heart rate monitoring(5,6)
or the foetal response to acoustic stimulation(7)
was an attractive suggestion because it provided
an assessment of current foetal condition and
risk. The studies have shown that the LATs
cannot be recommended as a screening test for
foetal compromise in low risk women since the
sensitivity is too low and false positive rates are
high(8).
Measurement of amniotic fluid index (AFI)
or volume forms an important and influential
component of antepartum foetal surveillance
through biophysical profiling. Since significant
number of women present with ruptured
membranes prior to onset of labour, the present
study was designed to evaluate the effectiveness of
AFI at admission in labour as a predictor of foetal
status by correlating incidence of non-reassuring
foetal status with amniotic fluid index, and finding
out relationship of rupture of membranes with
maternal and neonatal outcome.
22
A prospective observational study was
carried out in the Labour ward Facility of District
Government Hospital, attached to a Medical
College, from July 2012 to July 2013.
The Study was approved by Institutes Scientific
and Ethics Committee. All the cases recruited were
informed of the study and their written consent
was obtained. Sample size required was calculated
on the basis of incidence for non- reassuring foetal
status (15%) in the hospital to obtain the results
with 95% confidence interval.
Consecutive consenting 100 women with
singleton live term pregnancies with pre-labour
rupture of membranes were recruited to the study.
Women were with cephalic presentation of foetus
and vertex as presenting part and had known
gestational age. Women excluded were high risk
pregnancies, uterus with fibroid/ scar/ anomalies,
medical disorders complicating pregnancy
(anaemia, gestational diabetes, hypertension),
foetal growth restriction, non-reassuring foetal
status at admission, choriamnionitis at admission
and women in active phase of labour (cervix
dilation ≥ 3 cm).
AFI as admission test in PROM
For the purpose of the study following
definitions and descriptions were considered:
(a) Term pregnancy: Period of pregnancy
from 37 completed weeks to 40 weeks was
considered as term. This period was further subdivided in to early term (37 to 38.6 weeks) and full
term (39 to 40 weeks).
(b) Pre-labour rupture of membranes: Women
with complaint of leak of amniotic fluid without
uterine contractions or in early labour (cervix up
to 3 cm dilatation). The amniotic fluid leak should
be visible on speculum examination and the fluid
should have alkaline pH.
(c) Known gestational age: The calculated
period of gestation in weeks of parturient with
regular 28-30 day menstrual cycle and the known
last menstrual period (LMP) in agreement with
either uterine size at the pelvic examination in 1st
trimester and/ or ultrasound determined period
of gestation.
(d) Non-reassuring foetal-neonatal status
(NRFS): Presence of any of the following meconium stained liquor during labour, foetal
heart rate (FHR) variations during labour, Apgar
of ≤ 7 at 1 and/ or 5 minutes, or neonatal intensive
care unit (NICU) stays, i.e., newborns requiring
transfer to NICU soon after birth and monitoring
for more than 24 hours.
(e) Chorioamnionitis: was considered to
be present if maternal fever of >37.8°C was
present with any two of the following – maternal
tachycardia of > 120 beats/ min, foetal tachycardia
160 beats/ min, purulent or smelling amniotic
fluid vaginal discharge, uterine tenderness, or
maternal leucocytosis > 15,000 cells/ mcL.
The particulars regarding pregnancy and
the findings at admission and follow-up were
recorded on the format designed for the study.
At the outset,
(a) Speculum examination with sterile Sim
speculum was performed to confirm the rupture
of membranes. Rupture of membranes was
confirmed if the pooling of amniotic fluid on
speculum was seen and determination of alkaline
pH of the fluid using red litmus paper. Change of
colour to blue on contact with fluid was taken as
alkaline.
(b) A vaginal swab was taken for culture
studies, and Inj. Ampicillin 2g followed by 500mg
6th hourly was administered, intravenously.
(c) A single digit vaginal examination was
performed with aseptic observations to note
cervical dilatation, effacement, station of the
presenting part, and to assess pelvic capacity for
ruling out disproportion.
A. Mallesara et al.
to:
Following recruitment, women were subjected
(a) Admission cardiotocography: to obtain
foetal heart traces for a minimum of 20 minutes
using tocodynamometer (EDAN Foetal Monitor,
China; Model F3). The machine had the paper
speed of 3cm/minute. Foetal heart rate traces
obtained at admission were interpreted as
‘reassuring’ and ‘non-reassuring’(9).
(b) Admission record of AFI: Amniotic fluid
index was recorded using ultrasound unit (Philips
HD7 XE BOTHELL, WA USA) equipped with
3.5MHz curvilinear transducer. The four-quadrant
AFI(10) was measured and to study its effect the
cases were grouped, for the purpose of the study,
as with low (< 5 cm), average (5.1-8 cm), or high (>
8 cm) AFI.
Blinding policy in the study:
The measured AFI was not informed to the
obstetrician managing the cases in the labour
ward. The investigator knowing the value of
measured AFI was not involved in the labour
management of any of the cases.
Foetal and maternal monitoring:
The maternal wellbeing in labour was
monitored by recording pulse rate and blood
pressure at 30 minutes interval. Foetal well-being
was monitored by foetal heart trace recording and
inspecting the colour of liquor on vulvar diaper.
Labour-delivery management:
Labour was managed as per the hospital policy.
Labour was either induced with oxytocics or
expectant management was carried out. Progress
of labour was monitored and documented on
modified WHO partogram. Episiotomy was
made to all primigravidas and in multigravidas
when needed. Delivery of the head was assisted
by Ritgen manoeuvre and oro-nasopharyngeal
suctioning done following the delivery of the
baby. After the placental delivery piece of chorioamnion near the placental edge was collected for
culture studies.
Neonatal Care:
Asphyxia status of the new-born was assessed
by Apgar at 1 and 5 minute. Neonatal assessment
included estimation of the gestational age by new
Ballard scores, birth weight and recognition of
congenital abnormalities and soft tissue injuries if
any.
In cases where meconium stained liquor was
present, laryngoscopic visualization of the foetal
larynx and glottis for meconium was done and
if detected, endotracheal suctioning through a
suction catheter was carried out. Baby was kept
in neonatal intensive care unit for observation
and management. Any neonate requiring stay in
neonatal intensive care unit, the duration and the
indication for the same was noted.
Work-up for sepsis:
Maternal septic work-up included high
vaginal swab for culture sensitivity (collected
at first examination), determination of total
leucocyte count and placental membrane culture
examination.
Neonatal septic work-up consisted estimation
of C-reactive protein, total leucocyte count and
study of peripheral smear for band neutrophils.
The route of delivery, Apgar scores, birth
weight, and information about septic workup,
neonatal problems, and perinatal deaths were
recorded in the designed proforma.
Statistical analysis:
Outcome of labour, delivery and neonate were
studied in relation to AFI. The statistical methods
applied to analyse the data were chi square test
and Fisher’s t test. To validate the significance of
admission AFI, the cases were grouped as those
with under or more than 5 cm of AFI. A statistical
package SPSS version 17.0 was used and p value
<0.05 was considered significant.
RESULTS
The mean age of parturient was 25 ± 4.03
years with majority (47%) in the age group of 2025 years. Nullipara formed 2/3rd of the study
population. Nearly half (56%) of the pregnancies
were at early term gestation. Normal AFI of >8
cm was found in 47% of parturients and low AFI
of <5 cm was recorded in 17% of women with
PROM. The mean AFI was 7.9 ± 2.7 cm. Almost all
cases had reported early on occurrence of leaking,
except 4 women who spent more than 12 hours at
home awaiting onset of labour or in transit. The
mean duration of PROM at admission was 4.1 ±
3.2 hours.
The evidence of compromise was identified
in 18 foetus/ neonates of 100 parturients. Nonreassuring foetal heart trace was recorded in 38.9
percent and 22.2 percent were associated with low
Apgar scores of these 18 cases with non-reassuring
foetal-neonatal status. The incidence of caesarean
delivery was 12 percent in the study group.
Although cases with foetal growth restriction
were excluded there were 19 percent neonates
with birth weight lesser than 2.5 kg. However, the
mean birth weight was 2.8 ± 0.4 kg.
An effort was made to explore and find out the
association of AFI estimates, if any, with some of
the patient characteristics and pregnancy outcome.
23
2016, 28: N.2
Proportion of cases with admission AFI of less
than 5 cm was found to be higher in the peripheral
age groups being highest (40%) among the age
cohorts of ≤ 20 years (p= 0.655).
Incidence of less AFI (<5 cm) did not appear
to be different in the two parity groups, despite
number of nullipara being two-times that of
multipara in the study. The proportions of cases
with lesser AFI were similar across the term
gestational period phases - early and full term
pregnancies. There was only one woman with
less AFI in the group who had PROM beyond 12
hours when reporting to hospital. Point of interest
to note was despite varying amount of time since
leak, proportion of cases with average to high AFI
was similar (Table 1).
Association between AFI groups and the
admission-delivery interval (ADI) showed that
women with higher AFI took longer time to deliver
(4.2 ± 1.1 and 11.4 ± 5.1 hours in women with mean
AFI 7.2 ± 2.6 and 8.2 ±2.7 cm, respectively). No
definite trend was seen with caesarean delivery
and AFI stratification. However, in women with
AFI of lesser than 5 cm, the decision for caesarean
was much commoner (4 of 12 vs. 13 of 88 cases
with caesarean and vaginal delivery, respectively;
p =0819) (Table 2).
No association was seen for occurrence of
Table 1.
AFI and maternal characteristics (N=100).
24
abnormal foetal heart trace and AFI at admission.
Abnormal FHR trace was recorded in 11.8% of
women with AFI of lesser than 5 cm (2 of 17 cases)
and it was 6% in women with admission AFI
beyond 8 cm (5 of 83 cases; p=0.2). There were 4
cases with meconium stained amniotic fluid, but
none in the group with AFI of < 5cm at admission.
There were 4 babies with low Apgar among 53
mothers who had admission AFI of up to 8 cm
(7.5%) and no baby was born with low Apgar
when mother’s admission AFI was higher than
8 cm. If the child required transfer to intensive
neonatal care nursery within 24 hour of birth and
stay for more than 12 hours was considered to
indicate indirectly the intrapartum insult. Even
though there were 17 women with AFI less than 5
cm none of them had their babies requiring NICU
transfer (Table 3).
The interdependency of maternal characteristics
with AFI at admission on the effect of foetus/
neonate was explored. There were a total of 18%
occurrences with compromised foetal outcome as
indicated by abnormal FHR traces, appearance of
meconium with liquor, low Apgar of lesser than 7
at 1 or 5 minutes of birth or the early requirement
for neonatal intensive care. Incidence of nonreassuring foetal status was higher if the mother
had low admission AFI of less than 5 cm, more so
A. Mallesara et al.
Table 2.
AFI and Labour-Delivery (N=100).
Table 3.
AFI and Non-Reassuring Foetal-Neonatal Status (N=100).
if she was aged between 20-25 years (p=0.243) and
was a nullipara (p=0.208). Period of gestation and
duration after rupture of membranes did not show
any meaningful relationship with occurrence of
NRFS.
In women who required oxytocin for induction
of labour had higher incidence of NRFS if AFI
at admission was less than 5 cm (p=0.654). The
duration in labour did not show any correlation
with occurrence of NRFS. Influence of NRFS
did not appear to dictate mode of delivery since
distribution of cases according to admission AFI
25
2016, 28: N.2
and compromised foetal status in them was similar
between vaginal and caesarean delivery (Table 4).
There were only two neonates that showed
perinatal infection. Both of their mothers had
average AFI and the total duration after rupture of
membranes till delivery was 17 hours 20 minutes
and 9 hours 10 minutes, respectively. (p=0.483)
Only case of chorioamnionitis was in one who
had total duration after rupture of membranes
of 23 hours and ADI of 20 hours. Her labour was
induced with oral PGE1. She had above average
AFI of 11.6 cm at admission. (p=0.558). These
cases of infective morbidity were associated with
women having admission AFI of > 5 cm and they
had rupture of membranes to delivery interval of
> 12hours.
To validate the significance of admission AFI,
the cases were grouped as those with under or
more than 5 cm of AFI. Number of cases with nonreassuring foetal status was 3 of 17 with less than
5 cm AFI group and that in the other group were
15 cases of 83 women. Based on these findings, the
AFI of <5 cm at admission, although found to have
poor sensitivity and positive predictive value, it
Table 4.
Proportion of NRFS cases in relation to some maternal characteristics and delivery factors in relation to AFI at admission (n,%).
26
Table 5.
Validation of low AFI at admission as predictor of intrapartum nonreassuring foetal-neonatal status.
demonstrated to have acceptable high specificity
higher negative predictive value (Table 5).
There were no cases of stillbirths, early neonatal
deaths and maternal deaths in the study group.
DISCUSSION
Every foetus is prone to develop intrapartum
hypoxia as labour is a process of repeated foetal
hypoxic events. It is difficult to predict with
accuracy which foetus would develop hypoxia in
labour and the degree of hypoxia the baby would
undergo. Mostly because of presence of differing
risk factors and different indicators the reported
incidence of intrapartum foetal compromise has a
wide variation.
Women with AFI < 5 cm have been shown to
be at significantly higher relative risk of 6.83 for
caesarean delivery if the foetal heart trace showed
variable decelerations(11). Other studies have
reported a high 25% occurrence of foetal distress(6).
The figure for non-reassuring foetal status in the
present study was 17% in women with AFI < 5 cm.
The protective importance of intact membranes
is known and rupture of it prior to the onset of
labour or in early labour does impart high risk
nature affecting foetal wellbeing.
The participant characteristics like age and
parity did not appear to be the influencing factors
for occurrence of PROM in the studied group. The
reason for preponderance of nulliparous women
in the recruited could be because of increased
alertness and apprehension in them coupled
with multipara reporting late in advanced labour
for being indifferent to the appearance of leak
having gone through labours earlier. It is only
A. Mallesara et al.
an assumption. Because of the early reporting
when leak occurred, in a nullipara lesser AFI at
admission may be considered as a significant
finding. It was found that nullipara with AFI of
< 5 cm had higher proportion of cases with nonreassuring foetal status (Table 4).
Majority of the cases had AFI >8 (47%) and
mean duration of PROM at admission was 4.13
hours in the present study. This can be accounted
by increased health awareness resulting in timely
reporting to the labour ward.
The finding of women with AFI < 8 cm having
shorter admission-delivery interval than the
counterparts with higher AFI make one to search
for the answer for variation in compromise to
foetal wellbeing in the mean AFI values among
AFI cohorts.
The cases with AFI < 5 cm in whom labour was
induced and maintained with oxytocin infusion
the occurrence of intrapartum foetal compromise
was commoner. In the absence of intrauterine
pressure monitoring data it will be difficult to
comment on the finding. It may be incidental
that most patients in other group receiving
prostaglandin preparations had AFI of > 5 cm.
Moreover administration of different oxytocics
was not randomized and oxytocin was the most
frequently used preparation (67 of 93 cases, 72%).
The incidence of operative intervention to
deliver for foetal compromise was reported to be 3times commoner in low AFI groups(12). The present
study noted frequency of caesarean delivery twice
than vaginal delivery in the group with AFI < 5
cm. It was seen that even with the not-so stringent
criterion used for defining non-reassuring foetal
status, heir occurrence was similar in both the
delivery modes.
Despite patients with PROM having admissiondelivery interval of more than 12 hours forming
nearly 3rd of the study group, the infective
morbidity and foetal compromise was similar in
the two cohorts of labour duration on either side
of 12 hours. It is in contrast to reported 68.4%
overall incidence of significant maternal and foetal
infection rates in the study group with low AFI.
That study(13) also included preterm pregnancies
with expectant management. Use of liberal
antimicrobials could be the reason behind the
only 1 and 2% of maternal and perinatal infection,
respectively in the present report.
The present study accorded a high specificity
(82%) and negative predictive value (81.9%) to
the predictability of admission AFI of < 5 cm in
women with PROM to pre-suggest possibility
of intrapartum foetal compromise. But, the
27
2016, 28: N.2
sensitivity of the indicator was a poor 17%. The
good results for prediction by Baron and associates
(1995)(11) based on study with intact membranes
could not be reproduced and probably they cannot
be extrapolated to the situations with ruptured
membranes (Table 5).
The higher specificity and negative predictive
values attached to the low AFI in identifying
pregnancies likely to develop intrapartum foetal
non-reassuring nature based on the observations
made in the present study appear substantial in
the light of incorporated blinded component
that kept the treating obstetricians unprejudiced.
To look in to influence of confounding variables
such as maternal characteristics including socioeconomic and educational status of the patient
REFERENCES
28
1) Moberg LJ, Garite TJ, Freeman RK. Foetal heart rate
patterns and foetal distress in patients with preterm
premature rupture of membranes. Obstet Gynecol
1984; 64:60–64
2) Lanier LR, Scarbrough RW, Ficklingim DW, Baker
RE Jr. Incidence of maternal and foetal complications
associated with rupture of membranes before the
onset of labour. Am J Obstet Gynecol 1965; 93:398-404
3) Gonik B, Bottoms SF, Cotton DB. Amniotic fluid
volume as a risk factor in preterm PROM. Obstet
Gynecol 1985; 65:456-459
4) Naeye RL. Causes of perinatal mortality in the US
Collaborative Perinatal Project. JAMA
1977; 238:228-229
5) Ingemarsson I, Arulkumaran S, Ingemarsson E,
Tambyraja RL, Ratnam SS. Admission test: a screening
test for foetal distress in labour. Obstet Gynecol 1986;
68:800-806
6) Sarno AP Jr, Ahn MO, Phelan JP. Intrapartum
amniotic fluid volume at term; association of ruptured
membranes, oligohydramnios and increased foetal
risk. J Reprod Med 1990;
35:719-723
7) Ingemarsson I, Arulkumaran S, Paul RH, Ingemarsson
E, Tambyraja RL, Ratnam SS. Foetal acoustic
and labour-delivery events, type of oxytocic used
more number of cases need to be studied under
those cohort subgroups.
ACKNOWLEDGEMENT
Authors thankfully acknowledge Clinical unit
heads of Obstetrics and Gynaecology and Medical
Superintendent of the Lady Goschen Hospital,
Mangaluru for permission given to carry out the
project.
DECLARATION
Authors declare no conflict of interest.
stimulation in early labour in patients screened with
the admission test. Am J Obstet Gynecol 1988; 158:70-74
8) Blix E, Oian P. Labour admission test: an assessment
of the test’s value as screening for foetal distress in
labour. Acta Obstet Gynecol Scand 2001; 80:738-743
9) Vintzileos AM, Antsaklis A, Varvarigos I, Papas C,
Sofatzis I, Montgomery JT. A Randomized Trial of
Intrapartum Electronic Foetal Heart Rate Monitoring
versus Intermittent Auscultation. Obstet Gynecol 1993;
81:899-907
10) Phelan JP, Smith CV, Broussard P, Small M.
Amniotic fluid volume assessment with the fourquadrant technique at 36-42 weeks’ gestation. J Reprod
Med 1987; 32:540-542
11) Baron C, Morgan MA, Garite TJ. The impact
of amniotic fluid volume assessed intrapartum
on perinatal outcome. Am J Obstet Gynecol 1995;
173:167-174
12) Grubb DK, Paul RH. Amniotic fluid index and
prolonged antepartum foetal heart rate decelerations.
Obstet Gynecol 1992;79:558-560.
13) Vintzileos M, Campbell WA, Nochimson DJ,
Weinbaum PJ. Degree of oligohydramnios and
pregnancy outcome in patients with PROM. Obstet
Gynecol 1985; 66:162-167
Italian Journal of
Leiomyosarcoma of the vulva: a case report and review of the literature
Giuseppe Comerci1, Venelia Picarelli1, Emilia Crisanti2, Giandomenico Raulli2
1
2
Gynecology Oncology Service, Department of Obstetrics, Gynecology & Pediatrician
Department of Pathology, “Santa Maria delle Croci” Hospital, Ravenna, Italy
ABSTRACT
Leiomyosarcoma of the vulva is very uncommon and
it represents 1% of the vulval neoplasms. A case of
44-years old lady affected by leiomyosarcoma of the
vulva is presented.
She was admitted to our unit because of complaining
painful nodule localized on the left labia majora.
It was supposed to be a vulval abscess and under
local anesthesia it was excised. Histology report was
consistent with leiomyosarcoma of the vulva. Imaging
did not reveal any other lesion. A second surgery has
been done in order to guarantee optimal free margins.
She did not require adjuvant treatment. After five years
of follow-up there is no evidence of local recurrence and
distant metastases.
Most vulval lesion are benign but the possibility of
leiomyosarcoma should always be considered if a
rapidly growing hard vulvar mass is found. The surgical
excision with widely free margins is recommended.
Long term careful follow-up is necessary.
Keywords: Gynecologic oncology; surgery in GYN
cancers; cancer of the vulva; gynecologic imaging;
epidemiology of GYN cancers.
INTRODUCTION
Malignant tumors of the vulvar soft tissue
are very rare. Leiomyosarcoma is the most
frequent histological type, representing 1% of the
malignant neoplasms of the vulva(1-3). However, it
is an aggressive disease which usually present as
slowly growing nodule and it can often mistaken
DOI: 10.14660/2385-0868-38
SOMMARIO
Il leiomiosarcoma della vulva è una neoplasia maligna
molto rara e rappresenta l’1% dei tumori vulvari.
In quasto articolo si illustra il caso clinico di una
paziente di 44 anni ricoverata presso la nostra unità
di ginecologia per la comparsa di un nodulo dolente a
carico del grande labbro vulvare di sinistra.
La diagnosi di ammissione è stata di ascesso vulvare
che, in anestesia locale, è stato escisso. La diagnosi
istologica è stata di leiomiosarcoma della vulva.
In seguito a tale diagnosi è stata fatta una stadiazione
per immagini sottoponendo la paziente ad una TC totalbody che non ha rivelato secondarismi.
Una chirurgia di seconda istanza è stata successivamente
eseguita in funzione di garantire sufficienti margini di
tessuto indenne. Non è stato necessaria alcuna terapia
adiuvante.
Dopo cinque anni di controlli clinici e strumentali la
paziente non ha sviluppato lesioni locali o a distanza.
Gran parte delle lesioni vulvari sono benigne ma la
possibilità che possa trattarsi di una neoplasia invasiva
dovrebbe essere sempre considerata qualora si noti
una lesione di consistenza dura e a rapida crescita. E’
raccomandata fortemente una chirurgia radicale con
ampi margini di tessuto sano. E’, inoltre, opportuno
eseguire un attento e duraturo follow-up.
for a benign lesion causing a delay in diagnosis.
The major incidence is seen in women between
40 and 55 years old. These tumors are thought
to originate from smooth muscle within erectile
tissue or blood vessel walls, the round ligament,
the dartos muscle, or the erectorpili muscle(4).
Primary therapy is surgical and prognosis is
difficult to estimate based on the rareness of
these tumors(1). The case of a patient who had a
leiomyosarcoma growth in the left labia majora is
reported.
29
2016, 28: N.2
Leiomyosarcoma of the vulva
CASE
Forty-four years old, para 1 was admitted
to our unit because of complaining painful 2
cm nodule localized on the left labia majora.
The patient reported that the lesion was present
since years but during the last four months
increased rapidally in size. It was thought to be a
possible vulvar abscess but white cell count with
neutrophil count was normal and reactive protein
C was negative. Anyway, the following day, under
local anesthesia it was found to be a 2 x 2 cm hard
mass on the left labia majora. It was incompletely
excised. Histology confirmed leiomyosarcoma.
The tumor greatest dimension was 1,5 cm. Grossly
it has white cut surface and ill-defined margins.
It is composed primarily of spindle cell arranged
in fascicles with area showing pleomorphism
and mitotic figures (average 18 per 10 HPF), with
infiltrative margins and area of necrosis (Figure 1). It
Figure 2.
The cells stain for smooth-muscle actin and desmin; no staining is
observed for keratin or S-100 (40x).
DISCUSSION
Figure 1.
The tumor is composed primarily of spindle cells arranged in fascicles
with necrosis, infiltrative margins and mitotic figures (18 x 10 Hpf).
30
stains for smooth-muscle actin and desmin, there is
no staining for keratin or S-100 (Figure 2). A CT scan
of the thorax, abdomen and pelvis was performed,
revealing no additional lesions. A second surgery
was scheduled and a wide local excision of the
left vulva, deeper up to the fascia, was done.
Microscopic examination showed a 5 mm residual
tumor with free margin greater than 1 cm. Five
years after the diagnosis, patient remains well
with no clinical evidence of recurrence.
This is the first case of vulvar leiomyosarcoma
reported in our unit as, already mentioned, the
disease is rare. As in this case, an enlarging painless
mass, located in labia majora or minora is usually
the only symptom of vulvar leiomyosarcoma. Its
biological behavior in the vulva is similar to that in
other subcutaneous tissue locations, characterized
by high rate of local recurrence and frequency
of metastasis by hematogenous route. So these
tumors have an insidious evolution and usually
reach huge dimensions before accurate diagnosis
is done. Because of the rarity of these neoplasms
our knowledge is limited.
Differentiation between benign and malignant
lesion in the vulva is difficult and it causes
diagnostic problems. To overcome this problem,
Nielsen et al. in 1996 proposed an useful scoring
system in order to differentiate leiomyomas and
leiomyosarcomas of the vulva. The most important
pathologic findings are: tumor diameter greater
than 5 cm, infiltrative margins, more than five
mitotic figures per 10 HPF and moderate to severe
nuclear atypia. Tumors with three or more of these
characteristics are considered sarcomas; those that
have only one of these characteristics should be
diagnosed as leiomyomas and those with only
two characteristics should be considered benign
but atypical leiomyomas.
A review of the literature shows a wide variety
of treatment options due to a small number of
cases but most of the authors feel that a radical
vulvectomy is only mandatory if a wide local
excision should not guarantee a pathological free
margin greater than 1 cm(5). In our case, because
G. Comerci et al.
Leiomyosarcoma of the vulva
the lesion was 2 cm in greater dimension and
localized in the labia majora we have had the
possibility to preserve the clitoris in order to
decrease the consequences for psychosexual
function. In our case there were no clinically
and radiologically enlarged lymph nodes at the
moment of diagnosis; we decided not to perform
inguinal lymphadenectomy. As reported in
the literature, this disease behave aggressive in
general, with a high rate of local recurrence and
distant metastases by haematogenous route (liver
and lung mainly). In the review analysed by
Aartsen et al, the authors found that the disease
may present with possible late recurrence(6). For
REFERENCES
1) Curtin JP, Saigo P, Slucher B, Venkatraman ES,
Mychalczak B, Hoskins WJ. Soft-tissue sarcoma of the
vagina and vulva: a clinicopathologic study. Obstet
Gynecol 1995;86:269-272.
2) Nielsen GP, Rosenberg AE, Koerner FC, Young RH,
Scully RE. Smooth-muscle tumors of the vulva: a
clinicopathological study of 25 cases and review of the
literature. Am J Surg Pathol 1996;20(7):779-793.
3) Behranwala KA, Latifaj B, Blake P, Barton DP,
Shepherd JH, Thomas JM. Vulvar soft tissue tumors.
Int J Gynecol Cancer 2004;14:94-99.
4) Kaufman RH, Gardner HL. Benign mesodermal
tumors. Clin Obstet Gynecol 1965;8:953-981.
5) Gonzales-Bugatto F, Anon-Requena MJ,
Lopez-Guerrero MA, Baez-Perea JM, Bartha JL
this reason we have planned to follow-up our
patient for at least ten years.
In conclusion, any vulval lesion with unusual
characteristics or insidious evolution should
be investigated rapidally, in order to make an
accurate diagnosis, and due to the rarity of the
disease referral to a gynecological cancer centre is
mandatory(7-9).
DISCLOSURE
The authors declare that they have no conflict
of interest.
Hervias-Vivancos B. Vulvar leiomyosarcoma in
Bartholin’s gland area: a case report and literature
review. Arch Gynecol Obstet 2009;279:171-174.
6) Aartsen EJ, Albus-Lutter CE. Vulvar sarcoma:
clinical implications. Eur J Obstet Gynecol Reprod Biol
1994;56:181-189.
7) Salehin D, Haugk C, William M, Hemmerlein B, Thill
M, Diedrich K, Friedrich M. Leiomyosarcoma of the
vulva. Eur J Gynaec Oncol 2012;33(3):306-308.
8) DiSaia PJ, Rutledge Felix, Smith JP. Sarcoma of
the vulva: report of 12 patients. Obstet Gynecol
1971;38(2):180-184.
9) Davos I, Abell MR. Soft tissue sarcomas of vulva.
Gynecol Oncol 1976;4(1):70-86.
31
Italian Journal of
Terrorism and the male to female ratio at birth: “Anni di Piombo” in Italy
Victor Grech1, Julian Mamo1
1
Academic Department of Paediatrics, Mater Dei Hospital, Malta
ABSTRACT
Introduction: Males are usually born slightly in excess
of females and the ratio is often expressed as M/F (male
divided by total births). Many factors have been shown
to influence M/F, including periods of terrorism which
lower M/F through a process of excessive male foetal
loss.
The Years of Lead constituted a terrorist political
phenomenon that commenced in Italy, known as
“Anni di Piombo” (1969–1982). This study was carried
out in order to ascertain whether the era caused any
fluctuations in annual M/F in Italy.
Methods: Annual birth data by gender for Italy was
obtained from a World Health Organisation Database.
Monthly data was unavailable.
Results: Annual M/F showed no significant annual
dips. However, M/F rose between 1965-69 and 1970-4,
and again between 1985-89 and 1990-94 (p<0.01).
Discussion: These findings may be due to one of two
reasons: a population that is unaffected or less affected
by terrorism, or additional factors that may have
obscured and even swung M/F upward, in the opposite
direction to that expected. A potential explanation is
an increase in ambient radiation following a peak of
atmospheric bomb testing prior to the Partial Nuclear
Test Ban Treaty in 1963, and after Chernobyl in 1986.
The rise in M/F in Italy in the early 1970s may have
been caused by the former and the rise in the late 1980s
may have been caused by the latter. Radiation may be as
strong or an even stronger influence on M/F than stress.
Keywords: Sex ratio; infant, newborn; birth rate/*trends;
terrorism; Italy
INTRODUCTION
Males are born slightly in excess of females(1).
The ratio of male-to-female live births is
conventionally expressed as M/F (male births
divided by total births – technically M/T not
32
DOI: 10.14660/2385-0868-39
SOMMARIO
Introduzione: I maschi, solitamente, nascono in numero
leggermente superiore rispetto alle femmine e il rapporto
è spesso espresso come M/F (maschi su totale delle
nascite). E’ stata dimostrata l’influenza di molti fattori
sul rapporto M/F, incluso periodi di terrorismo in cui
si ha un abbassamento del rapporto M/F attraverso un
processo di eccessiva morte fetale maschile.
Gli Anni di Piombo costituiscono un fenomeno politico
terroristico iniziato in Italia (1969-1982). Questo studio
è stato condotto allo scopo di accertare se il periodo ha
causato fluttuazioni nel rapporto annuale M/F in Italia.
Metodi: Dati annuali delle nascite divisi per genere per
l’Italia, sono stati ottenuti dal Database del World Health
Organisation. I dati mensili non erano disponibili.
Risultati: Il rapporto annuale M/F non ha mostrato
variazioni annuali significative. Tuttavia, si è riscontrato
un aumento del rapporto M/F tra il 1965-69 e il 1970-4,
and di nuovo tra il 1985-89 e il 1990-94 (p<0.01).
Discussioni: Questi risultati possono essere ricondotti
a uno dei due seguenti motivi: o una popolazione non
è influenzata o poco influenzata dal terrorismo, o altri
fattori possono aver modificato il risultato facendo
aumentare il rapporto M/F in direzione opposta
rispetto a quanto atteso. Una potenziale spiegazione è
un aumento delle radiazioni ambientali a seguito dei test
nucleari nell’atmosfera prima del Trattato sulla messa
al bando parziale dei test nel 1963, e dopo Chernobyl
nel 1986. La crescita del rapporto M/F in Italia all’inizio
degli anni ’70 può essere stata causata dal primo e
l’aumento negli ultimi anni ’80 può essere stata causata
dal secondo. Le radiazioni possono influenzare in modo
sostanziale il rapporto M/F, o ancora più sostanziale di
quanto ipotizzato.
M/F). Many factors have been shown to influence
M/F, and indeed, all forms of stress have been
shown to cause dips in M/F. Violence in particular
has also been shown to reduce population M/F.
This has included not only frank warfare(2), but
also simple civil unrest(3). Terrorist attacks have
also been shown to reduce M/F. This was notably
shown after the September 11 attacks, following
V. Grech et al.
Anni di Piombo and M/F birth ratio
which transiently less males were born (four
months later) not only in New York(4), but in the
entire United States(5).
The mechanism for these dips has been shown
to be due to an excess of male foetal loss in women
who were already pregnant(5). A similar effect was
also found following the Los Angeles Rodney
King riots (1992) and the Breivik (Norway - 2011)
and Sandy Hook (Connecticut - 2012) shootings(6).
Longer periods of sectarian violence have also
been shown to lower M/F, as was evidenced after
“The Troubles” in Northern Ireland(6,7).
The Years of Lead constituted a political
phenomenon that arose from the Cold War. This
was characterized by anarchists and by both leftand right-wing terrorism that commenced in Italy
and spread to the rest of Europe. In Italy, these
were referred to as the “Anni di Piombo”, a period
of socio-political turmoil that mostly affected
Northern Italy and lasted from the late 1960s into
the early 1980s (1969–1982). This era was notable
for violent waves of terrorist acts and summary
executions of both civilian and military victims.
Violence erupted in 1969 with public protests, the
occupation of the Fiat automobile factory in Milan,
the death off the policeman Antonio Annarumma
and the bombings of Piazza Fontana in Milan and
that of the monument to Victor Emmanuel II in
Rome, among others(8).
This study was carried out in order to
ascertain whether the Anni di Piombo caused any
fluctuations in annual M/F in Italy.
M/F rose between 1965-69 and 1970-4, and again
between 1985-89 and 1990-94. These rises are
highly statistically significant (Table 1).
Figure 1.
M/F for Italy, 1950-99.
Table 1.
Totals and M/F for the three eras: 1950-69, 1970-84 and 1985-99,
along with significance testing.
METHODS
Annual birth data by gender for Italy was
obtained from a World Health Organisation
Database (HFA (Health for All) Database) for 195099. Monthly data was unfortunately unavailable
and not forthcoming.
Excel was used for data entry, overall analysis
and charting. The quadratic equations of Fleiss
were used for the calculation of 95% confidence
intervals for ratios(9). Chi tests and chi tests for
trends for annual male and female births were
used throughout using the Bio-Med-Stat Excel
add-in for contingency tables(10). A p value ≤0.05
was taken to represent a statistically significant
result.
RESULTS
Annual M/F showed no significant individual
variation/s for the period 1950-1999. Five year
M/F values for this period are shown in Figure 1.
33
2016, 28: N.2
DISCUSSION
Research regarding the field of M/F has
repeatedly shown that M/F dips follow
catastrophic or tragic events if these are felt to be
momentous enough and/or to cause sufficient
population stress or privation, whether or not
these are associated with violence. For example, an
M/F dip was noted in the United Kingdom after
the accidental death of the Lady Diana, Princess
of Wales in 1997, a loved public figure(11). A dip in
M/F was also noted in Quebec a few months after
a closely-run referendum proposing secession
from Canada(12).
This is in accordance with the Trivers-Willard
hypothesis which states that evolution should
have favoured parents who can influence M/F
according to conditions around conception and
during pregnancy. In polygynous species, a
robust son who is conceived under favourable
environmental conditions has greater reproductive
opportunities than an equivalent daughter
who is constrained by pregnancy and lactation.
Conversely, under unfavourable conditions, a
male foetus (which is weaker than a female foetus)
will be less likely to be carried to term and survive
to reproductive age, and if so, would compete
poorly with more robust males. However a frail
female is likelier to survive and reproduce. Hence,
under unfavourable conditions, the parental
passage of genes if favoured if less males are
produced through the culling of weaker males(13).
This may have been the mechanism for
the decline noted in M/F in Northern Ireland
during “The Troubles” (1969-1998). The ethnonationalist conflict was political with ethnic and
sectarian influences, with a majority Unionist/
Loyalist population who did not want the
country to secede from the United Kingdom,
and a minority Nationalist/Republican RomanCatholic population who wished to leave the
United Kingdom. Over 3500 individuals died in
the Troubles and this was associated a decline in
M/F(6,7).
This study shows the converse effect, a rise in
M/F. These findings may be due to one of two
reasons: a population that is unaffected or less
affected by terrorism, or additional factors that
34
may have obscured and even swung M/F upward,
in the opposite direction to that expected.
One such potential influence is ionising
radiation, the only toxin that has repeatedly been
shown not only to cause foetal losses, but also cull
more female than male foetuses, thereby raising
M/F in ensuing cohorts. Irradiated men sire an
excess of males(14), and irradiated females give
birth to an excess of females(15). This is attributed
to the hypothesis that if an X-linked recessive
lethal gene is induced in a mother’s germ cell line
by ionising radiation, it would have no effect on
a heterozygous daughter but would be lethal to
a hemizygous male zygote. X-linked dominant
lethal mutations in mothers would be equally
lethal to both genders (16). X-linked dominant
mutations induced in fathers would suppress
only female offspring. Recessive X-linked lethal
mutations in fathers would not influence M/F as
sons do not receive the paternal X-chromosome
and daughters carry (and are protected by) a
second X-chromosome from their mother(16).
M/F is thus influenced through increased
but gender-biased foetal mortality. It has been
hypothesised that the skew toward higher
female mortality may be due to the fact that the X
chromosome contains more genetic material and
is physically larger, and hence, may be more easily
struck by ionising radiation. Another possibility is
that ova and sperm afford their genetic material
different levels of protection(16,17).
The effect of radiation was shown, for example,
in areas in close proximity to nuclear facilities(17),
worldwide following a peak of atmospheric bomb
testing prior to the Partial Nuclear Test Ban Treaty
in 1963(18), and after Chernobyl in 1986(17,19).
The rise in M/F in Italy in the early 1970s may
have been caused by the former and the rise in the
late 1980s may have been caused by the latter(20).
If this is the case, then radiation may be as strong
or an even stronger influence on M/F than stress.
COMPETING INTERESTS STATEMENT
There are no real/potential conflicts, financial
or otherwise.
REFERENCES
1) James WH. Proximate Causes of the Variation
of the Human Sex Ratio at Birth. Early Hum Dev.
2015;91:795-9.
2) Grech V. Conflicts in the last fifty years and
subsequent effects on the male:female ratio at birth.
Br J Med Med Res 2015;5:1247-1254.
3) Grech V. Population Stress, Civil Unrest and the
Male to Female Ratio at Birth in Chile, Argentina,
Australia and Finland. Int J Tropical Dis Health 2015;6:
27-34.
4) Catalano R, Bruckner T, Marks AR, Eskenazi B.
Exogenous shocks to the human sex ratio: the case of
September 11, 2001 in New York City. Hum Reprod.
2006;21:3127-31.
5) Bruckner TA, Catalano R, Ahern J. Male fetal loss in
the U.S. following the terrorist attacks of September
11, 2001. BMC Public Health. 2010;10:273.
6) Grech V. Terrorist attacks and the male-to-female
ratio at birth: The Troubles in Northern Ireland, the
Rodney King riots, and the Breivik and Sandy Hook
shootings. Early Hum Dev. 2015;91:837-40.
7) Grech V. The male to female ratio at birth in the
Republic of Ireland and Northern Ireland: influence
of societal stress. Ulster Med J. 2015;84:157-60.
8) Weinberg L. The end of terrorism? New York:
Routledge; 2013.
9) Fleiss JL. Statistical methods for rates and
proportions. New York: John Wiley and Sons; 1981:1415 (2nd edition).
10) Slezák P. Microsoft Excel add-in for the statistical
analysis of contingency tables. Int J Innovation Educ
Res 2014;2:90-100.
V. Grech et al.
11) Grech V. Historic Royal events and the male to
female ratio at birth in the United Kingdom. Eur J
Obstet Gynecol Reprod Biol. 2015 May 30;191:57-61.
12) Grech V. The male:female ratio at birth was
depressed in Québec by the sovereignty referendums.
Obstet Gynaecol Can 2015;37:405–411.
13) Trivers RL, Willard DE. Natural selection of
parental ability to vary the sex ratio of offspring.
Science. 1973;179:90-2.
14) James WH. The sex ratios of offspring of people
exposed to non-ionising radiation. Occup Environ
Med. 1997;54:622-3.
15) Schull WJ, Neel JV. Radiation and the sex ratio in
man. Science. 1958;128:343-8.
16) Vogel F, Motulsky AG. Human genetics. 2nd ed.
Berlin: Springer; 1986.
17) Scherb H, Voigt K. The human sex odds at birth
after the atmospheric atomic bomb tests, after
Chernobyl, and in the vicinity of nuclear facilities.
Environ Sci Pollut Res Int. 2011;18:697-707.
18) Grech V. The Chernobyl accident, the male to
female ratio at birth and birth rates. Acta Medica
(Hradec Kralove). 2014;57:62-7.
19) Grech V. Atomic bomb testing and its effects on
global male to female ratios at birth. Int J Risk Saf Med.
2015;27:35-44.
20) Scherb H, Voigt K. Response to F. Bochud and T.
Jung: Comment on the human sex odds at birth after
the atmospheric atomic bomb tests, after Chernobyl,
and in the vicinity of nuclear facilities, Hagen Scherb;
Kristina Voigt, Environ Sci Pollut Res (2011) 18:697-707.
Environ Sci Pollut Res Int. 2012;19:4234-41.
35
Italian Journal of
Management of adnexal masses during the third trimester of pregnancy:
a case report in twin-pregnancy and review of the literature
Luciana Cacciottola1, Eugenio Solima1,Giuseppe Trojano1, Marzia Montesano1, Mauro
Busacca1, Michele Vignali1
Department of Biomedical Science for the Health, University of Milan, Macedonio Melloni Hospital,
Milan, Italy
1
ABSTRACT
The occurrence of ovarian masses during pregnancy
is uncommon, nevertheless the correct diagnosis
and management, either surgical or obstetric, may
represent an issue. The clinical management has to
take into consideration aspects both related to the
mass (symptoms of torsion, rupture or occlusion and
malignant potential) and to the foetal risks.
A 36-year-old woman with a twin pregnancy at 29
weeks of gestation was diagnosed with an ovarian cyst
with suspicious ultrasonographic features (diameter
of 15 cm and enhanced blood flow). An expectant
management until a safer gestational age for the twins
was established. At 32 weeks of gestation symptoms
of bowel obstruction and abdominal pain required
a caesarean section and the removal of the affected
adnexum. The histological analysis revealed a mucinous
borderline tumour with intraepithelial carcinoma.
When an adnexal mass is diagnosed during third
trimester of pregnancy the ultrasonographic evaluation
has to be done to assess the potential of malignancy.
The clinical management needs a multidisciplinary
approach has to be balanced between the risk of
malignancy or other issues related to the mass and the
foetal health.
Keywords: Adnexal mass; borderline tumour; mucinous
tumour; twin-pregnancy; ovarian markers; CA 19.9
INTRODUCTION
According to literature the incidence of adnexal
masses in pregnancy ranges from 1 in 25 to 1 in
8000(1). The widespread use of ultrasonography
since the first trimester makes the detection of
36
DOI: 10.14660/2385-0868-40
SOMMARIO
Il riscontro di una neoformazione ovarica in gravidanza
è un evento raro. La diagnosi e la gestione clinica
possono presentare diverse criticità. E’ neccessario
considerare il potenziale di malignità e la presenza di
complicanze (torsione ovarica, rottura della massa e
dolore addominale), oltre che i rischi fetali.
Una paziente di 36 anni, con gravidanza gemellare,
ha avuto diagnosi di massa ovarica sospetta a 29
settimane gestazionali. L’ecografia mostrava una
neoformazione di circa 15 cm, multicistica, con porzioni
solide e aumentata vascolarizzazione. Abbiamo
scelto una condotta di attesa per le problematiche
fetali di prematurità, ma a 32 settimane gestazionali
l’insorgenza di una sintomatologia suggestiva per
occlusione intestinale ha portato al taglio cesareo e
contestualmente ad annessiectomia monolaterale con
stadiazione della patologia ovarica. L’esame istologico
definitivo era tumore mucinoso borderline con
carcinoma intraepiteliale.
In caso di riscontro di una massa ovarica nel terzo
trimestre la valutazione, attraverso l’ecografia, del
potenziale di malignità guida la condotta clinica rispetto
alla scelta di una terapia chirurgica e al timing del parto.
La gestione del caso deve essere multidisciplinare e
tenere in conisiderazione sia i rischi associati ad un
ritardo di diagnosi istologica e terapia chirurgica, sia i
rischi fetali.
asymptomatic lesions possible and more frequent
every day(2,3). During pregnancy most ovarian
tumours reduce or disappear spontaneously and
they don’t need surgical management(4).
Although malignant adnexal cysts are
extremely rare (ranging from 1 in 10’000 to 1 in
50’000) the possibility of a borderline tumour has
to be considered(5). Malignancy is not the only
L. Cacciottola et al.
Adnexal mass in pregnancy
risk of adnexal masses in pregnancy: the risk of
rupture, torsion or bowel occlusion are increased
during the whole gestation and so is the risk of
dystocia during labour(5,6,7).
Nevertheless the management of adnexal
masses can be difficult as both the surgical removal
of the mass and an expectant management present
risks for the mother and the foetus(5,6).
CASE PRESENTATION
A 36 year-old twin pregnant woman on the
29th week of gestation presented to the Emergency
Room in January 2015 complaining diffuse
abdominal pain. She had a previous caesarean
section because of a foetal malpresentation. This
pregnancy was a spontaneous bichorial-biamniotic
twin pregnancy with regular evolution for both
twins and no signs of obstetrics pathologies.
No uterine contractions or tenderness were
noted and the cervix was regular at vaginal
examination and at ultrasound screen. An obstetric
ultrasonography showed that both foetuses heart
rates were regular and checked the foetal position:
cephalic for the first twin and breech for the
second one.
While hospitalized the patient started to have
irregular uterine contractions; then a tocolytic
therapy and antenatal corticosteroids for foetal
lung maturation were performed.
An ultrasonography detected the presence of
left ovarian cyst, with multilocular lesions of 14
x 15 x 13 cm with liquid and solid portions, with
regular boundaries and a vascular flow perfusing
the solid areas (color score 3/4).
Ovarian markers were dosed finding CA 19,9
increased (462,5 IU/ml). Normal values were
observed for CA125.
Considering the gestational age, the common
issues related to a twin pregnancy and the mass
size (which made it not possible to be removed
preserving the pregnancy), an observation period,
until the 34th week of gestation was established
by a multidisciplinary team foreseeing a magnetic
risonance imaging (MRI) and an elective caesarean
section and surgical management of the mass.
After few weeks an exacerbation of abdominal
pain together with other gastro-enteric symptoms
such as nausea, anorexia and difficult digestion led
to the decision to anticipate the caesarean section
which was performed at 32 weeks of gestation,
before MRI execution.
The caesarean section was carried out through
a midline incision. A sample of peritoneal fluid
was collected for cytology before the twins
extraction. First twin was in cephalic presentation,
the second twin was in breech presentation. The
newborns were both males weighting 1850 grams
and 1990 grams and with an Apgar score of 9 and
10 respectively. After closing the uterine incision
and the visceral peritoneum the ovarian mass was
then considered.
The mass showed solid and cystic portions. It
was located between the diaphragm on the top,
the small bowel medially and the uterus and
pelvic cavity inferiorly. After the removal of few
adhesions between the small bowel and the mass,
the vascular ovarian pedicle was then isolated,
clamped and ligated with double safety vessel
ligation because of its size. The mass was then
removed without compromising its integrity and
sent to the pathology for a frozen section analysis
which came back to be a mucinous borderline
tumour, weighing 2095 grams. Omentectomy,
appendicectomy and several peritoneal biopsies
were then performed. The right ovary appeared
regular.
The operation course and puerperium were
regular.
The definitive histological exam reported
mucinous borderline tumour intestinal type with
intraepithelial carcinoma (1A1 F.I.G.O. 2013).
Free peritoneal fluid, appendix, peritoneum and
omentum were free from neoplastic cells.
A 4 months follow-up was established
considering patient’s young age and the clinical
benign course of this kind of lesion. Twins were
discharged in few weeks heatlhy.
DISCUSSION
In this case the adnexal mass was diagnosed
in the third trimester of a twin pregnancy, with
suspicious features and symptoms (abdominal
pain and increasing preterm uterine contractions).
Even if a surgical management to confirm the
tumour histology was the best patient’s option, the
a conservative surgical treatment without stopping
the pregnancy was not possible, because of the
patient’s history of previous caesarian section
and the size of the mass itself. Even though the
adnexal mass had several features of malignancy
such as an increased size, solid component and
abnormal blood flow, the high risks of neonatal
complications deemed an expectant management
until a safer gestational age to be the best option
for the patient.
CA 125 was negative while CA 19.9 was found
highly increased (>400 IU/ml). Even though
37
2016, 28: N.2
there are limited reports regarding the use of CA
19.9 as a diagnostic marker in ovarian mucinous
tumours (and even less about its value in
screening borderline and malignant tumours from
the benign ones)(8) its positivity, together with the
ultrasonographic features, were suggestive of a
mucinous mass.
Regarding the definitive histological type
the discovery of malignant cells in the tumour’s
parenchyma is based on cytological evidences and
immunohistochemical techniques. This accounts
for the underdiagnosis of this type of tumours
as they require a more extensive sampling
then possible during a frozen section analysis.
Mucinous borderline tumours with intraepithelial
carcinoma have a benign clinical behaviour and
are bilateral only 5% of the times.
We applied a fertility preserving strategy
choosing not to remove the other ovary or perform
biopsies which could cause adhesions and reduce
fertility(9). Even if the rate or recurrence is higher
in this kind of management (10% to 20% versus
5% of radical surgery) the mortality rate is no
increased(10,11).
Considering the low risk of lymph nodes
metastasis in this kind of histotype the
retroperitoneal staging was omitted(12).
REVIEW OF THE LITERATURE
38
Adnexal masses in pregnancy are rare, from
0,15%-0,57% (incidence rate ranging from 1 in
25 to 1 in 8000)(1). The risk of malignancy is even
less common, (1 in 10000 to 1 in 50000) especially
considering the patients’ age (3). The risk of
borderline ovarian tumour (BOT) is though worth
of being considered. BOT represent between 10%
and 20% of all ovarian malignancies(13). The mean
age of incidence is 20 years earlier than ovarian
invasive carcinomas, with up to 30% of diagnosis
in childbearing age (< 40 years) (14). The exact
incidence of BOT during pregnancy is unknown;
literature reports an incidence up to 8% of adnexal
masses(14).
Even if their early diagnosis is increasingly
frequent because of the widespread use of
ultrasonography from the first trimester, the
19.4% of all ovarian masses are detected in the
third trimester or at term of pregnancy and this
percentage reaches 36,9% considering the ovarian
masses requiring surgery(5).
When dealing with an adnexal mass in third
trimester of pregnancy the malignant potential, the
likelihood of sponaneous resolution (depending on
the size and the ultrasonographic and radiologic
appearance), the presence of symptoms and the
risk of obstructed labour should be considered(12).
The ultrasonographic diagnosis of malignant
ovarian masses during pregnancy has a sensitivity
ranging between 68 and 93%(6), with a certain rate
of false positives. It’s not known if the specific
pregnancy’s hormonal environment could
contribute to this particular issue. The Doppler
examination has a false positive rate of 49% in
predicting malignancies, due to the increased
pelvic blood flo (3).
MRI with gadolinium injection can be
performed during from the third trimester of
pregnancy. Gadolinium is a pregnancy category
C drug. Animal studies have shown an increased
risk of skeletal malformations; for this reason it
should be avoided during organogenesis. MRI
is a second line examination and it should be
considered in case of indeterminate adnexal
lesion, up to 20% of times. It is useful in evaluating
adnexal masses that are too large to be evaluated
by ultrasonography(7,15).
Ca 125 is not useful in the diagnosis of
ovarian masses during pregnancy, because the
effect of embryonic growth during pregnancy
and the peculiar hormonal assessment can
cause significant variations in the first and third
trimester. CA 19.9 is even less specific during
pregnancy, but it is associated with several types
of mucinous tumours in the gastrointestinal
tract and with primitive ovarian tumours as well
(dermoid cyst and mucinous ovarian tumour),
playing a potential role in different diagnosis(16,17).
The 70% of the masses resolve spontaneously(4).
This percentage does not decrease in patients
with complex or large cysts (more than 5 cm) and
is higher in presence of simple cysts with major
diameter less than 5 cm (18).
Adnexal masses are asymptomatic in 65% of
cases. Symptoms detected are abdominal pain,
occurrence of rapture or bleeding and ovarian
torsion(4,7). The rate of torsion is between 1 and 22%
of cases, it is higher in adnexal masses with size
between 6 and 8 cm, compared to other size (22%
vs 14%), but only 5,9% of ovarian torsions appears
in third trimester(19). The cyst rapture or bleeding
seems to be less frequent, ranging form 1 to 9%,
without difference during the whole pregnancy(20).
There is not a definitive management
strategy dealing with the adnexal masses in
pregnancy(1). The optimal management foresees
a multidisciplinary approach, involving specialist
in oncology, in obstetrics and sometime in
pediatrics(5).
In case of an asymptomatic masses with no
L. Cacciottola et al.
features of malignancy in third trimester an
expectant management should be offered and
surgery should be considered at least 6 weeks after
delivery.
Ultrasonographic features of malignancy guide
to a surgical management. In case of a complex
mass or a large one with major diameter > 8 cm(20)
or > 10 cm(19,21) according to different authors, there
is an increased risk of malignancy.
If a low malignant potential can be confirmed
the tumour can be treated with conservatively
adnexectomy, peritoneal citology and biopsies,
without leading to the end of pregnancy when
possible. In case of single ovary or bilateral
tumour a conservative treatment with cistectomy
should be considered(4,5) to preserve fertility in
young patients(9).
Frozen section analysis should be always
performed to achieve the diagnosis. In case
of invasive tumour unilateral or bilateral
adnexectomy with abdominopelvic exploration
should be done in stage IA and IB. If the tumour
stage is advanced (stage II-IV) the best options in
third trimester is to consider a premature birth
to avoid delay in mother’s treatment. In earlier
gestational age the neoadjuvant chemotherapy
during pregnancy should be taken in consideration
by a multidisciplinary group and according to the
patient’s will(8).
The surgical approach (laparoscopic or
laparotomic) should be established considering the
gestational age, the patient’s history of previous
surgery, the likelihood of pelvic adhesions and the
mass’(22,23). Laparoscopy is as safe as laparotomy
up to 32 weeks of gestation(24) and should be
preferred when possible because it seems to
cause less preterm uterin contractions , even if
there is not an evidence of difference in preterm
delivery rate and intrauterine foetal demise(25).
The increased risk of emergency surgery versus
elective surgery is not confirmed(6,25).
List of abbreviations
BOT: borderline ovarian tumour.
MRI magnetic risonance imaging
COMPETING INTERESTS
All authors declare no conflict of interests.
39
2016, 28: N.2
REFERENCES
1) Mukhopaddhyay A, Shunde A, Naik R. Ovarian cyst
and cancer in pregnancy. Best Pract Res Clin Obstet
Gynaecol 2016. pp 58-72
2) Hoover K, Jenkins TR. Evaluation and management
of adnexal mass in pregnancy. Am J Obstet Gynecol.
2011. pp 97-102
3) Xie M, Zhang X, Wang W, Hua K. Benign pelvic
masses masquerading as adnexal cancer during
pregnancy on ultrasound: A retrospective study of 5
years. Mol Clin Oncol 2015. pp 1395-1397
4) Aggarwal P, Kehoe S. Ovarian tumours in pregnancy:
a literature review. Eur J Obstet Gynecol Reprod Biol.
2011. pp 119-24
5) Marret H, Lhomme¥ C, Lecuru F, Canis M, Leveque
J, Golfier F et al. Guidelines for the management of
ovarian cancer during pregnancy. Eur J Obstet Gynecol
Reprod Biol. 2010 pp 18-21
6) Whitecar MP, Turner S, Higby MK. Adnexal masses
in pregnancy: A review of 130 cases undergoing
surgical management. Am J Obstet Gynecol. 1999. pp
19-24
7) Navqui M, Kaima A. Adnexal masses in pregnancy.
Clin Obstet Gynaecol 2015. pp 93-101
8) Kyung MS, Choi JS, Hong SH et al. Elevated CA 19-9
levels in mature cystic teratoma of the ovary. Int J Biol
Markers. 2009. pp 52-6
9) Tomao F, Peccatori F, del Pup L, Franchi D, Zanagnolo
V, Panici PG, Colombo N. Special issues in fertility
preservation for gynaecologic malignancies. Crit Rev
Oncol Hematol. 2016. pp 206-219
10) du Bois A, Trillish F, Mahner S, Heitz F, Harter
P. Management of borderline ovarian tumors. Ann
Oncol. 2016
11) du Bois A, Ewald-Riegler N, de Gregorio N. et al.
Borderline tumours of the ovary: a cohort study of
the Arbeitsgmeinschaft Gjnäkologische Onkologie
(AGO) Study Group. Eur J Cancer 2013. pp 1905-1914
12) Powless CA, Aletti GD, Bakkum-Gamez JN, Cliby
WA. Risk factors for limph node metastasis in apparent
early-stage epithelial ovarian cancer: implications for
surgical staging. Gynaecol Oncol. 2011. pp 536-540
13) TropÈ CG, Kaern J, Davidson B. Borderline ovarian
40
tumours. Best Pract Res Clin Obstet Gynaecol. 2012. pp
325-36
14) Fauvet R, Brzakowski M, Morice P, Resch B,
Marret H,Graesslin O et al. Borderline ovarian tumors
diagnosed during pregnancy exhibit a high incidence
of aggressive features: results of a French multicenter
study. Ann Oncol.2012. Pp 1481-7
15) Yacobozzi M, Nguyen D, Rakita D. Adnexal masses
in pregnancy. Semin Ultrasound CT MR. 2012. pp 55-64
16) Cho H, Kyung M.S. Serum CA19-9 as a Predictor
of Malignancy in Primary Ovarian Mucinous Tumors:
A Matched Case-Control Study. Med Sci Monit. 2014.
pp 1334-9
17) Ercan S, Kaymaz O, Yucel N. Serum concentrations
of CA 125, CA 15-3, CA 19-9 and CEA in normal
pregnancy: a longitudinal study. Arch Gynecol Obstet.
2012. pp 579-84
18) Bernhard LM, Klebba PK, Gray DL. Predictors of
persistence of adnexal masses in pregnancy. Obstet
Gynecol. 1999. pp 585-9
19) Yen CF, Lin SL, Murk W. . Risk analysis of torsion
and malignancy for the adnexal masses during
pregnancy. Fertil Steril. 2009. pp 1895-902
20) Bignardi T, Condous G. The management of
ovarian pathology in pregnancy. Best Pract Res Clin
Obstet Gynaecol. 2009. pp 539-48
21) Horowitz NS. Management of adnexal masses in
pregnancy. Clin Obstet and Gynaecol. 2011. pp 519-527
22) Mathevet P, Nessah K, Mellier G. Laparoscopic
management of adnexal masses in pregnancy: a case
series. Eur J Obstet Gynecol Reprod Biol. 2003. pp
217-22
23) ACOG Committee on Obstetric Practice. ACOG
committee opinion No 474: non obstetrics surgery
during pregnancy. Obstet Gynaecol 2011. 420-421
24) Weiner E, Mizrachi Y, Keidan R.. Laparoscopic
surgery performed in advanced pregancy compared
to early pregnancy. Arch Gynaecol Obstet. 2015. pp
1063-68
25) Webb KE, Sakhel K, Chauhan SP, Abuhamad AZ.
2015. Adnexal mass during pregnancy: a review. Am J
Perinatol. pp 1010-16
Italian Journal of
Marta Mancini1,2, Francesco Cassanelli1,2, Nicola Santomarco1, Matteo Collamarini1,2,
Arianna Olivieri1,2, Emilio Piccione2, Michelangelo Boninfante1
1
2
Department of Obstetrics and Gynecology: Ospedale Generale Madre Giuseppina Vannini, Rome-Italy
Specialization School of Obstetrics and Gynecology, University of Rome Tor Vergata, Italy
ABSTRACT
Interstitial pregnancy is a rare form of ectopic pregnancy
with a significant risk for morbidity(1). A 27-year-old
woman was brought to the emergency department
with vaginal spotting bleeding and serum ß hCG levels
up to 7900 mUI/mL. The trans-vaginal ultrasound
scan showed a normal uterus with an endometrial
thickness of 13 mm; near the left uterine horn, there
was a mass characterized by an oval shape of 24x25x18
mm with a mixed echogenic pattern and a moderate
vascularization at Color-Doppler investigation which
was suggestive for a cornual/interstitial pregnancy.
During the next controls the ß hCG levels increased
until 9156 mlU/mL, for this reason it was proceed
with a laparoscopy. During laparoscopy an ectopic
pregnancy was diagnosed in the left uterine horn.
Complete salpingectomy was performed. Interstitial
(IP) and corneal (CP) pregnancies should be considered
as two different clinical situations. It is important to
enhance the clinician’s suspicion about interstitial/
cornual pregnancy(2). Laparoscopic approach represents
the treatment of choice for reducing maternal risks and
obtaining the patient’s best outcome(3).
SOMMARIO
La gravidanza interstiziale rappresenta una rara
localizzazione di gravidanza ectopica associata ad un
elevato tasso di morbidità. Una donna di 27 anni è giunta
in Pronto Scoccorso per perdite ematiche vaginali e con
livelli di ß hCG di 7900 mUI/mL. L’ecografia pelvica
trans-vaginale ha mostrato un corpo uterino nella norma
con spessore endometriale di 13 mm; in prossimità
dell’angolo cornuale sinistro dell’utero si è evidenziato
una formazione a contenuto misto, di forma ovalare,
di mm 24x25x18, dotata di discreta vascolarizzazione
al Color-Doppler, riferibile a gravidanza ectopica
cornuale/interstiziale. Nei controlli successivi le ß
hCG sono aumentate di 9156 mlU/mL, per cui si è
deciso di procedere con la laparoscopia. Nel corso di
tale procedura, è stata diagnosticata una gravidanza
ectopica interstiziale sinistra per cui è stata effettuata
una salpingectomia totale sinistra. È importante fare
diagnosi differenziale tra gravidanza ectopica di tipo
interstiziale o cornuale per rendere più appropriata
la scelta terapeutica chirurgica e favorire un miglior
outcome della paziente.
Keywords: Ectopic pregnancy; interstitial pregnancy;
laparoscopic treatment; salpingectomy
INTRODUCTION
IP represents approximately 1–3% of ectopic
pregnancies (EP) (2). In an IP, the embryo is
implanted at the proximal site of the fallopian
tube, which is embedded within the muscular
wall of the uterus(4). This site is a highly vascular
area near the anastomosis of the ascending uterine
and tubo-ovarian vessels(5). A diagnosis is usually
delayed because of such a rare position and the
maternal mortality rate related to it is 2.0–2.5%(1).
DOI: 10.14660/2385-0868-41
CASE PRESENTATION
A 27-year-old nulliparous woman was
referred to the emergency room of our hospital on
March 2016 with spotting bleeding. The woman
referred irregular menstrual periods. Her medical
history included smoking (20 cigarettes per
day) and no past or current medical problems.
On arrival, her vital parameters were normal.
Vaginal examination revealed bleeding, no uterine
dilatation, no uterine contractions or abdominal
pain and tenderness. Speculum inspection was
unremarkable. In addition, laboratory evaluation
revealed that hematocrit was 37.5%, hemoglobin
41
2016, 28: N.2
12.3 gr/dl, white cell blood count 11.4 x 103 /
mL, normal liver and kidney function tests. Her
βhCG value was 7900 mlU/mL. The ultrasound
examination showed no evidence of a gestational
sac in the uterine cavity, nor in the adnexal region.
In the suspicion of an EP, the woman was admitted
to our obstetric department for observation of the
evolution of the pregnancy. The day after, clinical
examination was identical. A second transvaginal
ultrasound scan was performed and it showed “a
normal uterus with an endometrial thickness of
13 mm (Figure 1); near the left horn of the uterus
presence of a mass characterized by an oval shape
of 24x25x18 mm with a mixed echogenic pattern
and a moderate vascularization at Color-Doppler
investigation, suggestive for a cornual/interstitial
pregnancy (Figure 2). Presence of free abdominal
fluid in Douglas cavity”.
Figure 1.
Fig. 1 Normal uterus with an endometrial thickness of 13 mm.
42
Figure 2.
Near the left horn of the uterus presence of a mass characterized by
an oval shape of 24x25x18 mm with a mixed echogenic pattern and a
moderate vascularization at Color-Doppler investigation, suggestive
for a cornual/interstitial pregnancy.
βhCG levels increased up to 8043 mlU/mL
and, finally, up to 9156 mlU/Ml in 24 hours. The
surgical approach was necessary into account
of clinical condition and of βhCG levels, that
contraindicate a medical treatment (Methotrexate)(6).
The woman decided to proceed with surgery. A
traditional laparoscopic approach was preferred.
During the procedure, a left interstitial EP
(maximum diameter 3-4 cm) was found (Figure
3) with an extended adherence syndrome
that included both the adnexa and hepatodiaphragmatic and hepato-renal regions. This
pathological pattern suggested a previous Pelvic
Inflammatory Disease (PID).
Figure 3.
Laparoscopic diagnosis of left interstitial ectopic pregnancy.
Figure 4.
A complete left salpingectomy performed with a Bipolar Biclamp
applied in the proximal interstitial-isthmic portion and Surgiflo
Hemostatic Matrix in the left cornual region.
M. Mancini et al.
The tube with EP could not be salvaged. For
this reason, a complete left salpingectomy was
performed with a Bipolar Biclamp applied in the
proximal interstitial-isthmic portion and Surgiflo
Hemostatic Matrix in the left cornual region
(Figure 4).
Finally, the adherences were removed by
adhesiolysis. The patient was discharged from
the hospital without complications on the second
postoperative day. At the demission, a serial
dosage of serum βhCG levels was suggested to
the patient every week for the follow-up until
the βhCG titer became negative. Furthermore,
it was prescribed transvaginal ultrasound
control and clinical examination after 15 days.
An important advice for the patient was not to
get pregnant for 1 year after the surgery. After
two weeks, histopathological report confirmed
the laparoscopic diagnosis: interstitial ectopic
pregnancy.
DISCUSSION
Cornual and interstitial pregnancies are
two rare subtypes of EP characterized by the
implantation of the gestational sac in the uterine
horns or into the proximal portion of the fallopian
tube. These conditions present a significantly
greater propensity to expand before rupture if
compared with the distal portion(7). For these
reasons, IP may remain asymptomatic until 7–16
weeks’ gestation, timing at which tubal rupture
may result in catastrophic, life-threatening
maternal hemorrhage(8,9). CP, on the other hand,
refers to a pregnancy that develops in a horn of
a bicornuate uterus, with highly variable clinical
outcomes that are particularly related to the
size of the uterine horn involved(4). However,
the two terms are often used interchangeably in
the medical literature and in clinical practice.
Today, the use of sensitive β-human chorionic
gonadotropin (β-hCG) assay and transvaginal
ultrasound permits earlier diagnosis(10) of IP. But
the final diagnosis is usually made at the time of
surgery(11). Once a diagnosis of IP is suspected,
multiple factors should be considered to determine
whether surgical or medical treatment is indicated.
These factors include clinical presentation and
features of EP, gestational age at diagnosis,
contraindications to medical therapy and patient
preference. Early diagnosis may potentially allow
conservative treatment thus minimizing morbidity
and mortality rates. Formerly, treatment options
for IP mainly relied upon laparotomy (3) .
Conservative laparoscopic treatment is now
the preferred surgical approach in cases of EP
that are not eligible for medical treatment. The
Royal Collage of Obstetricians and Gynecologist
recommends that the women with EP who are
most suitable for medical (Methotrexate) therapy
are those with minimal symptoms and low serum
β-hCG levels (<3000 IU/l). Even in women
with significant hemoperitoneum, laparoscopic
surgery can be safely conducted by experienced
laparoscopic surgeons if hemodynamic stability
is achieved through perioperative management.
Laparoscopic treatment per se offers several
advantages over laparotomy. These include
lower surgical morbidity, shorter hospital stay,
faster return to normal activities, and decreased
healthcare cost (12). Conservative laparoscopic
treatment may potentially remove the EP while
preserving uterine architecture(13). It does not
appear necessary to routinely monitor serum
β-hCG levels postoperatively in women diagnosed
with tubal miscarriages undergoing complete
salpingectomy. On the contrary, it is advisable for
a ruptured EP or in cases of salpingectomy where
there is thought to be spillage of trophoblast(14).
Expectant management of EPs that are located in
the distal tube has been shown to be an acceptable
approach in the presence of a spontaneously
declining serum β-hCG level in an asymptomatic
woman(15). Nonetheless expectant management
may also potentially be associated with uterine
rupture leading to severe maternal morbidity,
unpredictable course to resolution (even with
declining β-hCG levels) and the need for
prolonged hospitalization. Risk of recurrence of
IP(13) and risk of uterine rupture during subsequent
pregnancy may be also considered.
CONCLUSIONS
An early diagnosis and a correct treatment of IP
avoids invasive operations, such as a laparotomy
obtaining a favorable maternal outcome. A
successful and safe management of this condition
is possible when the treatment strategy is based on
the patient’s clinical conditions, on the evaluation
of the risk factors and on the integration of the
different available diagnostic techniques.
43
2016, 28: N.2
REFERENCES
1) S. Lau, T. Tulandi. Conservative medical and surgical
management of interstitial ectopic pregnancy. Fertil
Steril, 72 (1999), pp. 207–215.
2) E. Kagan Arleo, E. M. DeFilippis Cornual, interstitial,
and angular pregnancies: clarifying the terms and a
review of the literature. NY Presbiterian/Weill Cornell,
New York, NY, USA, 2014 763-770.
3) Grobman WA, Milad MP: Conservative laparoscopic
management of a large corneal ectopic pregnancy.
Hum Reprod 1998;13:2002–2004.70 Hill A.
4) S. Dilbaz, B. Katas, B. Demir, B. Dilbaz Treating
cornual pregnancy with a single methotrexate
injection: a report of 3 cases. J Reprod Med, 50 (2005),
pp. 141–144.
5) M.M. Chou, J.J. Tseng, Y.C. Yi, W.C. Chen, E.S. Ho.
Diagnosis of an interstitial pregnancy using fourdimensional volume contrast imaging. Am J Obstet
Gynecol, 193 (2005), pp. 1551–1553.
6) Lau S, Tulandi T: Conservative medical and surgical
management of interstitial ectopic pregnancy. Fertil
Steril 1999.
7) Moawad NS, Mahajan ST, Moniz MH, Taylor SE,
Hurd WW: Current diagnosis and treatment of
interstitial pregnancy. Am J Obstet Gynecol 2010; 202:
15–29.
8) Tulandi T, Al-Jaroudi D: Interstitial pregnancy:
results generated from the Society of Reproductive
44
Surgeons Registry. Obstet Gynecol 2004; 103: 47–50.
9) Fylstra DL: Ectopic pregnancy not within the (distal)
fallopian tube: etiology, diagnosis, and treatment. Am
J Obstet Gynecol 2012; 206: 289–299.
10) Larrain D, Marengo F, Bourdel N, Jaffeux P, AubletCuvelier B, Pouly JL, Mage G, Rabischong B: Proximal
ectopic pregnancy: a descriptive general populationbased study and results of different management
options in 86 cases. Fertil Steril 2011;95:867–871.
11) G. Cucinella, A. Perino: Interstitial pregnancy: a
road map of surgical treatment based on a systematic
review of the literature. Gynecol Obstet Invest 2014;
141-149.
12) Baumann R, Magos AL, Turnbull A: Prospective
comparison of video pelviscopy with laparotomy for
ectopic pregnancy. BJOG 1991; 98:765–771.
13) Royal College of Obstetricians and Gynaecologists:
The management of tubal pregnancy. Guideline No.
21, May 2004. Reviewed 2010.
14) Bora SA, Kirk E, Daemen A, Timmerman D, Bourne
T: Is serum human chorionic gonadotrophin follow-up
necessary after suspected spillage of trophoblast at the
time of laparoscopic surgery for ectopic pregnancy?
Gynecol Obstet Invest 2011;71:225–228.
15) Maymon R, Shulman A: Controversies and
problems in the current management of tubal
pregnancy. Hum Reprod Update 1996;2:541–551.
Italian Journal of
Transient osteoporosis and pathological fractures in pregnancy
and puerperium: a case report and review of literature
Guido Formelli1, Giorgio Scagliarini1,Mauro Girolami2, Giuseppe Mignani2
1
2
UO Ostetricia e Ginecologia Bentivoglio, AUSL Bologna, Italia
UO Ortopedia Bentivoglio, Istituto Ortopedico Rizzoli Bologna, Italia
ABSTRACT
Spontaneous pathological fractures of the pelvic bones
and the femoral neck occuring during the last three
months of pregnancy or immediately after delivery are
often underestimated and misinterpreted.
Early diagnosis and a prompt evaluation of symptoms
and signs can prevent more serious orthopedical
complications and physical limitations of the women in
their family and work activities. We describe a recent
clinical case under our observation 20 years after the
pubblication of a previous report on the same subject.
Keywords: Pregnancy; pelvic bones; spontaneous
fractures.
INTRODUCTION
Orthopaedic problems during pregnancy and
puerperium are very frequent but fortunately
most are of a benign nature resulting in a complete
recovery. We need to consider in particular painful
osseous-articular syndromes, which are usually
located in the pelvic girdle and spinal column and
are related to fetal intrauterine development,
diastasis of the pubic symphysis and sacrum-iliac
joints, coccyx lesions, an increase in weight and
last but not least, bad body posture. Traumatic
musculoskeletal-lesions occurring during labour
and delivery have also been described(1).
Of a rarer nature but more insidious, due
to possible sequelae, are the spontaneous
DOI: 10.14660/2385-0868-42
SOMMARIO
Durante la gravidanza possono verificarsi fratture
patologiche spontanee soprattutto a livello delle
ossa del bacino e del collo femorale. Queste fratture
sono probabilmente più frequenti di quanto si creda
perchè non vengono diagnosticate o confuse con altre
sindromi osteo-articolari. Una diagnosi precoce è invece
fondamentale per i necessari provvedimenti impedendo
lo sviluppo di limitazioni funzionali che andrebbero ad
interessare donne giovani nel pieno delle attività
lavorative e famigliari. Descriviamo un caso
capitato recentemente alla nostra osservazione come
aggiornamento di un medesimo report di circa 20 anni
fa.
pathological fractures of the pelvic ring and of
the femoral neck which can occur during the last
three months of pregnancy or immediately after
delivery. These cases are probably more frequent
than believed, difficult to determine and certainly
underestimated or misinterpreted(2,3).
An early diagnosis of this disease at the first
sign of premonitory symptoms is essential in
allowing us not only to control and treat the
symptomatology but also to prevent pathological
fractures, bone non unions and possible physical
limitations, particularly serious for young women
involved in work and family activities. A recent
clinical case under our observation has induced
and stimulated us to review the international
literature and the state of the art 20 years after
the publication of a previous report on the same
subject(4).
45
2016, 28: N.2
CASE STUDY
A 34 year old woman 160 cm tall,weighing 59
kg, primipara in her 3rd pregnancy at 41st week of
amenorrhoea, was admitted to the maternity ward
of Bentivoglio Hospital at 2.01 am in labour. The
course of her pregnancy had been normal, but in
the last three weeks she complained of a pain in
her left hip when weight bearing. There was no
history of any previous trauma.
Blood test levels were normal.
At 2.28 am the patient gave birth to a male
weighing 3395gm, Apgar 10-10.
During the first few days after birth, left hip
pain and mobility reduction in the lower left
limb persisted, so the patient was visited by an
orthopaedic consultant and x rays of the pelvis
were performed. A compound fracture of the left
ileo-pubiscus ramus was evidenced (Figure 1).
The consultant advised bed rest for 2 weeks and
to walk for small distances with two crutches for a
further 20 days until the pain ceased. A complete
recovery was reached about 90 days later.
Figure 1.
Compound fracture of the ileo-pubicus ramus.
DISCUSSION
46
Low back pain, lumbar sciatica, hip and
coccyx pain are very frequent in the last months
of pregnancy and are usually considered to be
caused by mechanical events, normal weight
increase during the last three month period, a
change in posture due to a lumbar hyperlordosis,
Spontaneous pathological fractures in pregnancy
or caused at the time of delivery. However hip
pain can conceal a bone density reduction, that
can lead, fortunately in few cases, to a pathological
fracture(1,2).
Transient osteoporosis before and post partum
is a little known clinical syndrome; the event of
pathological fractures are certainly more frequent
than the small number of cases recorded in the
scientific literature(7). It is interesting to note that in
almost 20 years since the ten cases recorded in our
previous report, at the present time only twelve
more cases have been reported(5,6,7).
The occurrence of fractures depends on the
seriousness of the clinical case and the areas
involved and is usually more frequent for the
femoral neck, the ribs, the vertebral column and
more rarely the ischiopubic rami.
The mother’s weight and age, fetal weight and
prolonged labour don’t seem to be risk factors. The
majority of these patients however have a family
history of osteoporosis and low levels of calcium
and vitamin D intake and low sunlight exposure,
even if there is a physiological increase in calcium
absorption during pregnancy(5).
The pathogenesis of this condition however
remains unknown, whether described as transient
osteoporosis or as algodystrofia.
Anglo-American and French orthopaedic
schools have different opinions on these fractures
: respectively as a result of a transient osteoporosis
occurring during pregnancy and lactation or
included in the vast chapter of algodystrophy
the pathogenesis of which is only partially
understood.
According to these authors, pregnancy and
lactation can cause a calcium bone content
reduction which varies from 3% to 7% according
to fetal and neonatal needs , quickly reintegrated
after weaning and not correlated to a future
osteoporosis risk in post menopause(8,9,10).
Most probably more factors are involved
such as hormone levels, constitution, posture,
body movement and the vascular condition of
the patient. Multiple changes in fact influence
bone metabolism in pregnancy, such as increase
in calcium request by the fetus, especially during
the last month of bone mineralization, change in
nutritional habits and physical activity, as well
as increase in hormone levels in puerperium
or clinical pathological diseases in pregnancy
resulting in hyperaemia of the pelvis.
Much is still to be studied and understood
about the changes in bone structure during
pregnancy and if these changes are the direct
consequence of pregnancy, or occur due to genetic
Spontaneous pathological fractures in pregnancy
factors already existing before pregnancy.
The pain usually sets in a sudden and
unexpected way with limping and sometimes
reduced hip mobility. The symptomatology
depends on the entity of the bone damages;
obesity, strong mechanical pain, accentuated by
weight bearing and movement, which disappears
after rest, must be considered a predictive fracture
risk symptom.
Diagnosis is achieved mainly at a radiological
and specialistic level, but can involve differential
diagnostic problems with a simple overloaded
throcanteric bursitis, a tubercular coxitis, a septic
arthritis, an idiopathic femoral head necrosis and
last but not least, lytic bone metastases.
Rest and reduction in weight bearing are the
best course of action in eliminating the problem.
The treatment however is not well defined
even if calcium, vitamin D and occasionally
biphosphonates are often prescribed.
As in the case presented, positive progress can
be obtained and the problem is resolved in 2 to
3 months. The diagnosis of these cases may be
hindered by the uncommon use of x-rays during
pregnancy, although during the last three months,
the possible negative effects for the fetus are
reduced.
Other exams, like MRI and ultrasonography,
are not dangerous in pregnancy but rarely are a
REFERENCES
1) Miller MJ, Low LK,Zielinski R.,Smith AR,De Lancey
JOL,Brandon C. Evaluating maternal recovery from
labor and delivery: bone and levator ani injuries.Am J
Obst Gyn 2015, 213, 188-201
2) Karlsson MK,Ahlborg HG,Karlsson C..Maternity and
bone mineral density. Acta Orthop 2005,76, 2-13,
3) Karlsson C,Obrant KJ,Karlsson M.Pregnancy and
lactation confer reversible bone loss in humans.
Osteoporos Int 2001 12(10) 828-34
4) Mignani G,Rotini R,Marchiodi L,Bianco T. Le fratture
del collo femorale da osteoporosi gravidica. Giornale
Italiano di Ortopedia e Traumatologia. 1994 ,XX,4,
523-31
5) Di Gregorio S,Danilowicz K.,Rubin Z., Mautalen C.
Osteoporosis with vertebral fractures associated with
pregnancy and lactation. Nutrition 2000; 16(11-12)
1052-5
G. Formelli et al.
useful support in diagnosis.
The x-ray shows a typical uniform low
density, rarely patchy images of the femural head
and the ischio-pubic rami (a characteristic of
algodystrophia). Instead the MRI scans in the study
of the hip in its initial stages can be inadequate,
with results in common and similar images to
avascular idiopathic osteonecrosis. In the event
of hip pain in the last three months of pregnancy,
a simple suspect or an early diagnosis, that lead
to a reduction or elimination of weight bearing
can avoid the emergence of pathological fractures
leading to successive possible complications such
as bone necrosis and bone non unions.
In the presence of pathological fractures,
above all concerning the proximal femur, an
early diagnosis is mandatory in conserving the
femur integrity, whereas in the case of a late
diagnosis it is nearly always necessary (as has
been described in two of our old cases reported),
to proceed surgically with a complete prosthesis(4),
a devastating operation particularly for young
patients with high expectancy levels of physical
activity and involved in work and family activities.
Therefore, more than in any other fields,
there is a need for a continuous interdisciplinary
collaboration between obstetric and orthopaedic
consultants in order to obtain an early diagnosis
and resolution of these cases.
6) Sarli M.,Hakim C., Zanchetta J. Osteoporosis
during pregnancy and lactation.Report of eight cases.
Medicine 2005, 65 (6) 489-94
7) Stumpf UC,Kurth AA,Fassbender WJ Pregnancy
associated osteoporosis: an underestimated and
underdiagnosed severe disease.A review of two cases
in short- and long-term follow up.
Adv Med Sci 2007 ,52, 94-7
8) Ensom MH,Liu PY,Stephenson MD,Effect of
pregnancy on bone mineral density in healthy women.
Obstet Gynecol Surv 2002 57(2) 99-111
9) Kovacs CS Calcium and bone metabolism disorders
during pregnancy and lactation. Endocrinol Metab Clin
North Am 2011 40(4) 795-826
10) Khalkwarf HJ , Specker BL Bone mineral changes
during pregnancy and lactation. Endocrine 2002 17(1)
49-53
47
Italian Journal of
The timing of elective caesarean delivery at term in Lombardy:
a comparison of 2010 and 2014
Giuseppe Trojano1, Michele Vignali1, Mauro Busacca1, Sonia Cipriani2, Giovanna Esposito2,
Camilla Bulfoni3, Fabio Parazzini2,4
Dipartimento Materno Infantile – ASST FBF-Sacco, Ospedale Macedonio Melloni Università degli
Studi di Milano, Milan Italy
2
Fondazione IRCCS Cà Granda, Dipartimento Materno-Infantile, Ospedale Maggiore Policlinico,
Università degli Studi di Milano, Milan, Italy
3
Dipartimento Materno-Infantile, Ospedale Niguarda, Milan, Italy
4
Dipartimento di Scienze Cliniche e di Comunità, Università di Milano, Milan, Italy
1
ABSTRACT
Elective caesarean section (CS) before 39 completed
weeks of gestation increases likelihood of respiratory
morbidity in newborns and admissions in neonatal
intensive care. Thus, guidelines have recommended
that planned caesarean section should not be routinely
carried out before 39 completed weeks of gestation. In
this paper, we have analyzed the timing of elective CS
after 37th completed weeks of gestation in 2010 and 2014
in Lombardy, a region of the North of Italy, in order
to evaluate whether there was a measurable change
in clinical practice during the last years in the timing
of the elective CS. We analyzed data of all deliveries
Lombardy, in period of time between 1st January31th December 2010 and 1st January-31th December
2014. From all deliveries, we identified all elective CS
deliveries at term.The frequency of elective CS in 37th
and 38th week of gestation decreased respectively from
14,2% and 46,7% in 2010 to 13,7% and 44,6% in 2014
(chi square test 37-38 vs 39 or more p<0,05). Likewise
the proportion of elective CS in 39th week of gestation
increased from 28,4% in 2010 to 33,3% in 2014. This
finding was statistically significant. Similar findings
emerged when the analysis was performed separately
in strata of women who had a pregnancy with a breech
presentation and those who had a previous caesarean
section/uterine scar. In conclusion, the results of this
analysis suggest that obstetricians in Lombardy have
responded to the increasing evidence on the benefits
of delaying elective CS, but still a large number of
elective Cs at term are performed before the 39th week
of gestation.
Keywords: Elective cesarian section; week of gestation
48
DOI: 10.14660/2385-0868-43
SOMMARIO
Il taglio cesareo elettivo eseguito prima della fine
della 39 settimana compiuta di gestazione aumenta la
probabilità di morbosità respiratoria dei neonati ed i
ricoveri in terapia intensiva neonatale. Le linee guida,
pertanto hanno raccomandato che un taglio cesareo
elettivo non dovrebbe essere effettuato prima di 39
settimane compiute di gestazione. In questo articolo
abbiamo analizzato il timing del taglio cesareo elettivo
dopo la 37 settimana compiuta di gestazione nel
periodo compreso tra il 2010 e 2014 in Lombardia per
valutare se vi era stato un cambiamento quantificabile
nella pratica clinica dell’epoca di esecuzione del cesareo
elettivo durante gli ultimi anni. Sono stati analizzati i
dati relativi a tutti i parti in Lombardia nel periodo
compreso tra il 1° Gennaio 2010 e il 31 Dicembre 2010 ed
il 1° Gennaio 2014 e il 31 Dicembre 2014. Fra tutti i parti,
sono stati identificati i tagli cesarei elettivi a termine. La
frequenza dei tagli cesarei a 37 e 38 settimane è diminuita
rispettivamente dal 14.2 % e 46,7% nel 2010 al 13,7% e
44,6% nel 2014 (chi square test 37-38 vs 39 + settimane
p<0,05). Allo stesso modo la proporzione di tagli cesarei
elettivi a 39 settimane è aumentata dal 28,4% nel 2010
al 33,3% nel 2014. Questi dati sono risultati essere
statisticamente significativi. Simili risultati sono emersi
quando l’analisi è stata eseguita separatamente tra il
gruppo di donne con feto in presentazione podalica e
gruppo di donne con pregresso taglio cesareo/cicatrici
uterine. In conclusione I risultati di questa analisi
dimostrano che gli ostetrici in Lombardia hanno
risposto all’evidenza crescente dei benefici del ritardo
del taglio cesareo elettivo ma ancora un grande numero
di tagli cesarei a termine sono eseguiti prima della 39
settimana di gestazione.
G. Trojano et al.
Timing of elective cesarean section
INTRODUCTION
In the last fifteen years several studies have
suggested that elective caesarean section (CS)
before 39 completed weeks of gestation increases
likelihood of respiratory morbidity in newborns
and admissions in neonatal intensive care (1-7).
Following these results, since the mid 2000,
guidelines have recommended that planned
caesarean section should not be routinely carried
out before 39 completed weeks of gestation(8,9).
Along this line, recently the proportion of elective
CS after the 39th week of gestation has been
proposed as indicator of quality of obstetric care(10).
At our knowledge the impact in the routine
clinical practice of these guidelines in Italy have
not been investigated.
In this paper, we have analyzed the timing of
elective CS after 37th completed weeks of gestation
in 2010 and 2014 in Lombardy, a region of the
North of Italy, in order to evaluate whether there
was a measurable change in clinical practice
during the last years in the timing of the elective CS
. In conclusion, the results of this analysis suggest
that obstetricians in Lombardy have responded to
the increasing evidence on the benefits of delaying
elective CS, but still a large number of elective Cs
at term are performed before 39 week of gestation.
This is a population-based study using
data from a regional data-base. In Lombardy,
a standard form is used to register all births
and neonatal discharges from public or private
hospitals.
All admissions and discharges are codified
according to the International Classification
of Diseases 9th edition – Clinical Modification
(ICD-9-CM), Italian version. For all deliveries,
information is available for maternal age, maternal
country of birth and reason for admission.
Further at delivery, a specific form is filled by
midwifes including information on pregnancy
on maternal characteristics type of conception
(spontaneous/non spontaneous (i.e., after ART
or medically induced ovulation only), course of
pregnancy, delivery and maternal outcome at
birth (CedAP data base). Data from this data base
have been linked with the hospital discharge data
base in order to obtain detailed information on
delivery, pregnancies and maternal and paternal
characteristics. We analyzed data of all deliveries
Lombardy, in period of time between 1st January31th December 2010 and 1st January-31th December
2014.
From all deliveries, we identified all elective CS
deliveries. Further, we computed the distribution
of elective CS at term in the considered calendar
period according to week of gestation at surgery.
Gestational age was considered as completed
week of gestation. Further, we repeated the
analysis for each of these two groups: women
who had a pregnancy with a breech presentation
and those who had a previous caesarean section/
uterine scar.
According to the Italian law, this study
constituted service evaluation and did not require
ethics approval because it considered the analysis
of anonymous data collected in routine data base.
RESULTS
During the period 1st January-31th December
2010 a total of 97.407 deliveries were registered in
the CEDAP data base. The corresponding figures
for the period 1st January-31th December 2014 was
87.548.
After exclusion of records with missing
information about gestational age at birth, a total
of 17.894 elective CS were identified in 2010 and
15.299 (85,5%) of those were performed at term
(≥37 weeks of gestation). The corresponding
figures for 2014 were 15.007 and 12.634 (84,2%).
The distribution of elective CS at term
according to selected factors and calendar period
are considered in Table 1. In 2014 mothers
who underwent elective CS at term were, in
comparison with those who underwent it in 2010,
older, more frequently nulliparous and reported
more frequently a previous CS.
Table 2 considers the distribution of elective
CS at term according to the week of gestation in
2010 and 2014.
The frequency of elective CS in 37th and 38th
week of gestation decreased respectively from
14,2% and 46,7% in 2010 to 13,7% and 44,6% in
2014 (chi square test 37-38 vs 39 or more p<0,05).
Likewise the proportion of elective CS in 39th week
of gestation increases from 28,4% in 2010 to 33,3%
in 2014. This finding was statistically significant.
Similar findings emerged when the analysis was
performed separately in strata of women who had
a pregnancy with a breech presentation and those
who had a previous caesarean section/uterine
scar.
49
2016, 28: N.2
Table 1.
Distribution of elective CS at term according to selected factors and
calendar period.
Table 2.
Distribution of elective CS at term according to week of gestation,
neonatal presentation and previous CS in 2010 and 2014.
50
G. Trojano et al.
DISCUSSION
The general results of this analysis show that
during the period 2010-2014 a shift from 38th to
39th week of gestation occurred in the timing of
elective CS in Lombardy.
Before of discussing these results potential
limitations should be considered. In general
analysis based on large data set may suffer some
limitations on accuracy. In particular, we have
no information on the quality of definition of
gestational age. However, in Italy less than 4% of
pregnant women undergo the first examination
after the 12 week of gestation(11). Further any miss
classification should tend to reduce the differences
among calendar periods. We have considered
all deliveries, thus at least in part our results
may be affected by the inclusion in the analysis
of elective CS due to conditions that might
necessitate intervention before 39 weeks gestation.
It is unlikely however that the proportion of these
conditions markedly changed from 2010 to 2014.
The trend observed in our analysis is consistent
with the findings of previous large population
based studies conducted in different populations.
For example in the UK the proportion of
REFERENCES
1) van den Berg A, van Elburg RM, van Geijn HP,
Fetter WP. Neonatal respiratory morbidity following
elective caesarean section in term infants. A 5-year
retrospective study and a review of the literature. Eur J
ObstetGynecolReprod Biol. 2001;98(1):9–13.
2) Zanardo V, Simbi KA, Vedovato S, Trevisanuto D.
The influence of timing of elective cesarean section
on neonatal resuscitation risk. PediatrCrit Care Med.
2004;5(6):566–570.
3) Hansen AK, Wisborg K, Uldbjerg N, Henriksen
TB. Risk of respiratory morbidity in term infants
delivered by elective caesarean section: cohort study.
BMJ. 2008;336(7635):85–87.
4) Tita AT, Landon MB, Spong CY, Lai Y, Leveno KJ,
Varner MW, Moawad AH, Caritis SN, Meis PJ, Wapner
RJ, Sorokin Y, Peaceman AM, O’Sullivan MJ, Sibai BM,
Thorp JM, Ramin SM, Mercer BM. Eunice Kennedy
Shriver National Institute of Child Health and Human
Development (NICHD) Maternal-Fetal Medicine Units
Network (MFMU) Timing of elective repeat cesarean
delivery at term and neonatal outcomes. N Engl J Med.
2009;360(2):111–120.
5) Clark SL, Miller DD, Belfort MA, Dildy GA, Frye DK,
Meyers JA. Neonatal and maternal outcomes associated
with elective term delivery. Am J ObstetGynecol.
2009;200(2):e151–154. 156.
6) Farchi S, Lallo DD, Franco F, Polo A, Lucchini
R, Calzolari F, De Curtis M. Neonatal respiratory
morbidity and mode of delivery in a population-based
elective CS done between 39 and 40 weeks
increased from 39% to 63% from 2000 to 2009(12).
In the USA, organizations have begun using
indicators to monitor the proportion of elective CS
performed after 39 completed weeks on women
with an uncomplicated pregnancy(10). A recent
paper has suggested that a 95% rate of elective
delivery after 39 weeks would be a reasonable
national quality benchmark in the USA(13). In the
previous quoted UK analysis the current rate was
about 80%(12).
In conclusion, the results of this analysis
suggest that obstetricians in Lombardy have
responded to the increasing evidence on the
benefits of delaying elective CS. This analysis gives
some favorable support to the role of guideline in
improving obstetric routine practice, but still a
large number of elective Cs at term are performed
before the 39th week of gestation in Lombardy.
COMPETING INTERESTS
The authors declare that they have no
competing interests.
study of low-risk pregnancies. ActaObstetGynecol
Scand. 2009. pp. 1–4.
7) Yee W, Amin H, Wood S. Elective cesarean
delivery, neonatal intensive care unit admission,
and neonatal respiratory distress. Obstet Gynecol.
2008;111(4):823–828.
8) National Collaborating Centre for Women’s and
Children’s Health. Caesarean section: Clinical
Guideline. 2004.
9) ACOG Committee Opinion No. 394, December 2007.
Cesarean delivery on maternal request. ObstetGynecol.
2007;110(6):1501.
10) Main EK. New perinatal quality measures from the
National Quality Forum, the Joint Commission and
the Leapfrog Group. CurrOpinObstetGynecol. 2009.
11) Certificato di assistenza al parto (CedAP) Analisi
dell’evento nascita http://www.salute.gov.it/
imgs/C_17_pubblicazioni_2024_allegato.pdf
12) Gurol-Urganci I, Cromwell DA, Edozien LC, Onwere
C, Mahmood TA van der Meulen JH The timing of
elective caesaren delivery between 2000 and 2009 in
England. BMc pregnancy and childbirth 2011; 11:43
13) Clark SL, Frye DR, Meyers JA, Belfort MA, Dildy
GA, Kofford S, Englebright J, Perlin JA. Reduction
in elective delivery at < 39 weeks of gestation:
comparative effectiveness of 3 approaches to change
and the impact on neonatal intensive care admission
and stillbirth. Am J ObstetGynecol. 2010;203(5):e441–
446. 449
51
Italian Journal of
Centiles of weight at term birth according to maternal nationality in a
Northern Italian region
Fabio Parazzini1,2, Sonia Cipriani2, Giuseppe Bulfoni2, Paola Agnese Mauri1, Giorgia Carraro2,
Salvatore Andrea Mastrolia3, Mauro Busacca4, Giuseppe Trojano4
Dipartimento di Scienze Cliniche e di Comunità, Universita’ degli Studi di Milano, Milan Italy
Fondazione IRCCS Cà Granda, Dipartimento Materno-Infantile, Ospedale Maggiore Policlinico, Milan,
Italy
3
Dipartimento di Ostetrica e Ginecologia AOU Policlinico di Bari Università degli Studi di Bari, Bari,
Italy
4
Dipartimento Materno-Infantile, ASST FBF-Sacco Ospedale Macedonio Melloni, Università degli Studi
di Milano, Milan, Italy
1
2
ABSTRACT
Country specific birthweight curves may reflect the
ethnic composition of that population and may offer
information on the “true“ birth weight distribution
of new births from native and foreign mothers. In
consideration of the fact that in Italy now about 30%
new births born in foreigners, we analyzed the centiles
of weight at birth separately for the native Italian
women and foreign ones. We considered data of all
deliveries in a Northern Italian Region (Lombardy) with
a population of about 10 millions inhabitants, in period
of time between 1st January 2010 and 31th December 2014.
Gestational age was considered as completed week of
gestation. On the basis of these data we computed the
10th, 50th and 90th centile values of neonatal birthweight
from the 37th to 42nd week of gestation at delivery for
the total population and separately for native Italian
and the five more common nationality of non Italian
women (i.e. women born in Morocco, Albania and
Romania, China and Egypt). These nationality were
considered since they represent at least the 5% of all
foreigner mothers. The values of centiles were higher
in males than in females in all the gestational weeks
and the different maternal nationality populations.
Lower centiles values were observed in babies born by
Italian women, the higher been observed in babies born
by Chinese women and Maroccan and Egyptian ones
with differences of about 100-200gr among babies born
form mother with these nationality in comparison with
babies born by Italian mothers. This descriptive analysis
of centiles of weight at birth in Lombardy provides
Italian obstetricians and neonatologist with curves of
fetal growth more closely representing the population
under curve.
Keywords: Centiles; birth; weight
52
DOI: 10.14660/2385-0868-44
SOMMARIO
Curve di peso alla nascita specifiche di una area
geografica riflettono la composizione etnica di quella
popolazione e possono offrire informazioni sulla
“vera” distribuzione del peso nascita di nuove nascite
da madri autoctone e straniere. In considerazione del
fatto che in Italia ormai circa il 30% di nuovi nati nasce
da madri straniere, abbiamo analizzato i centili di peso
alla nascita separatamente per i nati da donne italiane
native e da donne nate in altre nazioni. Abbiamo
preso in considerazione i dati di tutte i parti avvenuti
in Lombardia nel periodo compreso tra il 1° gennaio
2010 ed il 31 dicembre 2014. Sulla base di questi dati
abbiamo calcolato il valore del 10°, 50° e 90° centile di
peso alla nascita per i nati a termine (37°-42° settimana
di gestazione al parto) per la popolazione totale e
separatamente per le madri nate in Italia e le madri
nate nelle cinque nazioni più comuni tra le donne non
italiane (Marocco, Albania e Romania, Cina ed Egitto).
I valori dei centili erano più alti nei maschi rispetto alle
femmine in tutte le settimane di gestazione e le diverse
nazionalità della madre. Sono stati osservati valori
inferiori dei centili nei bambini nati da donne italiane,
i più alti valori dei centili sono stati osservati nei
bambini nati da donne cinesi, marocchine ed egiziane
con differenze di circa 100-200gr tra i bambini nati da
madri con queste nazionalità rispetto ai bambini nati
da madri italiane . Questa analisi descrittiva dei centili
di peso alla nascita in Lombardia offre agli ostetrici
ed ai neonatologi curve di crescita fetale che meglio
rappresentano la nostra popolazione.
F. Parazzini et al.
Centiles of weight at birth in Lombardy
INTRODUCTION
The available percentiles of weight at birth
by gestational age vary widely. Published data
shown, for the same gestational week, differences
of hundreds of grams for the median values or
for the 5th and 95th percentiles(1-5). Part of these
differences are due to the criteria used for the
definition of study births. For example, some
studies have excluded pathological pregnancies,
but some differences are likely due to the different
populations considered. In fact maternal ethnicity
is a determinant of low birth weight.
It has been suggested that birthweight centiles
are generally higher among term infants born
to mothers who immigrate in elevated income
countries than those of infants born in their
respective native countries(6). Thus it is important
to be available data from each countries or regions.
In fact, country specific birthweight curves may
reflect the ethnic composition of that population
and may offer information on the “true“ birth
weight distribution of new births from native and
foreign mothers.
In Italy percentiles of weight at birth for
gestational age have been published in 1995
and 2010(7-9). These analysis, however, have not
presented separately the percentiles according to
maternal nation of birth.
Nowadays in Italy now about 30% new births
born in foreigners so, it is useful to analyze the
centiles of weight at birth separately for the native
Italian women and foreign ones.
Further, it has been shown that birthweight
mean increased over recent decades, thus up-todate centiles for birthweight for gestational age are
useful in clinical practice(10).
METHODS
This is a population-based study using data
from a regional data-base.
In Lombardy, a standard form is used to
register all births and neonatal discharges from
public or private hospitals.
All admissions and discharges are codified
according to the International Classification
of Diseases 9th edition – Clinical Modification
(ICD-9-CM), Italian version. For all deliveries,
information is available for maternal age, maternal
country of birth and reason for admission Further
at delivery, a specific form is filled by midwives
including information on pregnancy on maternal
characteristics type of conception (spontaneous/
non spontaneous (i.e., after ART or medically
induced ovulation only), course of pregnancy,
delivery and maternal outcome at birth (CedAP
data base). Data from this data base have been
linked with the hospital discharge data base in
order to obtain detailed information on delivery,
pregnancies and maternal characteristics.
We analyzed data of all deliveries in a Northern
Italian Region (Lombardy) with a population of
about 10 millions inhabitants, in period of time
between 1st January 2010 and 31th December 2014.
Gestational age was considered as completed
week of gestation.
On the basis of these data we computed the 10th,
50th and 90th centile values of neonatal birthweight
from the 37th to 42nd week of gestation at delivery
for the total population and separately for native
Italian and the five more common nationality of
non Italian women (i.e. women born in Morocco,
Albania and Romania, China and Egypt).These
nationalities were considered since they represent
at least the 5% of all foreigner mothers.
In the computation of centiles we used the
methods reported in previous publications(11,12)
to evaluate the quality of birthweight data, we
compared the information reported in CedAP
data-base and SDO data-base. We applied the
Tukey’s methodology(12) for identifying outliers.
For each data-base separately, we considered the
distribution of birthweight by sex and gestational
age. The cases with birthweight lower than the first
quartile minus twice the interquartile range (lower
Tukey limit) or higher than the third quartile plus
twice the interquartile range (upper Tukey limit)
were considered outliers. CedAP values were
considered in the analysis. In the cases where
CedAP value was an outlier and SDO value were
not, CedAP data-base value was corrected with
SDO data-base value. Then we applied Tukey’s
methodology to CedAP data-base distribution and
eliminated outliers cases.
RESULTS
We identified in the CedAP data-base a total of
361.756 singleton babies, born in Lombardy region
(Northern Italy) during the period 1st January 2010
to 31st December 2014. This data-base was linked
with SDO (discharge register) data-base: 8.189
(2,3%) records were deleted due to a lack of link
between the two data base
After the exclusion of cases with missing
values on gestational age, sex of newborn and
birth weight (n=2850, 0,8%) and deletion of cases
with outlier values of birthweight (n=1250, 0,4%)
we considered 349.467 newborns.
Among this, 330.007 (94,4%) term births
53
2016, 28: N.2
(gestational age ≥37 weeks) were considered in
present analysis.
The distribution of maternal characteristics
and course of pregnancy of considered births
are shown in Table 1 according to maternal
nationality. Italian women were older and
nulliparae and more frequently reported non
spontaneous conception and previous cesarean
section.
The 10th, 50th and 90th centiles of weight at birth
for gestational age in the total population and in
strata of maternal nationality are shown in Table 2.
The values of centiles were higher in males
than in females in all the gestational weeks and
the different maternal nationality populations.
Table 1.
Distribution of maternal characteristics according to country of birth.
54
Lower centiles values were observed in babies
born by Italian women, the higher been observe in
babies born by Chinese women and Moroccan and
Egyptian ones.
DISCUSSION
The objective of the present analysis is to
offer information on centiles of weight at birth
for term births in Italian and not Italian women,
considering women who delivered in the period
2010-2014 in Lombardy.
Potential limitations of this analysis should be
briefly discussed.
Information considered are based on routinely
F. Parazzini et al.
Table 2.
Centiles of weight at birth according to gestational age and maternal country of birth.
55
2016, 28: N.2
collected data base. However, the quality and
completeness of data considered was generally
satisfactory . For example there was no missing
values on birth weight and gestational week of
delivery was missing in less than 1% of cases.
We have no information on the quality of
definition of gestational age. However, in Italy,
less than 4% of pregnant women undergo the first
examination after the 12 week of gestation(13).
The results of this analysis shows differences of
about 100-200gr among babies born form mother
with different nationality in comparison with
babies born by Italian mothers. These differences
are consistent with those reported in other
countries(14). The discussion of these differences is
REFERENCES
56
1) Dobbins TA, Sullivan EA, Roberts CL, Simpson JM.
Australian national birthweight percentiles by sex and
gestational age, 1998–2007. Med J Aust.
2012;197(5):291–4;
2) Sankilampi U, Hannila ML, Saari A, Gissler M,
Dunkel L. New population-based references for birth
weight, length, and head circumference in singletons
and twins from 23 to 43 gestation weeks. Ann Med.
2013;45(5–6):446–54
3) Goldenberg RL, Cutter GR, Hoffman HJ, Foster JM,
Nelson KG, Hauth JC. Intrauterine growth retardation:
standards for diagnosis. Am J Obstet Gynecol. 1989
Aug;161(2):271-7. Review
4) Bonellie S, Chalmers J, Gray R, Greer I, Jarvis
S, Williams C. Centile charts for birthweight for
gestational age for Scottish singleton births.
BMC Pregnancy Childbirth. 2008 Feb 25;8:5. doi:
10.1186/1471-2393-8-5.
5) Fok TF, So HK, Wong E, Ng PC, Chang A, Lau J, Chow
CB, Lee WH; Hong Kong Neonatal Measurements
Working Group Updated gestational age specific birth
weight, crown-heel length, and head circumference of
Chinese newborns. Arch Dis Child Fetal Neonatal Ed.
2003 May;88(3):F229-36
6) Boshari T, Urquia ML, Sgro M, De Souza LR, Ray JG
Differences in birthweight curves between newborns
of immigrant mothers vs. infants born in their
corresponding native countries: systematic overview.
Paediatr Perinat Epidemiol. 2013 Mar;27(2):118-30
7) Parazzini F, Cortinovis I, Bortolus R, Fedele L, Decarli
A. Weight at birth by gestational age in Italy.Hum
Reprod. 1995 Jul;10(7):1862-3.
8) Gagliardi L, Macagno F, Pedrotti D, Coraiola N,
beyond the scope of this analysis. The presented
figures give the “true” centiles in Lombardy,
thus they reflect the different age and parity
distribution of mothers born in different countries.
In conclusion this descriptive analysis of
centiles of weight at birth in Lombardy provides
Italian obstetricians and neonatologist with
curves of fetal growth more closely representing
the population under cure. In particular it offers
information at our knowledge not available before
on the distribution of centiles of weight at birth
on babies born from foreign mothers in Italy and
underlines the role of using birth weight curves
tailored to maternal country of birth(15).
Furlan R, Agostini L, Milani S. Standard antropometrici
neonatali prodotti dalla task-force della Società
Italiana di Neonatologia e basati su una popolazione
italiana Nord-Orientale. Riv Ital Ped 1999; 25: 159-169.
9) Bertino E, Spada E, Occhi L, Coscia A, Giuliani F,
Gagliardi L, Gilli G, Bona G, Fabris C, De Curtis M,
Milani S. Neonatal anthropometric charts: the Italian
neonatal study compared with other European studies.
J Pediatr Gastroenterol Nutr. 2010 Sep;51(3):353-61. doi:
10.1097/MPG.0b013e3181da213e.
10) Bonellie S, Chalmers j Gray R Greer I Jarvis
S Williams C centile charts for birth weight for
gestational age for Scottish singleton births BMC
Pregnancy Childbirth 2008 Feb 25; 8:5
11) Li Z, Umstad MP, Hilder L, Xu F, Sullivan EA
Australian national birthweight percentiles by sex and
gestational age for twins, 2001-2010. BMC Pediatrics
2015:15;148.
12) Tukey JW. Exploratory data analysis, vol. 231.
Reading, MA: Addison-Wensley; 1977.
13) Certificato di assistenza al parto (CeDAP) Analisi
dell’evento nascita http://www.salute.gov.it/
imgs/C_17_pubblicazioni_2024_allegato.pdf
14) Ray JG, Sgro M, Mamdani MM, Glazier RH, Bocking
A, Hilliard R, Urquia ML. Birth weight curves tailored
to maternal world region. J Obstet Gynaecol Can. 2012
Feb;34(2):159-71
15) Marcelo L. Urquia PhD MSc , Howard Berger
MD, Joel G. Ray MD MSc; for the Canadian Curves
Consortium Risk of adverse outcomes among infants
of immigrant women according to birth-weight curves
tailored to maternal world region of origin CMAJ,
2015, 6:187(1)
Italian Journal of
Altered lamin A expression as a possible prognostic biomarker in
endometrioid endometrial cancers
Lucia Cicchillitti1, Giacomo Corrado2, Mariantonia Carosi3, Rossella Loria1,
Malgorzata Ewa Dabrowska3, Giuseppe Trojano4, Emanuela Mancini2, Giuseppe Cutillo2,
Rita Falcioni1, Giulia Piaggio1, Enrico Vizza2
Department of Research, Advanced Diagnostics and Technological Innovation, Area of Translational
Research, “Regina Elena” National Cancer Institute, Rome, Italy.
2
Department of Experimental clinical Oncology, Gynecologic Oncology Unit, “Regina Elena” National
Cancer Institute, Rome, Italy.
3
Department of Research, Advanced Diagnostics and Technological Innovation, Anatomy Pathology
Unit “Regina Elena” National Cancer Institute, Rome, Italy.
4
Department of Obstetrics and Gynaecology, ASST Fatebenefratelli-Sacco M. Melloni Hospital,
Milan, Italy
1
ABSTRACT
Endometrial cancer (EC) is a major cause of mortality
for patients worldwide. EC is classified as type I, also
called the endometrioid type (EEC), or type II based on
histologic properties. Although most cases of low grade
EECs do not behave aggressively, in rare instances,
even low-grade, well-differentiated EECs can progress
in a highly aggressive manner, and the prognosis for
recurrent or metastatic EEC remains poor. In this study,
we performed a retrospective cohort of several formalinfixed, paraffin-embedded (FFPE) specimens from
patients with EEC to find novel clinical and biological
features to help the diagnosis and consequently the
treatment EEC. Total RNA and proteins were extracted
and analyzed, respectively, by quantitative PCR and
western blotting. We found that alteration of lamin
A levels is associated with EEC development, thus
indicating its possible role as novel potential biomarker.
Interestingly, loss of lamin A was consistently associated
with lower estrogen receptor (ERs) expression in low
grade EEC, whereas in higher grade it was significantly
related with E-cadherin mRNA (CDH1) reduced
levels. Our data strongly indicate lamin A as a novel
predictive biomarker of aggressiveness with a potential
for a more systematic integration in clinical practice for
individualized therapy in EEC.
Keywords: Endometrioid Endometrial Cancer, Estrogen
Receptor, Lamin A, E-Cadherin.
DOI: 10.14660/2385-0868-45
SOMMARIO
Il cancro dell’endometrio è una delle principali cause
di mortalità per i pazienti in tutto. E’ classificato,
in base alle caratteristiche istologiche, in due tipi, il
tipo I, chiamato anche tipo endometrioide (EEC), e
il tipo II. Sebbene la maggior parte dei casi di basso
grado non si comportino in modo aggressivo, in rari
casi, anche i tumori dell’endometrio di basso grado e
ben differenziato possono progredire in modo molto
aggressivo e la prognosi in caso di recidiva o metastasi
a distanza rimane infausta.
In questo studio, abbiamo condotto una analisi
retrospettiva su diversi tessuti inclusi in paraffina
(FFPE) da pazienti con tumore di tipo endometrioide
(EEC) allo scopo di identificare nuovi markers per
aiutare la diagnosi e di conseguenza il trattamento dei
tumori dell’endometrio. In questo studio L’RNA e le
proteine estratti sono stati analizzati rispettivamente
mediante PCR quantitativa e western blotting.
Abbiamo osservato che alterati livelli di lamin A sono
associati allo sviluppo del tumore dell’endometrio,
indicando il suo possibile ruolo come potenziale
biomarcatore. La diminuzione dei livelli di lamin A
è strettamente associata a riduzione dei livelli dei
recettori degli estrogeni nei tumori di basso grado,
mentre è associata in maniera significativa a riduzione
di espressione di mRNA di E-Caderina (CDH1) nei
tumori di alto grado.I nostri studi indicano la Lamin A
come un nuovo biomarcatore prognostico da utilizzare
nella pratica clinica per il trattamento personalizzato
del cancro dell’endometrio.
57
2016, 28: N.2
INTRODUCTION
58
Endometrial cancer (EC) is a major cause of
mortality for patients worldwide. Most EC cases
are sporadic, with only 10% considered familiar(1).
In general, patients with EC have a good prognosis
since early diagnosis is frequent and the disease
has usually not spread beyond the uterus. EC is
clinically classified into two groups to assess the
risk for metastatic and recurrent disease, type I
and type II. Type I, also called the endometrioid
type (EEC) because of its histologic similarity
to the endometrium, accounts approximately
70–80% of sporadic EC and is characterised by
hyperoestrogenic risk factors, low stage and
grade, and favourable outcome. By contrast, type
II cancers are associated with higher patient age,
high stage and grade, non-endometrioid histology,
and poor prognosis. However, the clinical and
prognostic value of this distinction is suboptimal
with substantial phenotypic overlap; about 20% of
type I cancers recur with a median survival of 7–12
months, while 50% of type II cancers do not(2). EC
patients require more effective systemic therapy
than is presently available to well selected patient
populations to increase the likelihood of benefits.
In order to improve therapy it is important to
understand the processes which inhibit and
stimulate cancer progression. Currently, adjuvant
and systemic treatment of recurrent and metastatic
EC are based on conventional chemotherapy and
anti-hormonal treatment.
The cellular action of estrogens is mediated
trough the estrogen receptors (ERs) that belong
to the nuclear steroid receptor superfamily. Two
distinct ERs, defined as ER-α and ER-β, have
been identified. In the human uterus, ER-α is the
predominant subtype(3-5). Expression of ERs has
been correlated with stage, histologic grade and
survival(6-7). Loss of ERs has been significantly
associated with aggressive phenotype and poor
survival in EC patients. In particular, early
stage, well differentiated ECs usually retain ERs
expression, whereas advanced stage, poorly
differentiated tumours often lack one or both
receptors. Recently, it has also been observed an
association between lack of ER-α and epithelialmesenchymal transition (EMT)(8).
EMT enables epithelial cells to acquire a like
mesenchymal potential with increase motility
and ability to extravasate and circulate. The
process of EMT is associated with the progressive
redistribution or downregulation of the apical
and basolateral epithelial cell-specific tight and
adherens junction proteins such as E-cadherin and
cytokeratin, and novel expression of mesenchymal
Lamin A as novel molecular prognostic biomarker for EC
molecules such as vimentin and N-cadherin.
Importantly, some promising studies showed that
targeting EMT markers might be an interesting
and successful tool in future cancer therapy(9-11).
In EC, aberrant expression of major EMT markers
have been identified in metastatic disease and
associated with adverse prognosis, such as such
as lower expressions of E-cadherin and alphacatenin, and overexpressions of N-cadherin, betacatenin, vimentin, and matrix metalloproteinases,
thus indicating the prognostic impact of EMT
status(12).
Numerous studies suggest that reduced or
absent lamin A expression is a common feature
of a variety of different cancers, including small
cell lung cancer (SCLC), skin basal cell and
squamous cell carcinoma, testicular germ cell
tumour, prostatic carcinoma, leukemia and
lymphomas(13-18). Expression and function of lamin
A are involved in regulation of gene expression in
health and disease through interplay with cell cycle
progression, DNA replication, signal transduction
pathways, transcription factors, chromatinassociated proteins and tissue homeostasis and the
reduction in its expression frequently correlates
with proliferative capacity and differentiation
state. Lamin A is a type V intermediate filament
(IF) protein encoded by the LMNA gene and a
major nuclear architectural protein important for
maintaining nuclear membrane inner structure
integrity and function(19).Disruption of one or
more of these functions due to lamin mutations
cause a group of inherited diseases affecting
various tissues and organs or causing accelerated
ageing(20-24).
In this study, we analysed several EEC tissues
to find novel clinical and biological features to
help the diagnosis and consequently the treatment
of early EEC. We observed a large decrease in the
levels of lamin A mRNA (LMNA) and protein
levels in EEC as compared with benign tissues.
Moreover, LMNA loss further increased in higher
grade EEC tissues. Interestingly, clustering of the
mRNA expression of ERs and LMNA indicated an
association between low expression of LMNA and
loss of ERs in low grade EECs, thus suggesting a
potential role of lamin A in EC invasiveness and
aggressiveness in less aggressive ECs. In grade
3 EECs, generally expressing very low levels
of ERs and lamin A, these correlation did not
occur. Several papers support the hypothesis that
E-Cadherin expression patterns in high-grade EC
are associated with more aggressive characters
and poor prognosis to ECs(25-27). We observed a
L. Cicchillitti et al.
significant correlation between decreased LMNA
expression with lower E-cadherin mRNA (CDH1)
levels in high grade ECs. Altogether, our findings
strongly support the potential role of lamin
A status in EC aggressiveness and its role as
prognostic biomarker in association with ER status
or with CDH1 expression in low grade or high
grade EECs, respectively. Moreover, our results
indicate that evaluation of LMNA expression
related with ERs status may be used as predictive
biomarker in low grade EECs.
Patient cohort
A retrospective cohort of formalin-fixed,
paraffin-embedded (FFPE) specimens from
patients with endometriod endometrial cancer
(EEC, n=80) and normal tissue specimens
(NE, n=13) from patients who underwent a
hysterectomy to treat other benign disease were
collected. According with the histologic grade, we
analysed 31 grade 1 (G1), 14 grade 2 (G2) and 35
grade 3 (G3) samples. Biopsies were sampled for
primary tumors in hysterectomy specimens.
RNA extraction and RT-PCR
Total RNA derived from FFPE tissues was
extracted using the PureLink™ FFPE Total
RNA Isolation Kit (Invitrogen) following
the manufacturer’s instructions and reversetranscribed using PrimeScript RT reagent
kit (Takara). The quality of the total RNA
was measured using a NanoDrop 2000
spectrophotometer (Thermo Fisher Scientific,
Wilmington DE, USA). Quantitative PCR (qPCR)
was performed using SYBR Select (Applied
Biosystems) on an ABI Prism 7500 apparatus
(Applied Biosystems). mRNA expression was
normalized for 18S rRNA levels. Relative mRNA
expression was calculated using the comparative
Ct method (2−ΔΔCt).
Primers
LMNA fw
GGACAATCTGGTCACCCGC
LMNA rv TGGCAGGTCCCAGATTACATG
ESR1 fw TACTGACCAACCTGGCAGACAG
ESR1 rv
TGGACCTGATCATGGAGGGT
ESR2 fw
AGTTGGCCGACAAGGAGTTG
ESR2 rv
CGCACTTGGTCGAACAGG
CDH1 fw
CCCACCACGTACAAGGGTC
CDH1 rv
ATGCCATCGTTGTTCACTGGA
18S rRNA fw CCTGGATACCGCAGCTAGGA
18S rRNA rv GCGGCGCAATACGAATGCCCC
Immunoblotting
The paraffin from thin sections of FFPE
specimens was melted at 72°C for 20 minutes
using heat in the presence of a specially designed
Melting Buffer contained in the PureLink™
FFPE Isolation Kit used for RNA extraction
(Invitrogen). Tissues were then separated from
the melted paraffin by centrifugation. Proteins
were extracted in a high pH lysis buffer (20 mM
Tris HCl pH 9.0, 0.2 M Glycine, 2% (w/v) SDS).
The samples were first incubated on ice for 5 min,
and mixed by vortexing, then boiled at 100°C for
20 min followed by an l hour incubation at 80°
C for 2 hours. After extraction, any remaining
unsolubilized material was pelleted at 14000 × g
for 20 minutes, and protein concentration of total
protein extracted was determined by the BCA
Protein Assay (Pierce Chemicals Co., Rockford, IL,
USA). The Pierce BCA Protein Assay is a detergent
compatible formulation and the protein standards
were prepared using the same lysis buffer as the
samples. Proteins were resolved by SDS-PAGE
and electrotransferred to nitrocellulose. Each
membrane was blocked with 5% non-fat dry milk
in Tris buffered saline-Tween-20 (TBST) for 1 hour
at room temperature and subsequently incubated
with primary antibody for 16 hours at 4˚C. The
following antibodies were used: anti-Lamin A
(Santa Cruz), and anti-β actin (Sigma-Aldrich).
Immunoreactivity was detected by sequential
incubation with HRP-conjugated secondary
antibody.
Statistical analysis
Data were reported as mean and standard
deviation. Differences were considered statistically
significant when P≤0.05. Student T test was
performed for the comparison of results from qRTPCR (*P<0.05, **P<0.01, ***P<0.001).
RESULTS
Lamin A protein and mRNA altered expression
levels are associated with EEC aggressiveness.
A retrospective study was performed in a
cohort of FFPE specimens from patients with EEC
and of benign (NE) specimens from patients who
underwent a hysterectomy to treat other benign
disease (n = 13). According with the histologic
grade, we analysed 31 grade 1 (G1), 14 grade 2
(G2), 35 grade 3 (G3) EC tissues. Biopsies were
sampled for primary tumors in hysterectomy
specimens. Histologic are represented in Table 1.
To assess the possible involvement of lamin
A in EEC, its protein expression levels were
assessed by western blotting using an anti-lamin
59
2016, 28: N.2
Table 1.
Clinicopathological features of 80 EECs. RT= adjuvant radioteraphy;
CHT=adjuvant chemoteraphy. BMI= body mass index; MI=
myometrial infiltration.
60
Figure 1A.
Representative immunoblottings of proteins extracted from benign
(NE), G1, G2 and G3 EEC FFPE tissues with anti-Lamin A
antibody. Anti-β actin was used as loading control.
A antibody. Results showed a large reduction
of lamin A protein levels in EC compared with
benign tissues (Figure 1A). To investigate if
lamin A down-modulation occurred also at
mRNA level, we performed qRT-PCR analysis.
Results displayed that LMNA levels in EECs were
significantly lower than those in corresponding
non-cancerous tissues (Figure 1B), indicating
the involvement of an altered modulation at
transcriptional levels of lamin A expression in
EECs. Interestingly, decreased LMNA expression
correlated with histological differentiation
significantly, thus suggesting a potential role of
lamin A as predictive marker of EC aggressiveness
(Figure 1B and Table 2). Lamin A levels were
very similar in G2 and G3 , whereas a significant
Figure 1B.
Average expression of LMNA mRNA expression examined by qRTPCR±SD in EEC tissues. mRNA expression was normalized for 18S
rRNA levels. The error bars indicate the standard error. Statistical
significance: *P<0.05, **P<0.01, ***P<0.001. The error bars indicate
the standard error.
reduction was observed in G2-G3 compared with
G1 samples, thus suggesting that lamin A loss
maybe an early event in EC.
Low levels of lamin A are associated with
myometrial invasion
In our cohort of tissues, clinicopathologic
features indicated that 25,8%, 28,5% and 68,5%
of G1, G2 and G3 EECs analyzed displayed
myometrial infiltration >50%, respectively (Table 1).
Very interestingly, all G1 and G2 samples from
tumors with myometrial invasion > 50% showed
low levels of LMNA, thus suggesting a possible
role of lamin A in tumor invasion prevalently in
early stage of EECs.
Lamin A mRNA levels are associated with ER
loss in low grade EECs
Expression of ERs has been correlated with
EEC stage, histologic grade and survival. It has
been shown that high levels of ERs directly
correlate with better tumor differentiation and
less myometrial invasion. In particular, loss of ERs
has been significantly associated with aggressive
phenotype and poor survival in EEC patients(28).
It is worth to note that the ER-α is predominant
subtype in the human ERs and that a significant
correlation between ER-α protein and ESR-1
mRNA expression has been previously estimated
by microarray and qPCR analysis(29). Therefore,
we firstly evaluated mRNA expression levels
of ER-α (ESR1) in our cohort of samples. Our
data demonstrate that loss of ESR1 expression
correlates with an aggressive clinopathologic
phenotype, confirming data in literature (Figure
2A and Table 2). To explore potential biologic role
of lamin A in process contributing the aggressive
phenotype of ECs, we focused our attention
on transcriptional differences between EECs
expressing (ERs positive) and not expressing (ERs
negative) both ER-α and ER-β, and LMNA mRNA
levels. Clustering of the mRNA expression of ERs
and LMNA indicated a significant association
Table 2.
Clustering of LMNA, ERs, and CDH1 expression levels. EEC histological grade in relation to levels of ERs, LMNA and CDH1 expression.
Lamin A, ESR1, ESR2, and CDH1 mRNA was examined by qRT-PCR. Cut off=ECC over benign samples ≤ 0,5
61
2016, 28: N.2
Figure 2A.
Average expression of ESR1 mRNA examined by qRT-PCR±SD
in EECs (G1, G2, and G3) and benign FFPE tissues (NE). mRNA
expression was normalized for 18S rRNA levels.
Figure 2B.
LMNA expression in ERs negative compared with ERs positive (fold
over control) EEC tissues. Statistical significance: *P<0.05. The
error bars indicate the standard error.
between lack of ERs expression, decreased LMNA
expression (fold over control < 0,5) and higher
histologic differentiation grade (Figure 2B and
Table 2). Very interestingly, all ERs negative G1
and G2 EEC samples expressed concomitantly
low LMNA levels (Table 2). Analysis performed
in G3 EEC specimens, generally expressing
very low levels of ERs and LMNA, displayed a
different behavior since no differences in LMNA
expression levels were detected in ERs positive
compared with ERs negative tissues (Figure 2B),
thus indicating that LMNA down-modulation
associated with ERs loss may be an early event in
EC transformation.
Loss of lamin A is associated with E-cadherin
status in high grade ECs
Several papers support the hypothesis that
E-Cadherin expression patterns in high-grade EC
are associated with more aggressive characters and
poor prognosis to ECs(30, 36-38). Analysis of CDH1
mRNA status in our cohort of ECCs confirmed
these studies. In fact, as shown in Table 2, we
found that 48,4%, 64,3%, and 77,1% displayed
low levels of CDH1 levels (fold over control <
0,5) in G1, G2 and G3 EECs, respectively, thus
indicating that an increase number of cases with
higher grade generally display reduced expression
levels of CDH1 compared with lower grade ECs.
To assess the possible correlation between CDH1
mRNA levels and LMNA expression in our cohort
of EC samples, we compared CDH1 levels in
samples expressing low LMNA levels (fold over
control < 0,5) with those expressing higher LMNA
levels (fold over control > 0,5). Interestingly, we
observed a significant decrease of CDH1 levels in
tissues expressing low levels of LMNA compared
to those expressing higher levels only in G3 EEC
tissues (Figure 3). These evidences suggest an
association between decreased lamin A expression
and low levels of CDH1 in high grade EECs, thus
further indicating a possible involvement of lamin
A in tumor differentiation and aggressiveness and
suggesting its role in EMT.
DISCUSSION
62
Figure 3.
CDH1 expression and LMNA status. Average of CDH1 mRNA
expression examined by qRT-PCR±SD in EEC tissues expressing low
levels of LMNA compared with positive LMNA tissues- The error
bars indicate the standard error. Cut off=ECC over benign samples
≤ 0,5. Statistical significance: **P<0.01. The error bars indicate the
standard error.
Although three quarters of ECs are confined to
the uterus and treated at an early stage, 15%–20%
recur after primary surgery with limited effect
of systemic therapies in metastatic disease(2,31-34).
Thus, one important clinical challenge is to
accurately predict risk of recurrence within this
good prognosis patient subgroup in order to well
selected patient populations for more extensive
surgery and adjuvant therapy. The aim of our
study is to identify novel biomarkers with a
potential for a more systematic integration in
clinical practice for individualized therapy in EC.
We focused our attention on the expression
of lamin A, a nuclear protein involved in cell
differentiation and cancer development. The
expression of lamin A is often reduced or absent in
cells that are highly proliferative, including various
human malignancies such as colon cancer, cervical
cancer, lung cancer, prostate cancer, gastric cancer,
ovarian cancer and leukemia and lymphoma(13,18).
Assessment of lamin A protein and mRNA levels
in our cohort of FFPE tissues displayed a large and
significant decrease of its expression compared
with benign samples. Moreover, we observed a
significant correlation between lamin A loss and
advanced stage disease and a correlation with
increased myomerial infiltration. It is worth to
note that we observed a significant reduction
of LMNA mRNA levels in G1 compared with
higher grades, whereas no differences in its
expression levels were detectable between G2
and G3 EECs, thus suggesting that alteration of
LMNA expression maybe an early event in EC.
The identification of patients with poor prognosis
among the presumed low-risk endometrioid G1
and G2 cases represents a particular therapeutic
challenge. Subgroup analyses of prognostic factors
among patients with endometrioid histology have
confirmed a prognostic value of ERs expression
in curettage specimens in retrospective studies(6-8).
In fact, patients with ERs negative EEC are more
often diagnosed with higher grade and advanced
stage disease (7). Thus, we clustered mRNA
expression of LMNA and ERs. Our data indicated
a significant association between low LMNA
expression and lack of ERs in G1 and G2 EECs,
suggesting that lamin A may represent a novel
prognostic biomarker in low grade EC. Alterations
in E-cadherin expression have been linked to
decreased cell–cell adhesion, metastatic potential,
tumor dedifferentiation, and deep myometrial
invasion in endometrial and other carcinomas.
The hallmarks of EMT in cancer cells include
changed cell morphology and increased metastatic
capabilities in cell migration and invasion(35). A
recent meta-analysis indicated that EC patients
with reduced expression of E-cadherin may have a
poorer prognosis than those with normal or higher
expression of E-cadherin in high grade ECs(36)
and that down-regulation of E-cadherin plays a
major role in EMT and associates with myometrial
invasion, histologic grade and metastasis(37,38). In
this study, we observed that a significant decrease
of CDH1 mRNA was associated with LMNA loss
in G3 tumors, suggesting the possible involvement
of altered LMNA expression in EMT in high grade
EEC.
Our data strongly indicate lamin A as a novel
putative biomarker in EC. We hypothesizes that
lamin A down-modulation in association with ERs
status or CDH1 levels in low grade or high grade
tumors, respectively, may represents a predictive
marker of aggressiveness in EECs. Our findings
also support the concept that divergent molecular
pathways are involved in different histological
grade of ECs.
63
2016, 28: N.2
REFERENCES
64
1) Amant F, Moerman P, Neven P, Timmerman D, Van
Limbergen E, Vergote I. Endometrial cancer. Lancet
2005; 388 (9484): 491-505.
2) Salvesen HB, Carter SL, Mannelqvist M, et al.
Integrated genomic profiling of endometrial carcinoma
associates aggressive tumors with indicators of PI3
kinase activation. Proc Natl Acad Sci USA 2009; 106:
4834–39. Dedes KJ, Wetterskog D, Ashworth A, Kaye
SB, Reis-Filho JS. Emerging therapeutic targets in
endometrial cancer. Nat Rev Clin Oncol 2011; 8: 261–71).
3) Utsunomiya H, Suzuki T, Harada N, Ito K, Matsuzaki
S, Konno R, et al. Analysis of estrogen receptor alpha
and beta in endometrial carcinomas: correlation with
ER beta and clinicopathologic findings in 45 cases. IntJ
Gynecol Pathol . 2000; 4: 335-41.
4) Weihua Z, Saji S, Makinen S, Cheng G, Jensen EV,
Warner M, et al. Estrogen receptor (ER) beta, a
modulator of ERalpha in the uterus. Proc Natl Acad
Sci USA. 2000; 11: 5936-41.
5) Thomas C, Gustafsson JA. The different roles of
ER subtypes in cancer biology and therapy. Nat Rev
Cancer, 2011; (8) 597-608.
6) Zhang Y, Zhao D, Gong C, Zhang F, He J, Zhang
W, Z et al. Prognostic role of hormone receptors in
endometrial cancer: a systematic review and metaanalysis. World J Surg Oncol. 2015;13:208.
7) Backes FJ, Walker CJ, Goodfellow PJ, Hade EM,
Agarwal G, Mutch D, et al. Estrogen receptor-alpha as
a predictive biomarker in endometrioid endometrial
cancer. Gynecol Oncol. 2016;141(2):312-7.
8) Dong Y, Si JW, Li WT, Liang L, Zhao J, Zhou M, et al.
miR-200a/miR-141 and miR-205 upregulation might be
associated with hormone receptor status and prognosis
in endometrial carcinomas. Int J Clin Exp Pathol. 2015
Mar 1;8(3):2864-75.
9) Zhou XM1, Zhang H, Han X . Role of epithelial to
mesenchymal transition proteins in gynecological
cancers: pathological and therapeutic perspectives.
Tumour Biol. 2014 Oct;35(10):9523-30.
10) Tanaka Y, Terai Y, Kawaguchi H, Fujiwara S,
Yoo S, Tsunetoh S, et al. Prognostic impact of EMT
(epithelial-mesenchymal-transition)-related protein
expression in endometrial cancer. Cancer Biol Ther.
2013 Jan;14(1):13-9.
11) Abouhashem NS, Ibrahim DA, Mohamed AM.
Prognostic implications of epithelial to mesenchymal
transition related proteins (E-cadherin, Snail)
and hypoxia inducible factor 1α in endometrioid
endometrial carcinoma. Ann Diagn Pathol. 2016
Jun;22:1-11.
12) Wei-Ning Yang, Zhi-Hong Ai, Juan Wang, YanLi Xu, Yin-Cheng Teng. Correlation between the
overexpression of epidermal growth factor receptor
and mesenchymal makers in endometrial carcinoma.
J Gynecol Oncol. 2014 Jan;25(1):36-42.
13) Foster CR, Przyborski SA, Wilson RG, et al. Lamins
as cancer biomarkers J Biochem Soc Trans. 2010;38(Pt
1):297–300.
14) Prokocimer M, Davidovich M, Nissim-Rafinia M,
Wiesel-Motiuk N, Bar DZ, Barkan R, et al Nuclear
lamins- key regulators of nuclear structure and
activities, J Cell Mol Med. 2009; 13: 1059–85.
15) Capo-chichi CD, Cai KQ, Simpkins F, Ganjei-Azar
P, Godwin AK, Xu XX. Nuclear envelope structural
defects cause chromosomal numerical instability and
aneuploidy in ovarian cancer. BMC Med. 2011; 9-28.
16) Capo-chichi CD, Cai KQ, Smedberg J, Ganjei-Azar P,
Godwin AK, Xu XX. Loss of A-type lamin expression
compromises nuclear envelope integrity in breast
cancer. Chin J Cancer. 2011; 30: 415–25.
17) Belt EJ, Fijneman RJ, van den Berg EG, Bril H, Delisvan Diemen PM, Tijssen M, et al. Loss of LMNA/C
expression in stage II and III colon cancer is associated
with disease recurrence. Eur J Cancer 2011; 47: 1837–45.
18) Wu Z, Wu L, Weng D, Xu D, Geng J, Zhao F.
Reduced expression of LMNA/C correlates with poor
histological differentiation and prognosis in primary
gastric carcinoma. J Exp Clin Cancer Res. 2009; 28-8.
19) Dechat T, Pfleghaar K, Sengupta K, Shimi T,
Shumaker DK, Solimando L, et al. Nuclear lamins:
major factors in the structural organization and
function of the nucleus and chromatin. Genes Dev.
2008 Apr 1;22(7):832-53.
20) Maraldi NM , Capanni C , Del Coco R , Squarzoni
S, Columbaro M, Mattioli E , et al. Muscular
laminopathies- role of preLMNA in early steps
of muscle differentiation. Adv Enzyme Regul.
2011;51:246-56.
21) Camozzi D, Capanni C, Cenni V, Mattioli E,
Columbaro M, Squarzoni S, et al. Diverse lamindependent mechanisms interact to control chromatin
dynamics. Focus on laminopathies. Nucleus. 2014; 5:
427-40.
22) Mattioli E, Columbaro M, Capanni C, Maraldi
NM, Cenni V, Scotlandi K, et al. PreLMNA-mediated
recruitment of SUN1 to the nuclear envelope directs
nuclear positioning in human muscle. Cell Death
Differ. 2011;18:1305-15.
23) Worman HJ, Schirmer EC. Nuclear membrane
diversity- underlying tissue-specific pathologies in
disease? Curr Opin Cell Biol. 2015; 34: 101-12.
24) Barrowman J, Hamblet C, George CM, Michaelis
S. Mol Biol Cell. Analysis of prelamin A biogenesis
reveals the nucleus to be a CaaX processing
compartment. Mol Biol Cell. 2008 Dec;19(12):5398-408.
25) Schlosshauer PW, Ellenson LH, Soslow RA.
Catenin and E-Cadherin Expression Patterns
in High-Grade Endometrial Carcinoma Are
Associated with Histological Subtype. Mod Pathol
2002;15(10):1032–1037.
26) Fujimoto J, Ichigo S, Hirose R, Sakaguchi H,
Tamaya T. Suppression of E-cadherin and alphaand beta-catenin mRNA expression in the metastatic
lesions of gynecological cancers. Eur J Gynaecol Oncol
1997; 18: 484–487.
27) Sakuragi N, Nishiya M, Ikeda K, Ohkouch T,
Furth EE, Hareyama H, et al. Decreased E-cadherin
expression in endometrial carcinoma is associated
with tumor dedifferentiation and deep myometrial
invasion. Gynecol Oncol 1994; 53: 183–189.
28) Zhang Y, Zhao D, Gong C, Zhang F, He J, Zhang
W, et al. Prognostic role of hormone receptors in
endometrial cancer: a systematic review and metaanalysis. World J Surg Oncol. 2015 Jun 25;13:208.
29) Wik E, Ræder MB, Krakstad C, Trovik J, Birkeland
E, Hoivik EA, et al. Lack of estrogen receptor-α is
associated with epithelial-mesenchymal transition
and PI3K alterations in endometrial carcinoma. Clin
Cancer Res. 2013;19(5):1094-105..
30) N-cadherin protein, encoded by the CDH2 gene,
promotes tumor cell survival, migration and invasion,
and a high level of its expression is often associated
with poor prognosis. Gynecol Oncol. 2014 Jan; 25(1):
36–42.
31) Rose PG. Endometrial carcinoma. N Engl J Med.
1996; 9: 640-49.
32) Creasman WT. Prognostic significance of hormone
receptors in endometrial cancer. Cancer 4 (Suppl) 1993;
1467-70.
33) Morrow CP, Bundy BN, Kurman RJ, Creasman WT,
Heller P, Homesley HD, et al. Relationship between
surgicalpathological risk factors and outcome in
clinical stage I and II carcinoma of the endometrium:
a Gynecologic Oncology Group study. Gynecol Oncol
1991; 55-65.
34) Prat J. Prognostic parameters of endometrial
carcinoma. Hum Pathol. 2004;6: 649-62.).
35) Kalluri, R.; Weinberg, R.A. The basics of epithelialmesenchymal transition. J. Clin. Invest. 2009, 119,
1420–28.
36) Zheng X, Du XL, Jiang T. Prognostic significance
of reduced immunohistochemical expression of
E-cadherin in endometrial cancer-results of a metaanalysis. Int J Clin Exp Med. 2015 Oct 15;8(10):18689-96.
37) Mirantes C, Espinosa I, Ferrer I, Dolcet X, Prat J,
Matias-Guiu X. Epithelial-to-mesenchymal transition
and stem cells in endometrial cancer. Human
Pathology, vol. 44, no. 10, pp. 1973–1981, 2013.
38) Montserrat N, Mozos A, Llobet D, Dolcet X, Pons
C, de Herreros AG, et al to mesenchymal transition
in early stage endometrioid endometrial carcinoma.
Human Pathology, vol. 43, no. 5, pp. 632–643, 2012.
65
Riassunto delle Caratteristiche del Prodotto
1. DENOMINAZIONE DEL MEDICINALE: MECLON ® “20% + 4% crema vaginale”
MECLON® “200 mg/10 ml + 1 g/130 ml soluzione vaginale”. 2. COMPOSIZIONE QUALITATIVA E QUANTITATIVA: Crema vaginale. 100 g contengono: Principi attivi: Metronidazolo 20 g; Clotrimazolo 4 g. Eccipienti: contiene sodio metil p-idrossibenzoato e sodio
propil p-idrossibenzoato. Per l’elenco completo degli eccipienti, vedere paragrafo 6.1.
Soluzione vaginale. Flacone da 10 ml. 10 ml contengono: Principio attivo: Clotrimazolo
200 mg. Flacone da 130 ml. 130 ml contengono: Principio attivo: Metronidazolo 1 g.
Eccipienti: contiene sodio metil p-idrossibenzoato e sodio propil p-idrossibenzoato. Per
l’elenco completo degli eccipienti, vedere paragrafo 6.1. 3. FORMA FARMACEUTICA:
Crema vaginale. Soluzione vaginale. 4. INFORMAZIONI CLINICHE: 4.1 Indicazioni
terapeutiche: Crema vaginale. Cervico-vaginiti e vulvo-vaginiti causate da Trichomonas
vaginalis anche se associato a Candida albicans, Gardnerella vaginalis ed altra flora
batterica sensibile. MECLON® crema vaginale può essere impiegato anche nel partner
a scopo profilattico. Soluzione vaginale. Coadiuvante nella terapia di cervico-vaginiti,
vulvo-vaginiti causate da Trichomonas vaginalis anche se associato a Candida albicans,
Gardnerella vaginalis ed altra flora batterica sensibile. MECLON® soluzione vaginale può
essere impiegato anche dopo altra terapia topica od orale, allo scopo di ridurre il rischio di
recidive. 4.2 Posologia e modo di somministrazione: Crema vaginale. Somministrare
profondamente in vagina il contenuto di un applicatore una volta al giorno per almeno
sei giorni consecutivi, preferibilmente alla sera prima di coricarsi, oppure secondo prescrizione medica. Nelle trichomoniasi, maggior sicurezza di risultato terapeutico si verifica
con il contemporaneo uso di Metronidazolo per via orale sia nella donna non gestante
che nel partner maschile. Per un’ottimale somministrazione si consiglia una posizione
supina, con le gambe leggermente piegate ad angolo. Per ottenere una migliore sterilizzazione è preferibile spalmare un po’ di MECLON® crema vaginale anche esternamente,
a livello perivulvare e perianale. Se il medico prescrive il trattamento del partner a scopo
profilattico, la crema deve essere applicata sul glande e sul prepuzio per almeno sei
giorni. Istruzioni per l’uso: Dopo aver riempito di crema un applicatore, somministrare la
crema in vagina mediante pressione sul pistone, fino a completo svuotamento. Soluzione
vaginale. Somministrare la soluzione vaginale pronta una volta al giorno, preferibilmente al
mattino, oppure secondo prescrizione medica. Nella fase di attacco l’uso della soluzione
vaginale deve essere associato ad adeguata terapia topica e/o orale. L’irrigazione va
eseguita preferibilmente in posizione supina. Un lento svuotamento del flacone favorirà
una più prolungata permanenza in vagina dei principi attivi e quindi una più efficace
azione antimicrobica e detergente. Istruzioni per l’uso: Dopo aver versato il contenuto
del flaconcino nel flacone, inserire la cannula vaginale sul collo del flacone stesso. Introdurre
la cannula in vagina e somministrare l’intero contenuto. 4.3 Controindicazioni: Ipersensibilità verso i principi attivi od uno qualsiasi degli eccipienti. 4.4 Avvertenze speciali e
opportune precauzioni d’impiego: Evitare il contatto con gli occhi. Il consigliato impiego contemporaneo di Metronidazolo per via orale è soggetto alle controindicazioni,
effetti collaterali ed avvertenze descritte per il prodotto summenzionato. Evitare il trattamento durante il periodo mestruale. Tenere il medicinale fuori dalla portata e dalla
vista dei bambini. 4.5 Interazioni con altri medicinali e altre forme di interazione:
Nessuna. 4.6 Gravidanza e allattamento: In gravidanza il prodotto deve essere impiegato solo in caso di effettiva necessità e sotto il diretto controllo del medico.
4.7 Effetti sulla capacità di guidare veicoli e sull’uso di macchinari: MECLON ®
non altera la capacità di guidare veicoli o di usare macchinari. 4.8 Effetti indesiderati:
Dato lo scarso assorbimento per applicazione locale dei principi attivi Metronidazolo e
Clotrimazolo, le reazioni avverse riscontrate con le formulazioni topiche sono limitate a:
Disturbi del sistema immunitario: Non nota (la frequenza non può essere definita sulla
base dei dati disponibili): reazioni di ipersensibilità. Patologie della cute e del tessuto
sottocutaneo: Molto rari (frequenza <1/10.000): fenomeni irritativi locali quale prurito,
dermatite allergica da contatto, eruzioni cutanee. L’eventuale manifestarsi di effetti indesiderati comporta l’interruzione del trattamento. 4.9 Sovradosaggio: Non sono stati
descritti sintomi di sovradosaggio. 5. PROPRIETÀ FARMACOLOGICHE: 5.1 Proprietà
farmacodinamiche: Categoria farmacoterapeutica: Antinfettivi ed antisettici ginecologici/Associazioni di derivati imidazolici - Codice ATC: G01AF20. Meccanismo d’azione/
effetti farmacodinamici: Il MECLON ® è una associazione tra Metronidazolo (M) e
Clotrimazolo (C). Il (M) è un derivato nitroimidazolico ad ampio spettro di azione antiprotozoaria e antimicrobica. Ha effetto trichomonicida diretto ed è attivo su cocchi
Gram-positivi anaerobi, bacilli sporigeni, anaerobi Gram-negativi. Presenta attività spiccata
sulla Gardnerella vaginalis. Non è attivo sulla flora acidofila vaginale. Il (C) è un imidazolico
con spettro antifungino molto ampio (Candida, etc.). È attivo anche su Trichomonas
vaginalis, cocchi Gram-positivi, Toxoplasmi, etc. È stato documentato che l’associazione
Clotrimazolo-Metronidazolo dà luogo ad effetti di tipo additivo, pertanto essa è in grado
di conseguire tre vantaggi terapeutici principali: 1) Ampliamento dello spettro d’azione
antimicrobica, per sommazione degli effetti dei due principi attivi; 2) Potenziamento
dell’attività antimicotica, antiprotozoaria ed antibatterica; 3) Abolizione o ritardo della
comparsa dei fenomeni di resistenza. Studi microbiologici in vitro hanno dimostrato che
l’attività trichomonicida e antimicotica risulta potenziata quando il (M) e il (C) sono associati nelle stesse proporzioni che sono presenti nel MECLON®. Anche l’attività antibatterica esaminata su diversi ceppi di microorganismi è risultata elevata ed è emerso
un potenziamento di essa quando i due principi attivi del MECLON® vengono associati.
5.2 Proprietà farmacocinetiche: Dalle indagini farmacocinetiche sui conigli, cani e ratti
risulta che dopo ripetute applicazioni topiche di MECLON® non si rilevano concentrazioni
apprezzabili di Clotrimazolo e Metronidazolo nel sangue. Per applicazione vaginale nella
donna il (M) e il (C) vengono assorbiti in una percentuale che varia tra il 10% e il 20%
circa. 5.3 Dati preclinici di sicurezza: La tossicità acuta del MECLON® nel topo e nel
ratto (os) è risultata molto bassa, con una mortalità di appena il 20% dopo 7 giorni, a
dosi molto elevate (600 mg/Kg di (C) e 3000 mg/Kg di (M), sia da soli che associati).
Nelle prove di tossicità subacuta (30 giorni) il MECLON®, somministrato per via locale
(genitale) nel cane e nel coniglio, non ha determinato alcun tipo di lesione nè locale nè
sistemica anche per dosi molte volte superiori a quelle comunemente impiegate in terapia
umana (3-10 Dtd nel cane e 100-200 Dtd nel coniglio; 1 Dtd = dose terapeutica/die per
l’uomo = ca. 3,33 mg/Kg di (C) e ca. 16,66 mg/Kg di (M)). Il MECLON® somministrato
durante il periodo di gravidanza per via topica vaginale nel coniglio e nel ratto non ha
fatto evidenziare alcun segno di sofferenza fetale per dosi die di 100 Dtd, nè influssi
negativi sullo stato gestazionale. 6. INFORMAZIONI FARMACEUTICHE: 6.1 Elenco
degli eccipienti: Crema vaginale. Eccipienti: Stearato di glicole e polietilenglicole; Paraffina liquida; Sodio metile p-idrossibenzoato; Sodio propile p-idrossibenzoato; Acqua
depurata. Soluzione vaginale. Flacone da 10 ml. Eccipienti: Alcool ricinoleilico; Etanolo;
Acqua depurata. Flacone da 130 ml. Eccipienti: Sodio metile p-idrossibenzoato; Sodio
propile p-idrossibenzoato; Acqua depurata. 6.2 Incompatibilità: Non sono note incompatibilità con altri farmaci. 6.3 Periodo di validità: Crema vaginale: 3 anni. Soluzione
vaginale: 3 anni. 6.4 Precauzioni particolari per la conservazione: Questo medicinale
non richiede alcuna particolare condizione per la conservazione. 6.5 Natura e contenuto
del contenitore: MECLON® crema vaginale. Tubo in alluminio verniciato internamente
con resine epossidiche e fenoliche. Gli applicatori monouso sono di polietilene. Tubo da
30 g + 6 applicatori monouso. MECLON® soluzione vaginale. Flaconi di polietilene a
bassa densità; flaconcini di polietilene; cannule vaginali di polietilene. 5 flaconi da 10 ml
+ 5 flaconi da 130 ml + 5 cannule vaginali monouso. 6.6 Precauzioni particolari
per lo smaltimento e la manipolazione: Nessuna istruzione particolare. 7. TITOLARE
DELL’AUTORIZZAZIONE ALL’IMMISSIONE IN COMMERCIO: ALFA WASSERMANN
S.p.A. - Sede legale: Via E. Fermi, n. 1 - Alanno (PE). Sede amministrativa: Via Ragazzi
del ‘99, n. 5 - Bologna. 8. NUMERI DELL’AUTORIZZAZIONE ALL’IMMISSIONE IN
COMMERCIO: MECLON® crema vaginale: A.I.C. n. 023703046. MECLON® soluzione
vaginale: A.I.C. n. 023703059. 9. DATA DELLA PRIMA AUTORIZZAZIONE/RINNOVO
DELL’AUTORIZZAZIONE: 11.05.1991 (GU 07.10.1991) / 01.06.2010. 10. DATA DI
REVISIONE DEL TESTO: Determinazione AIFA del 27 Ottobre 2010.
20% + 4% crema vaginale, tubo da 30 g + 6 applicatori.
Prezzo: € 12,50.
200 mg/10 ml + 1 g/130 ml soluzione vaginale,
5 flac. 10 ml + 5 flac. 130 ml + 5 cannule. Prezzo: € 13,80.
Medicinale non soggetto a prescrizione medica (SOP). CLASSE C.
1. DENOMINAZIONE DEL MEDICINALE: MECLON® “100 mg + 500 mg ovuli”. 2.
COMPOSIZIONE QUALITATIVA E QUANTITATIVA: Un ovulo da 2,4 g contiene: Principi
attivi: Metronidazolo 500 mg; Clotrimazolo 100 mg. Per l’elenco completo degli eccipienti, vedere paragrafo 6.1. 3. FORMA FARMACEUTICA: Ovuli. 4. INFORMAZIONI
CLINICHE: 4.1 Indicazioni terapeutiche: Cerviciti, cervico-vaginiti, vaginiti e vulvo-vaginiti da Trichomonas vaginalis anche se associato a Candida o con componente batterica. 4.2 Posologia e modo di somministrazione: Lo schema terapeutico ottimale risulta il seguente: 1 ovulo di MECLON® in vagina, 1 volta al dì. 4.3 Controindicazioni:
Ipersensibilità verso i principi attivi od uno qualsiasi degli eccipienti. 4.4 Avvertenze
speciali e opportune precauzioni d’impiego: Evitare il contatto con gli occhi. Il consigliato impiego contemporaneo di Metronidazolo per via orale è soggetto alle controindicazioni, effetti collaterali ed avvertenze descritte per il prodotto summenzionato.
MECLON® ovuli va impiegato nella prima infanzia sotto il diretto controllo del medico e
solo nei casi di effettiva necessità. Tenere il medicinale fuori dalla portata e dalla vista
dei bambini. 4.5 Interazioni con altri medicinali e altre forme di interazione:
Nessuna. 4.6 Gravidanza e allattamento: In gravidanza il prodotto deve essere impiegato solo in caso di effettiva necessità e sotto il diretto controllo del medico. 4.7 Effetti
sulla capacità di guidare veicoli e sull’uso di macchinari: MECLON® non altera la
capacità di guidare veicoli o di usare macchinari. 4.8 Effetti indesiderati: Dato lo scarso assorbimento per applicazione locale dei principi attivi Metronidazolo e Clotrimazolo,
le reazioni avverse riscontrate con le formulazioni topiche sono limitate a: Disturbi del
sistema immunitario: Non nota (la frequenza non può essere definita sulla base dei dati
disponibili): reazioni di ipersensibilità. Patologie della cute e del tessuto sottocutaneo:
Molto rari (frequenza <1/10.000): fenomeni irritativi locali quale prurito, dermatite allergica da contatto, eruzioni cutanee. L’eventuale manifestarsi di effetti indesiderati comporta l’interruzione del trattamento. 4.9 Sovradosaggio: Non sono stati descritti sintomi
di sovradosaggio. 5. PROPRIETÀ FARMACOLOGICHE: 5.1 Proprietà farmacodinamiche: Categoria farmacoterapeutica: Antinfettivi ed antisettici ginecologici/Associazioni
di derivati imidazolici - Codice ATC: G01AF20. Meccanismo d’azione/effetti farmacodinamici: Il MECLON® è una associazione tra metronidazolo (M) e clotrimazolo (C). Il (M) è
un derivato nitroimidazolico ad ampio spettro di azione antiprotozoaria e antimicrobica.
Ha effetto trichomonicida diretto ed è attivo su cocchi Gram-positivi anaerobi, bacilli
sporigeni, anaerobi Gram-negativi. Presenta attività spiccata sulla Gardnerella vaginalis.
Non è attivo sulla flora acidofila vaginale. Il (C) è un imidazolico con spettro antifungino
molto ampio (Candida, etc.). È attivo anche su Trichomonas vaginalis, cocchi Grampositivi, Toxoplasmi, etc. È stato documentato che l’associazione ClotrimazoloMetronidazolo dà luogo ad effetti di tipo additivo, pertanto essa è in grado di conseguire
tre vantaggi terapeutici principali: 1) Ampliamento dello spettro d’azione antimicrobica,
per sommazione degli effetti dei due principi attivi; 2) Potenziamento dell’attività antimi-
cotica, antiprotozoaria ed antibatterica; 3) Abolizione o ritardo della comparsa dei fenomeni di resistenza. Studi microbiologici in vitro hanno dimostrato che l’attività trichomonicida e antimicotica risulta potenziata quando il (M) e il (C) sono associati nelle stesse
proporzioni che sono presenti nel MECLON®. Anche l’attività antibatterica esaminata su
diversi ceppi di microorganismi è risultata elevata ed è emerso un potenziamento di essa
quando i due principi attivi del MECLON® vengono associati. 5.2 Proprietà farmacocinetiche: Dalle indagini farmacocinetiche sui conigli, cani e ratti risulta che dopo ripetute
applicazioni topiche di MECLON® non si rilevano concentrazioni apprezzabili di
Clotrimazolo e Metronidazolo nel sangue. Per applicazione vaginale nella donna il (M) e
il (C) vengono assorbiti in una percentuale che varia tra il 10% e il 20% circa. 5.3 Dati
preclinici di sicurezza: La tossicità acuta del MECLON® nel topo e nel ratto (os) è risultata molto bassa, con una mortalità di appena il 20% dopo 7 giorni, a dosi molto elevate
(600 mg/Kg di (C) e 3000 mg/Kg di (M), sia da soli che associati). Nelle prove di tossicità subacuta (30 giorni) il MECLON®, somministrato per via locale (genitale) nel cane e
nel coniglio, non ha determinato alcun tipo di lesione nè locale nè sistemica anche per
dosi molte volte superiori a quelle comunemente impiegate in terapia umana (3-10 Dtd
nel cane e 100-200 Dtd nel coniglio; 1 Dtd = dose terapeutica/die per l’uomo = ca. 3,33
mg/Kg di (C) e ca. 16,66 mg/Kg di (M)). Il MECLON® somministrato durante il periodo di
gravidanza per via topica vaginale nel coniglio e nel ratto non ha fatto evidenziare alcun
segno di sofferenza fetale per dosi die di 100 Dtd, nè influssi negativi sullo stato gestazionale. 6. INFORMAZIONI FARMACEUTICHE: 6.1 Elenco degli eccipienti: Eccipienti:
Miscela idrofila di mono, di, tri-gliceridi di acidi grassi saturi. 6.2 Incompatibilità: Non
sono note incompatibilità con altri farmaci. 6.3 Periodo di validità: 3 anni. 6.4
Precauzioni particolari per la conservazione: Questo medicinale non richiede alcuna
particolare condizione per la conservazione. 6.5 Natura e contenuto del contenitore:
10 ovuli in valve in PVC, racchiusi in scatola di cartone. 6.6 Precauzioni particolari per
lo smaltimento e la manipolazione: Nessuna istruzione particolare. 7. TITOLARE
DELL’AUTORIZZAZIONE ALL’IMMISSIONE IN COMMERCIO: ALFA WASSERMANN
S.p.A. - Sede legale: Via E. Fermi, n. 1 - Alanno (PE). Sede amministrativa: Via Ragazzi
del ‘99, n. 5 - Bologna. 8. NUMERO DELL’AUTORIZZAZIONE ALL’IMMISSIONE IN
COMMERCIO: A.I.C. n. 023703010. 9. DATA DELLA PRIMA AUTORIZZAZIONE/
RINNOVO DELL’AUTORIZZAZIONE: 27.11.1978 (GU 16.01.1979) / 01.06.2010.
10. DATA DI REVISIONE DEL TESTO: Determinazione AIFA del 27 Ottobre 2010.
100 mg + 500 mg ovuli, 10 ovuli. Prezzo: € 12,50.
Medicinale non soggetto a prescrizione medica (SOP). CLASSE C.

Italian Journal of Gynaecology and Obstetrics

Transcript

Documenti analoghi

Dr. Edgardo Somigliana CURRICULUM VITAE Dati anagrafici: Nato

Test rapido per la diagnosi precoce dello stato di

EXPECTANT MOTHER Italian

gravidanza su istmocele: caso clinico

Gravidanza cervico-istmica su pregressa cicatrice

BANCA DI CAMBIANO ASSICURA IL MUTUO CON AFI ESCA

Nausea e vomito in gravidanza

MOSTRA ARTE AFRICANA

programma evento - AFI - Associazione Farmaceutici Industria

Scarica il programma